General Information of Drug Transporter (DT)
DT ID DTD0258 Transporter Info
Gene Name SLC2A3
Transporter Name Glucose transporter type 3, brain
Gene ID
6515
UniProt ID
P11169
Epigenetic Regulations of This DT (EGR)

Methylation

  Hepatocellular carcinoma

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC2A3 in hepatocellular carcinoma [ 1 ]

Location

5'UTR (cg24655009)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.31E+00 Statistic Test p-value:1.27E-14; Z-score:-4.50E+00

Methylation in Case

5.55E-01 (Median) Methylation in Control 7.27E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC2A3 in hepatocellular carcinoma [ 1 ]

Location

TSS1500 (cg02511315)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:6.67E-03; Z-score:-3.13E-01

Methylation in Case

5.47E-01 (Median) Methylation in Control 5.66E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC2A3 in hepatocellular carcinoma [ 1 ]

Location

TSS200 (cg10338338)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.12E+00 Statistic Test p-value:7.64E-04; Z-score:6.34E-01

Methylation in Case

3.04E-01 (Median) Methylation in Control 2.73E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC2A3 in hepatocellular carcinoma [ 1 ]

Location

Body (cg12911449)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:1.77E-02; Z-score:-4.44E-01

Methylation in Case

6.80E-02 (Median) Methylation in Control 7.49E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Pancretic ductal adenocarcinoma

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC2A3 in pancretic ductal adenocarcinoma [ 2 ]

Location

5'UTR (cg06204922)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:7.04E+00 Statistic Test p-value:2.32E-40; Z-score:6.13E+00

Methylation in Case

3.53E-01 (Median) Methylation in Control 5.02E-02 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC2A3 in pancretic ductal adenocarcinoma [ 2 ]

Location

TSS200 (cg09448875)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.19E+00 Statistic Test p-value:9.39E-06; Z-score:-1.27E+00

Methylation in Case

6.59E-01 (Median) Methylation in Control 7.86E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Bladder cancer

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC2A3 in bladder cancer [ 3 ]

Location

TSS1500 (cg07748193)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.18E+00 Statistic Test p-value:1.43E-08; Z-score:-6.96E+00

Methylation in Case

5.94E-01 (Median) Methylation in Control 6.98E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC2A3 in bladder cancer [ 3 ]

Location

Body (cg12911449)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.53E+00 Statistic Test p-value:3.75E-02; Z-score:-9.27E-01

Methylation in Case

5.37E-02 (Median) Methylation in Control 8.22E-02 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Breast cancer

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC2A3 in breast cancer [ 4 ]

Location

TSS1500 (cg02511315)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.21E+00 Statistic Test p-value:2.37E-08; Z-score:1.26E+00

Methylation in Case

6.51E-01 (Median) Methylation in Control 5.40E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC2A3 in breast cancer [ 4 ]

Location

TSS1500 (cg20313963)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.22E+00 Statistic Test p-value:3.52E-04; Z-score:6.70E-01

Methylation in Case

4.19E-01 (Median) Methylation in Control 3.42E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC2A3 in breast cancer [ 4 ]

Location

TSS200 (cg10338338)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.30E+00 Statistic Test p-value:5.33E-10; Z-score:1.30E+00

Methylation in Case

3.29E-01 (Median) Methylation in Control 2.53E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC2A3 in breast cancer [ 4 ]

Location

TSS200 (cg25580254)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.82E+00 Statistic Test p-value:6.44E-08; Z-score:1.25E+00

Methylation in Case

1.27E-01 (Median) Methylation in Control 6.99E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Colorectal cancer

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC2A3 in colorectal cancer [ 5 ]

Location

TSS1500 (cg07748193)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.08E+00 Statistic Test p-value:6.74E-06; Z-score:-1.37E+00

Methylation in Case

6.44E-01 (Median) Methylation in Control 6.98E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC2A3 in colorectal cancer [ 5 ]

Location

TSS1500 (cg20313963)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.20E+00 Statistic Test p-value:2.16E-02; Z-score:-7.80E-01

Methylation in Case

2.11E-01 (Median) Methylation in Control 2.54E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  HIV infection

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC2A3 in HIV infection [ 6 ]

Location

TSS1500 (cg07748193)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.09E+00 Statistic Test p-value:4.47E-05; Z-score:1.78E+00

Methylation in Case

7.46E-01 (Median) Methylation in Control 6.87E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC2A3 in HIV infection [ 6 ]

Location

TSS1500 (cg20313963)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.13E+00 Statistic Test p-value:6.35E-03; Z-score:5.06E-01

Methylation in Case

1.01E-01 (Median) Methylation in Control 8.96E-02 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC2A3 in HIV infection [ 6 ]

