General Information of Drug Transporter (DT)
DT ID DTD0263 Transporter Info
Gene Name SLC2A5
Transporter Name Glucose transporter type 5, small intestine
Gene ID
6518
UniProt ID
P22732
Epigenetic Regulations of This DT (EGR)

Methylation

  Hepatocellular carcinoma

           9 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC2A5 in hepatocellular carcinoma [ 1 ]

Location

5'UTR (cg04305621)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.32E+00 Statistic Test p-value:1.10E-13; Z-score:2.23E+00

Methylation in Case

5.73E-01 (Median) Methylation in Control 4.34E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC2A5 in hepatocellular carcinoma [ 1 ]

Location

TSS1500 (cg01532168)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:5.35E+00 Statistic Test p-value:9.64E-21; Z-score:6.22E+00

Methylation in Case

4.11E-01 (Median) Methylation in Control 7.67E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC2A5 in hepatocellular carcinoma [ 1 ]

Location

TSS1500 (cg23737366)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:1.31E-05; Z-score:-9.56E-01

Methylation in Case

7.96E-01 (Median) Methylation in Control 8.27E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC2A5 in hepatocellular carcinoma [ 1 ]

Location

Body (cg13869484)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.21E+00 Statistic Test p-value:1.93E-07; Z-score:-1.70E+00

Methylation in Case

5.20E-01 (Median) Methylation in Control 6.31E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC2A5 in hepatocellular carcinoma [ 1 ]

Location

Body (cg02289343)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:2.08E-07; Z-score:-2.03E+00

Methylation in Case

8.17E-01 (Median) Methylation in Control 9.03E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC2A5 in hepatocellular carcinoma [ 1 ]

Location

Body (cg06188496)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:1.59E-05; Z-score:-1.10E+00

Methylation in Case

6.36E-01 (Median) Methylation in Control 7.02E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC2A5 in hepatocellular carcinoma [ 1 ]

Location

Body (cg21689824)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:3.32E-05; Z-score:-1.16E+00

Methylation in Case

6.29E-01 (Median) Methylation in Control 6.87E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC2A5 in hepatocellular carcinoma [ 1 ]

Location

Body (cg25602242)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.18E+00 Statistic Test p-value:7.81E-05; Z-score:1.26E+00

Methylation in Case

6.30E-01 (Median) Methylation in Control 5.35E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC2A5 in hepatocellular carcinoma [ 1 ]

Location

Body (cg14565651)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:1.64E-02; Z-score:-2.87E-01

Methylation in Case

6.28E-01 (Median) Methylation in Control 6.42E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Bladder cancer

           7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC2A5 in bladder cancer [ 2 ]

Location

TSS1500 (cg16104584)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.15E+00 Statistic Test p-value:1.89E-02; Z-score:-2.71E+00

Methylation in Case

5.35E-01 (Median) Methylation in Control 6.14E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC2A5 in bladder cancer [ 2 ]

Location

Body (cg14565651)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.07E+00 Statistic Test p-value:4.84E-10; Z-score:-1.51E+01

Methylation in Case

2.47E-01 (Median) Methylation in Control 5.11E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC2A5 in bladder cancer [ 2 ]

Location

Body (cg02289343)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.35E+00 Statistic Test p-value:2.53E-04; Z-score:-2.73E+00

Methylation in Case

5.37E-01 (Median) Methylation in Control 7.26E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC2A5 in bladder cancer [ 2 ]

Location

Body (cg17554996)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.12E+00 Statistic Test p-value:7.23E-03; Z-score:-1.98E+00

Methylation in Case

6.75E-01 (Median) Methylation in Control 7.57E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC2A5 in bladder cancer [ 2 ]

Location

Body (cg13869484)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.14E+00 Statistic Test p-value:1.82E-02; Z-score:-2.34E+00

Methylation in Case

6.46E-01 (Median) Methylation in Control 7.36E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC2A5 in bladder cancer [ 2 ]

Location

Body (cg17243628)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.27E+00 Statistic Test p-value:4.51E-02; Z-score:-2.61E+00