Location

TSS200 (cg25580254)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.34E+00 Statistic Test p-value:2.55E-03; Z-score:8.92E-01

Methylation in Case

1.24E-01 (Median) Methylation in Control 9.31E-02 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC2A3 in papillary thyroid cancer [ 7 ]

Location

TSS1500 (cg20313963)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.73E+00 Statistic Test p-value:2.51E-19; Z-score:-2.51E+00

Methylation in Case

3.01E-01 (Median) Methylation in Control 5.22E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Prostate cancer

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC2A3 in prostate cancer [ 8 ]

Location

TSS1500 (cg09282497)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:4.89E+00 Statistic Test p-value:4.38E-02; Z-score:1.25E+01

Methylation in Case

2.89E-01 (Median) Methylation in Control 5.92E-02 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC2A3 in prostate cancer [ 8 ]

Location

Body (cg18485596)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.64E+00 Statistic Test p-value:2.78E-02; Z-score:5.73E+00

Methylation in Case

5.21E-01 (Median) Methylation in Control 1.98E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Significant hypermethylation of SLC2A3 in prostate cancer than that in healthy individual

Studied Phenotype

Prostate cancer [ICD-11:2C82]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:3.95E-07; Fold-change:0.467891021; Z-score:4.830572521
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Lung adenocarcinoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC2A3 in lung adenocarcinoma [ 9 ]

Location

TSS200 (cg10338338)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.25E+00 Statistic Test p-value:1.20E-02; Z-score:2.60E+00

Methylation in Case

3.57E-01 (Median) Methylation in Control 2.85E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Atypical teratoid rhabdoid tumor

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC2A3 in atypical teratoid rhabdoid tumor [ 10 ]

Location

Body (cg12911449)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.03E+00 Statistic Test p-value:3.15E-02; Z-score:3.85E-01

Methylation in Case

9.08E-01 (Median) Methylation in Control 8.85E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Prostate cancer metastasis

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypermethylation of SLC2A3 in prostate cancer metastasis than that in healthy individual

Studied Phenotype

Prostate cancer metastasis [ICD-11:2.00E+06]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:1.35E-07; Fold-change:0.48379757; Z-score:19.02130287
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

Histone acetylation

  Non-small cell lung cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Hypoacetylation of SLC2A3 in non-small cell lung cancer (compare with Vorinostat-treatment counterpart cells) [ 11 ]

Location

Promoter

Epigenetic Type

Histone acetylation Experiment Method Chromatin immunoprecipitation

Related Molecular Changes

Down regulation ofSLC2A3 Experiment Method RT-qPCR

Studied Phenotype

Non-small cell lung cancer[ ICD-11:2C25.4]

Experimental Material

Multiple cell lines of human

Additional Notes

SLC2A3 expression can be induced or increased following inhibition of histone deacetylases in non-small cell lung cancer cell lines.

microRNA

  Glioblastoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Lower expression of miR-106a in glioblastoma (compare with adjacent normal tissue) [ 12 ]

Epigenetic Type

microRNA Experiment Method Luciferase reporter assay

Related Molecular Changes

Down regulation ofSLC2A3 Experiment Method RT-qPCR

miRNA Stemloop ID

miR-106a miRNA Mature ID miR-106a-5p

miRNA Sequence

AAAAGUGCUUACAGUGCAGGUAG

miRNA Target Type

Direct

Studied Phenotype

Glioblastoma[ ICD-11:2A00.00]

Experimental Material

Patient tissue samples

Additional Notes

miR-106a was down-regulated in glioblastoma and regulated SLC2A3 expression via binding to the SLC2A3 mRNA.

  Bladder cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Lower expression of miR-195-5p in bladder cancer (compare with normal cells) [ 13 ]

Epigenetic Type

microRNA Experiment Method Luciferase reporter assay

Related Molecular Changes

Down regulation ofSLC2A3 Experiment Method Western Blot

miRNA Stemloop ID

miR-195 miRNA Mature ID miR-195-5p

miRNA Sequence

UAGCAGCACAGAAAUAUUGGC

miRNA Target Type

Direct

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Multiple cell lines of human

Additional Notes

miR-195-5p was down-regulated in bladder cancer and regulated SLC2A3 expression via binding to the SLC2A3 mRNA.