Methylation in Case

5.95E-01 (Median) Methylation in Control 7.56E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC2A5 in bladder cancer [ 2 ]

Location

Body (cg25602242)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.15E+00 Statistic Test p-value:4.91E-02; Z-score:1.97E+00

Methylation in Case

7.48E-01 (Median) Methylation in Control 6.49E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Breast cancer

         11 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC2A5 in breast cancer [ 3 ]

Location

TSS1500 (cg23737366)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.12E+00 Statistic Test p-value:1.25E-11; Z-score:2.38E+00

Methylation in Case

7.33E-01 (Median) Methylation in Control 6.51E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC2A5 in breast cancer [ 3 ]

Location

TSS1500 (cg16104584)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.40E+00 Statistic Test p-value:5.28E-06; Z-score:-1.56E+00

Methylation in Case

3.44E-01 (Median) Methylation in Control 4.81E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC2A5 in breast cancer [ 3 ]

Location

Body (cg13869484)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.68E+00 Statistic Test p-value:8.43E-19; Z-score:-4.39E+00

Methylation in Case

4.12E-01 (Median) Methylation in Control 6.94E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC2A5 in breast cancer [ 3 ]

Location

Body (cg06188496)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.24E+00 Statistic Test p-value:8.65E-12; Z-score:-2.01E+00

Methylation in Case

6.73E-01 (Median) Methylation in Control 8.34E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC2A5 in breast cancer [ 3 ]

Location

Body (cg25602242)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.15E+00 Statistic Test p-value:3.98E-03; Z-score:-9.33E-01

Methylation in Case

5.75E-01 (Median) Methylation in Control 6.62E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC2A5 in breast cancer [ 3 ]

Location

Body (cg17554996)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:4.14E-03; Z-score:-5.86E-01

Methylation in Case

6.53E-01 (Median) Methylation in Control 7.10E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC2A5 in breast cancer [ 3 ]

Location

Body (cg02289343)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.38E+00 Statistic Test p-value:5.30E-03; Z-score:-9.19E-01

Methylation in Case

5.07E-01 (Median) Methylation in Control 7.01E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC2A5 in breast cancer [ 3 ]

Location

Body (cg17243628)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.13E+00 Statistic Test p-value:2.19E-02; Z-score:-8.01E-01

Methylation in Case

5.95E-01 (Median) Methylation in Control 6.73E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC2A5 in breast cancer [ 3 ]

Location

Body (cg21689824)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:2.66E-02; Z-score:-6.16E-01

Methylation in Case

5.00E-01 (Median) Methylation in Control 5.21E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC2A5 in breast cancer [ 3 ]

Location

Body (cg14565651)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:2.76E-02; Z-score:-6.85E-01

Methylation in Case

5.01E-01 (Median) Methylation in Control 5.36E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC2A5 in breast cancer [ 3 ]

Location

Body (cg18800329)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:3.29E-02; Z-score:-5.51E-01

Methylation in Case

8.23E-01 (Median) Methylation in Control 8.51E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Colorectal cancer

           6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC2A5 in colorectal cancer [ 4 ]

Location

TSS1500 (cg16104584)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.53E+00 Statistic Test p-value:9.88E-13; Z-score:-2.88E+00

Methylation in Case

4.26E-01 (Median) Methylation in Control 6.50E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC2A5 in colorectal cancer [ 4 ]

Location

TSS1500 (cg23737366)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:8.47E-05; Z-score:-1.38E+00

Methylation in Case

8.66E-01 (Median) Methylation in Control 8.93E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC2A5 in colorectal cancer [ 4 ]

Location

Body (cg21689824)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:2.02E-04; Z-score:-9.99E-01

Methylation in Case

7.77E-01 (Median) Methylation in Control 8.34E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC2A5 in colorectal cancer [ 4 ]

Location

Body (cg13869484)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:1.04E-03; Z-score:-6.19E-01

Methylation in Case

8.10E-01 (Median) Methylation in Control 8.50E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC2A5 in colorectal cancer [ 4 ]

Location

Body (cg25602242)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:1.60E-02; Z-score:-4.71E-01

Methylation in Case

8.31E-01 (Median) Methylation in Control 8.54E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  HIV infection

           8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC2A5 in HIV infection [ 5 ]

Location

TSS1500 (cg16104584)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.32E+00 Statistic Test p-value:5.14E-04; Z-score:1.50E+00

Methylation in Case

4.00E-01 (Median) Methylation in Control 3.02E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC2A5 in HIV infection [ 5 ]

Location

Body (cg17243628)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.25E+00 Statistic Test p-value:6.61E-15; Z-score:5.11E+00

Methylation in Case

9.28E-01 (Median) Methylation in Control 7.44E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC2A5 in HIV infection [ 5 ]

Location

Body (cg17554996)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.11E+00 Statistic Test p-value:1.31E-13; Z-score:2.66E+00

Methylation in Case

8.56E-01 (Median) Methylation in Control 7.74E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC2A5 in HIV infection [ 5 ]

Location

Body (cg13869484)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.45E+00 Statistic Test p-value:2.86E-10; Z-score:-2.80E+00

Methylation in Case

4.41E-01 (Median) Methylation in Control 6.40E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC2A5 in HIV infection [ 5 ]

Location

Body (cg25602242)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.66E+00 Statistic Test p-value:1.63E-09; Z-score:3.63E+00

Methylation in Case

3.15E-01 (Median) Methylation in Control 1.90E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC2A5 in HIV infection [ 5 ]

Location

Body (cg06188496)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.43E+00 Statistic Test p-value:4.92E-08; Z-score:2.12E+00

Methylation in Case

4.90E-01 (Median) Methylation in Control 3.42E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC2A5 in HIV infection [ 5 ]

Location

Body (cg14565651)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.39E+00 Statistic Test p-value:5.01E-08; Z-score:2.93E+00

Methylation in Case

4.99E-01 (Median) Methylation in Control 3.58E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC2A5 in HIV infection [ 5 ]

Location

Body (cg21689824)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.18E+00 Statistic Test p-value:1.05E-06; Z-score:1.46E+00

Methylation in Case

3.89E-01 (Median) Methylation in Control 3.30E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC2A5 in papillary thyroid cancer [ 6 ]

Location

TSS1500 (cg16104584)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:4.40E-05; Z-score:-1.30E+00

Methylation in Case

6.79E-01 (Median) Methylation in Control 7.46E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC2A5 in papillary thyroid cancer [ 6 ]

Location

Body (cg17243628)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.11E+00 Statistic Test p-value:3.85E-03; Z-score:9.49E-01

Methylation in Case

8.18E-01 (Median) Methylation in Control 7.39E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC2A5 in papillary thyroid cancer [ 6 ]

Location

Body (cg25602242)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:4.53E-03; Z-score:6.33E-01

Methylation in Case

7.14E-01 (Median) Methylation in Control 6.81E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Systemic lupus erythematosus

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC2A5 in systemic lupus erythematosus [ 7 ]

Location

TSS1500 (cg16104584)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.14E+00 Statistic Test p-value:1.08E-02; Z-score:-3.65E-01

Methylation in Case

5.15E-01 (Median) Methylation in Control 5.86E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC2A5 in systemic lupus erythematosus [ 7 ]

Location

Body (cg25602242)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.08E+00 Statistic Test p-value:1.91E-02; Z-score:2.41E-01

Methylation in Case

3.66E-01 (Median) Methylation in Control 3.39E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC2A5 in systemic lupus erythematosus [ 7 ]

Location

Body (cg17243628)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:2.12E-02; Z-score:-1.65E-01

Methylation in Case

9.30E-01 (Median) Methylation in Control 9.36E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Pancretic ductal adenocarcinoma

           8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC2A5 in pancretic ductal adenocarcinoma [ 8 ]

Location

TSS200 (cg23752563)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.95E+00 Statistic Test p-value:3.41E-10; Z-score:1.70E+00

Methylation in Case

3.32E-01 (Median) Methylation in Control 1.71E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC2A5 in pancretic ductal adenocarcinoma [ 8 ]

Location

TSS200 (cg06646493)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.13E+00 Statistic Test p-value:9.44E-04; Z-score:-8.01E-01