  Unclear Phenotype

         47 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-103a directly targets SLC2A3 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-103a miRNA Mature ID miR-103a-3p

miRNA Sequence

AGCAGCAUUGUACAGGGCUAUGA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon2

miR-106a directly targets SLC2A3 [ 12 ]

Epigenetic Type

microRNA Experiment Method Luciferase reporter assay//qRT-PCR//Western blot

miRNA Stemloop ID

miR-106a miRNA Mature ID miR-106a-5p

miRNA Sequence

AAAAGUGCUUACAGUGCAGGUAG

miRNA Target Type

Direct

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

miR-107 directly targets SLC2A3 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-107 miRNA Mature ID miR-107

miRNA Sequence

AGCAGCAUUGUACAGGGCUAUCA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon4

miR-10a directly targets SLC2A3 [ 15 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-10a miRNA Mature ID miR-10a-5p

miRNA Sequence

UACCCUGUAGAUCCGAAUUUGUG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon5

miR-10b directly targets SLC2A3 [ 15 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-10b miRNA Mature ID miR-10b-5p

miRNA Sequence

UACCCUGUAGAACCGAAUUUGUG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon6

miR-1179 directly targets SLC2A3 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1179 miRNA Mature ID miR-1179

miRNA Sequence

AAGCAUUCUUUCAUUGGUUGG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon7

miR-122 directly targets SLC2A3 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-122 miRNA Mature ID miR-122-5p

miRNA Sequence

UGGAGUGUGACAAUGGUGUUUG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon8

miR-1255a directly targets SLC2A3 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1255a miRNA Mature ID miR-1255a

miRNA Sequence

AGGAUGAGCAAAGAAAGUAGAUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon9

miR-1255b directly targets SLC2A3 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1255b miRNA Mature ID miR-1255b-5p

miRNA Sequence

CGGAUGAGCAAAGAAAGUGGUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon10

miR-148a directly targets SLC2A3 [ 15 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-148a miRNA Mature ID miR-148a-3p

miRNA Sequence

UCAGUGCACUACAGAACUUUGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon11

miR-15a directly targets SLC2A3 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-15a miRNA Mature ID miR-15a-5p

miRNA Sequence

UAGCAGCACAUAAUGGUUUGUG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon12

miR-15b directly targets SLC2A3 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-15b miRNA Mature ID miR-15b-5p

miRNA Sequence

UAGCAGCACAUCAUGGUUUACA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon13

miR-16 directly targets SLC2A3 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-16 miRNA Mature ID miR-16-5p

miRNA Sequence

UAGCAGCACGUAAAUAUUGGCG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon14

miR-183 directly targets SLC2A3 [ 15 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-183 miRNA Mature ID miR-183-5p

miRNA Sequence

UAUGGCACUGGUAGAAUUCACU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon15

miR-195 directly targets SLC2A3 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-195 miRNA Mature ID miR-195-5p

miRNA Sequence

UAGCAGCACAGAAAUAUUGGC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon16

miR-24 directly targets SLC2A3 [ 16 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-24 miRNA Mature ID miR-24-3p

miRNA Sequence

UGGCUCAGUUCAGCAGGAACAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon17

miR-335 directly targets SLC2A3 [ 17 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-335 miRNA Mature ID miR-335-5p

miRNA Sequence

UCAAGAGCAAUAACGAAAAAUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon18

miR-34a directly targets SLC2A3 [ 18 ]

Epigenetic Type

microRNA Experiment Method Proteomics

miRNA Stemloop ID

miR-34a miRNA Mature ID miR-34a-5p

miRNA Sequence

UGGCAGUGUCUUAGCUGGUUGU

miRNA Target Type

Direct

Experimental Material

Human colorectal cancer cell line (SW480)

  Epigenetic Phenomenon19

miR-365a directly targets SLC2A3 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-365a miRNA Mature ID miR-365a-3p

miRNA Sequence

UAAUGCCCCUAAAAAUCCUUAU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon20

miR-365b directly targets SLC2A3 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-365b miRNA Mature ID miR-365b-3p

miRNA Sequence

UAAUGCCCCUAAAAAUCCUUAU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon21

miR-3907 directly targets SLC2A3 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3907 miRNA Mature ID miR-3907

miRNA Sequence

AGGUGCUCCAGGCUGGCUCACA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon22

miR-424 directly targets SLC2A3 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-424 miRNA Mature ID miR-424-5p

miRNA Sequence

CAGCAGCAAUUCAUGUUUUGAA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon23

miR-4310 directly targets SLC2A3 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4310 miRNA Mature ID miR-4310

miRNA Sequence

GCAGCAUUCAUGUCCC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon24

miR-4524a directly targets SLC2A3 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4524a miRNA Mature ID miR-4524a-5p

miRNA Sequence

AUAGCAGCAUGAACCUGUCUCA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon25

miR-4524b directly targets SLC2A3 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4524b miRNA Mature ID miR-4524b-5p

miRNA Sequence

AUAGCAGCAUAAGCCUGUCUC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon26

miR-4641 directly targets SLC2A3 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4641 miRNA Mature ID miR-4641

miRNA Sequence

UGCCCAUGCCAUACUUUUGCCUCA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon27

miR-4654 directly targets SLC2A3 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4654 miRNA Mature ID miR-4654