Methylation in Case

1.47E-01 (Median) Methylation in Control 1.66E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC2A5 in pancretic ductal adenocarcinoma [ 8 ]

Location

Body (cg22284058)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.11E+00 Statistic Test p-value:6.78E-04; Z-score:9.90E-01

Methylation in Case

7.25E-01 (Median) Methylation in Control 6.52E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC2A5 in pancretic ductal adenocarcinoma [ 8 ]

Location

Body (cg18274791)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:7.35E-04; Z-score:6.29E-01

Methylation in Case

9.44E-01 (Median) Methylation in Control 9.22E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC2A5 in pancretic ductal adenocarcinoma [ 8 ]

Location

Body (cg13359765)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.15E+00 Statistic Test p-value:7.27E-03; Z-score:-8.36E-01

Methylation in Case

3.09E-01 (Median) Methylation in Control 3.56E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC2A5 in pancretic ductal adenocarcinoma [ 8 ]

Location

Body (cg07478944)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.03E+00 Statistic Test p-value:1.01E-02; Z-score:8.89E-01

Methylation in Case

8.80E-01 (Median) Methylation in Control 8.56E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC2A5 in pancretic ductal adenocarcinoma [ 8 ]

Location

Body (cg03971338)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.01E+00 Statistic Test p-value:1.10E-02; Z-score:6.10E-02

Methylation in Case

8.61E-01 (Median) Methylation in Control 8.54E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC2A5 in pancretic ductal adenocarcinoma [ 8 ]

Location

Body (cg23701033)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:1.41E-02; Z-score:-5.95E-01

Methylation in Case

6.22E-01 (Median) Methylation in Control 6.64E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Atypical teratoid rhabdoid tumor

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC2A5 in atypical teratoid rhabdoid tumor [ 9 ]

Location

Body (cg02289343)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.22E+00 Statistic Test p-value:1.42E-04; Z-score:-8.27E-01

Methylation in Case

9.69E-02 (Median) Methylation in Control 2.15E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC2A5 in atypical teratoid rhabdoid tumor [ 9 ]

Location

Body (cg06188496)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:2.24E-03; Z-score:4.73E-01

Methylation in Case

8.80E-01 (Median) Methylation in Control 8.48E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC2A5 in atypical teratoid rhabdoid tumor [ 9 ]

Location

Body (cg13869484)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.03E+00 Statistic Test p-value:3.96E-02; Z-score:4.24E-01

Methylation in Case

8.94E-01 (Median) Methylation in Control 8.65E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC2A5 in atypical teratoid rhabdoid tumor [ 9 ]

Location

Body (cg14565651)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.64E+00 Statistic Test p-value:4.78E-02; Z-score:-1.89E-01

Methylation in Case

3.14E-02 (Median) Methylation in Control 5.15E-02 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Lung adenocarcinoma

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC2A5 in lung adenocarcinoma [ 10 ]

Location

Body (cg17554996)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:2.04E-03; Z-score:1.93E+00

Methylation in Case

8.72E-01 (Median) Methylation in Control 8.27E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC2A5 in lung adenocarcinoma [ 10 ]

Location

Body (cg13869484)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.32E+00 Statistic Test p-value:1.59E-02; Z-score:-1.69E+00

Methylation in Case

5.51E-01 (Median) Methylation in Control 7.26E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Panic disorder

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC2A5 in panic disorder [ 11 ]

Location

Body (cg17554996)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.16E+00 Statistic Test p-value:2.36E-03; Z-score:-5.73E-01

Methylation in Case

1.31E+00 (Median) Methylation in Control 1.52E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC2A5 in panic disorder [ 11 ]

Location

Body (cg06188496)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-9.09E-01 Statistic Test p-value:3.49E-03; Z-score:-3.53E-01

Methylation in Case

-1.49E+00 (Median) Methylation in Control -1.36E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC2A5 in panic disorder [ 11 ]

Location

Body (cg17243628)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:1.98E-02; Z-score:-2.98E-01

Methylation in Case

1.35E+00 (Median) Methylation in Control 1.49E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC2A5 in panic disorder [ 11 ]

Location

Body (cg13869484)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:3.31E-01 Statistic Test p-value:4.35E-02; Z-score:4.80E-01

Methylation in Case

-8.30E-02 (Median) Methylation in Control -2.51E-01 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Prostate cancer

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC2A5 in prostate cancer [ 12 ]

Location

Body (cg20439022)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.39E+00 Statistic Test p-value:4.79E-03; Z-score:2.84E+00

Methylation in Case

6.27E-01 (Median) Methylation in Control 4.50E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC2A5 in prostate cancer [ 12 ]

Location

Body (cg20561863)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.85E+00 Statistic Test p-value:1.73E-02; Z-score:2.72E+00

Methylation in Case

5.46E-01 (Median) Methylation in Control 2.95E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC2A5 in prostate cancer [ 12 ]

Location

Body (cg17383222)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.35E+00 Statistic Test p-value:1.79E-02; Z-score:2.57E+00

Methylation in Case

7.72E-01 (Median) Methylation in Control 5.71E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Lymphoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of SLC2A5 in lymphoma than that in healthy individual

Studied Phenotype

Lymphoma [ICD-11:2B30]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:7.88E-09; Fold-change:-0.515929085; Z-score:-15.86772438
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

Histone acetylation

  Fructose-fed mice

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Hypoacetylation of SLC2A5 in fructose force-fed mice (compare with glucose force-fed mice) [ 13 ]

Location

Promoter

Epigenetic Type

Histone acetylation Experiment Method Chromatin immunoprecipitation

Related Molecular Changes

Up regulation ofSLC2A5 Experiment Method RT-qPCR

Studied Phenotype

Fructose-fed mice

Experimental Material

Model organism in vivo (mouse)

Additional Notes

Jejunal expression of Slc2a5 by fructose force-feeding involved inducing the acetylation of histone H3 at K9 and of H4 at K5/16 around the Slc2a5 gene.

  Epigenetic Phenomenon2

Hypoacetylation of SLC2A5 in fructose force-fed mice (compare with glucose force-fed mice) [ 13 ]

Location

Promoter

Epigenetic Type

Histone acetylation Experiment Method Chromatin immunoprecipitation

Related Molecular Changes

Up regulation ofSLC2A5 Experiment Method RT-qPCR

Studied Phenotype

Fructose-fed mice

Experimental Material

Model organism in vivo (mouse)

Additional Notes

Jejunal expression of Slc2a5 by fructose force-feeding involved inducing the acetylation of histone H3 at K9 and of H4 at K5/16 around the Slc2a5 gene.

microRNA

  Unclear Phenotype

         49 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-1226 directly targets SLC2A5 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1226 miRNA Mature ID miR-1226-5p

miRNA Sequence

GUGAGGGCAUGCAGGCCUGGAUGGGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon2

miR-1247 directly targets SLC2A5 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1247 miRNA Mature ID miR-1247-3p

miRNA Sequence

CCCCGGGAACGUCGAGACUGGAGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon3

miR-1266 directly targets SLC2A5 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1266 miRNA Mature ID miR-1266-3p

miRNA Sequence

CCCUGUUCUAUGCCCUGAGGGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon4

miR-1304 directly targets SLC2A5 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1304 miRNA Mature ID miR-1304-5p

miRNA Sequence

UUUGAGGCUACAGUGAGAUGUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon5

miR-140 directly targets SLC2A5 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-140 miRNA Mature ID miR-140-3p

miRNA Sequence

UACCACAGGGUAGAACCACGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon6

miR-1827 directly targets SLC2A5 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1827 miRNA Mature ID miR-1827

miRNA Sequence

UGAGGCAGUAGAUUGAAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon7

miR-1914 directly targets SLC2A5 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1914 miRNA Mature ID miR-1914-3p

miRNA Sequence

GGAGGGGUCCCGCACUGGGAGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon8

miR-3135a directly targets SLC2A5 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3135a miRNA Mature ID miR-3135a

miRNA Sequence

UGCCUAGGCUGAGACUGCAGUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon9

miR-3184 directly targets SLC2A5 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3184 miRNA Mature ID miR-3184-5p

miRNA Sequence

UGAGGGGCCUCAGACCGAGCUUUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon10

miR-3650 directly targets SLC2A5 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3650 miRNA Mature ID miR-3650

miRNA Sequence

AGGUGUGUCUGUAGAGUCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon11

miR-3664 directly targets SLC2A5 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3664 miRNA Mature ID miR-3664-3p

miRNA Sequence

UCUCAGGAGUAAAGACAGAGUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon12

miR-3689d directly targets SLC2A5 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3689d miRNA Mature ID miR-3689d

miRNA Sequence

GGGAGGUGUGAUCUCACACUCG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon13

miR-383 directly targets SLC2A5 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-383 miRNA Mature ID miR-383-3p

miRNA Sequence

ACAGCACUGCCUGGUCAGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon14

miR-3914 directly targets SLC2A5 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3914 miRNA Mature ID miR-3914

miRNA Sequence

AAGGAACCAGAAAAUGAGAAGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon15

miR-3929 directly targets SLC2A5 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3929 miRNA Mature ID miR-3929

miRNA Sequence

GAGGCUGAUGUGAGUAGACCACU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon16

miR-423 directly targets SLC2A5 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-423 miRNA Mature ID miR-423-5p

miRNA Sequence

UGAGGGGCAGAGAGCGAGACUUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon17

miR-4302 directly targets SLC2A5 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4302 miRNA Mature ID miR-4302

miRNA Sequence

CCAGUGUGGCUCAGCGAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon18

miR-4326 directly targets SLC2A5 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4326 miRNA Mature ID miR-4326

miRNA Sequence

UGUUCCUCUGUCUCCCAGAC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon19

miR-4433a directly targets SLC2A5 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4433a miRNA Mature ID miR-4433a-3p

miRNA Sequence

ACAGGAGUGGGGGUGGGACAU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon20

miR-4478 directly targets SLC2A5 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4478 miRNA Mature ID miR-4478

miRNA Sequence

GAGGCUGAGCUGAGGAG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon21

miR-4649 directly targets SLC2A5 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4649 miRNA Mature ID miR-4649-3p

miRNA Sequence

UCUGAGGCCUGCCUCUCCCCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon22

miR-4695 directly targets SLC2A5 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4695 miRNA Mature ID miR-4695-5p

miRNA Sequence

CAGGAGGCAGUGGGCGAGCAGG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon23

miR-4722 directly targets SLC2A5 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4722 miRNA Mature ID miR-4722-5p

miRNA Sequence

GGCAGGAGGGCUGUGCCAGGUUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon24

miR-4768 directly targets SLC2A5 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4768 miRNA Mature ID miR-4768-3p

miRNA Sequence

CCAGGAGAUCCAGAGAGAAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon25

miR-4790 directly targets SLC2A5 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4790 miRNA Mature ID miR-4790-3p

miRNA Sequence

UGAAUGGUAAAGCGAUGUCACA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon26

miR-485 directly targets SLC2A5 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-485 miRNA Mature ID miR-485-5p

miRNA Sequence

AGAGGCUGGCCGUGAUGAAUUC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon27

miR-510 directly targets SLC2A5 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-510 miRNA Mature ID miR-510-5p

miRNA Sequence

UACUCAGGAGAGUGGCAAUCAC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon28

miR-512 directly targets SLC2A5 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-512 miRNA Mature ID miR-512-5p

miRNA Sequence

CACUCAGCCUUGAGGGCACUUUC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon29

miR-5194 directly targets SLC2A5 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-5194 miRNA Mature ID miR-5194

miRNA Sequence

UGAGGGGUUUGGAAUGGGAUGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon30

miR-649 directly targets SLC2A5 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-649 miRNA Mature ID miR-649

miRNA Sequence

AAACCUGUGUUGUUCAAGAGUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon31

miR-665 directly targets SLC2A5 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-665 miRNA Mature ID miR-665

miRNA Sequence

ACCAGGAGGCUGAGGCCCCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon32

miR-670 directly targets SLC2A5 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-670 miRNA Mature ID miR-670-3p

miRNA Sequence

UUUCCUCAUAUUCAUUCAGGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon33

miR-6733 directly targets SLC2A5 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6733 miRNA Mature ID miR-6733-3p

miRNA Sequence

UCAGUGUCUGGAUUUCCUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon34

miR-6734 directly targets SLC2A5 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6734 miRNA Mature ID miR-6734-5p

miRNA Sequence

UUGAGGGGAGAAUGAGGUGGAGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon35

miR-6738 directly targets SLC2A5 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6738 miRNA Mature ID miR-6738-5p

miRNA Sequence

CGAGGGGUAGAAGAGCACAGGGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon36

miR-6799 directly targets SLC2A5 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6799 miRNA Mature ID miR-6799-5p

miRNA Sequence

GGGGAGGUGUGCAGGGCUGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon37

miR-6802 directly targets SLC2A5 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6802 miRNA Mature ID miR-6802-5p

miRNA Sequence

CUAGGUGGGGGGCUUGAAGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon38

miR-6808 directly targets SLC2A5 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6808 miRNA Mature ID miR-6808-5p

miRNA Sequence

CAGGCAGGGAGGUGGGACCAUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon39

miR-6815 directly targets SLC2A5 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6815 miRNA Mature ID miR-6815-5p

miRNA Sequence

UAGGUGGCGCCGGAGGAGUCAUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon40

miR-6834 directly targets SLC2A5 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6834 miRNA Mature ID miR-6834-5p

miRNA Sequence

GUGAGGGACUGGGAUUUGUGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon41

miR-6851 directly targets SLC2A5 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6851 miRNA Mature ID miR-6851-5p

miRNA Sequence

AGGAGGUGGUACUAGGGGCCAGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon42

miR-6865 directly targets SLC2A5 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6865 miRNA Mature ID miR-6865-5p

miRNA Sequence

UAGGUGGCAGAGGAGGGACUUCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon43

miR-6884 directly targets SLC2A5 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6884 miRNA Mature ID miR-6884-5p

miRNA Sequence

AGAGGCUGAGAAGGUGAUGUUG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon44

miR-6893 directly targets SLC2A5 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6893 miRNA Mature ID miR-6893-5p

miRNA Sequence

CAGGCAGGUGUAGGGUGGAGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon45

miR-7160 directly targets SLC2A5 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-7160 miRNA Mature ID miR-7160-5p

miRNA Sequence

UGCUGAGGUCCGGGCUGUGCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon46

miR-7977 directly targets SLC2A5 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-7977 miRNA Mature ID miR-7977

miRNA Sequence

UUCCCAGCCAACGCACCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon47

miR-873 directly targets SLC2A5 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-873 miRNA Mature ID miR-873-5p

miRNA Sequence

GCAGGAACUUGUGAGUCUCCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon48

miR-9 directly targets SLC2A5 [ 17 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-9 miRNA Mature ID miR-9-5p

miRNA Sequence

UCUUUGGUUAUCUAGCUGUAUGA

miRNA Target Type

Direct

Experimental Material

Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon49

miR-940 directly targets SLC2A5 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-940 miRNA Mature ID miR-940

miRNA Sequence

AAGGCAGGGCCCCCGCUCCCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human
References
1 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
2 DNA Methylation Dynamics in Urological Tumors.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
5 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
6 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
7 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
8 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
9 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
10 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
11 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
12 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
13 Induction by fructose force-feeding of histone H3 and H4 acetylation at their lysine residues around the Slc2a5 gene and its expression in mice. Biosci Biotechnol Biochem. 2013;77(11):2188-91.
14 Direct conversion of fibroblasts to neurons by reprogramming PTB-regulated microRNA circuits. Cell. 2013 Jan 17;152(1-2):82-96.
15 The Landscape of microRNA Targeting in Prostate Cancer Defined by AGO-PAR-CLIP. Neoplasia. 2016 Jun;18(6):356-70.
16 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
17 MicroRNA targeting specificity in mammals: determinants beyond seed pairing. Mol Cell. 2007 Jul 6;27(1):91-105.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.