miRNA Sequence

UGUGGGAUCUGGAGGCAUCUGG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon28

miR-4769 directly targets SLC2A3 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4769 miRNA Mature ID miR-4769-5p

miRNA Sequence

GGUGGGAUGGAGAGAAGGUAUGAG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon29

miR-490 directly targets SLC2A3 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-490 miRNA Mature ID miR-490-5p

miRNA Sequence

CCAUGGAUCUCCAGGUGGGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon30

miR-497 directly targets SLC2A3 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-497 miRNA Mature ID miR-497-5p

miRNA Sequence

CAGCAGCACACUGUGGUUUGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon31

miR-500a directly targets SLC2A3 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-500a miRNA Mature ID miR-500a-5p

miRNA Sequence

UAAUCCUUGCUACCUGGGUGAGA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon32

miR-503 directly targets SLC2A3 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-503 miRNA Mature ID miR-503-5p

miRNA Sequence

UAGCAGCGGGAACAGUUCUGCAG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon33

miR-504 directly targets SLC2A3 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-504 miRNA Mature ID miR-504-3p

miRNA Sequence

GGGAGUGCAGGGCAGGGUUUC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon34

miR-5187 directly targets SLC2A3 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-5187 miRNA Mature ID miR-5187-5p

miRNA Sequence

UGGGAUGAGGGAUUGAAGUGGA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon35

miR-539 directly targets SLC2A3 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-539 miRNA Mature ID miR-539-5p

miRNA Sequence

GGAGAAAUUAUCCUUGGUGUGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon36

miR-562 directly targets SLC2A3 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-562 miRNA Mature ID miR-562

miRNA Sequence

AAAGUAGCUGUACCAUUUGC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon37

miR-606 directly targets SLC2A3 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-606 miRNA Mature ID miR-606

miRNA Sequence

AAACUACUGAAAAUCAAAGAU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon38

miR-646 directly targets SLC2A3 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-646 miRNA Mature ID miR-646

miRNA Sequence

AAGCAGCUGCCUCUGAGGC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon39

miR-6514 directly targets SLC2A3 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6514 miRNA Mature ID miR-6514-5p

miRNA Sequence

UAUGGAGUGGACUUUCAGCUGGC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon40

miR-6728 directly targets SLC2A3 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6728 miRNA Mature ID miR-6728-5p

miRNA Sequence

UUGGGAUGGUAGGACCAGAGGGG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon41

miR-6821 directly targets SLC2A3 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6821 miRNA Mature ID miR-6821-5p

miRNA Sequence

GUGCGUGGUGGCUCGAGGCGGGG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon42

miR-6838 directly targets SLC2A3 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6838 miRNA Mature ID miR-6838-5p

miRNA Sequence

AAGCAGCAGUGGCAAGACUCCU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon43

miR-6847 directly targets SLC2A3 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6847 miRNA Mature ID miR-6847-3p

miRNA Sequence

GGCUCAUGUGUCUGUCCUCUUC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon44

miR-6853 directly targets SLC2A3 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6853 miRNA Mature ID miR-6853-5p

miRNA Sequence

AGCGUGGGAUGUCCAUGAAGUCAG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon45

miR-7157 directly targets SLC2A3 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-7157 miRNA Mature ID miR-7157-5p

miRNA Sequence

UCAGCAUUCAUUGGCACCAGAGA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon46

miR-892c directly targets SLC2A3 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-892c miRNA Mature ID miR-892c-5p

miRNA Sequence

UAUUCAGAAAGGUGCCAGUCA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon47

miR-98 directly targets SLC2A3 [ 19 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-98 miRNA Mature ID miR-98-5p

miRNA Sequence

UGAGGUAGUAAGUUGUAUUGUU

miRNA Target Type

Direct

Experimental Material

Human cervical cancer cell line (Hela)
References
1 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
2 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
3 DNA Methylation Dynamics in Urological Tumors.
4 Genome-wide Scan for Methylation Profiles in Breast Cancer
5 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
7 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
8 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
9 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
10 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
11 Epigenetic regulation of glucose transporters in non-small cell lung cancer. Mol Ther Oncolytics. 2019 Feb 5;12:235-245.
12 Decreased miR-106a inhibits glioma cell glucose uptake and proliferation by targeting SLC2A3 in GBM. BMC Cancer. 2013 Oct 14;13:478.
13 MicroRNA-195-5p suppresses glucose uptake and proliferation of human bladder cancer T24 cells by regulating GLUT3 expression. FEBS Lett. 2012 Feb 17;586(4):392-7.
14 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
15 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
16 miR-24 Inhibits cell proliferation by targeting E2F2, MYC, and other cell-cycle genes via binding to "seedless" 3'UTR microRNA recognition elements. Mol Cell. 2009 Sep 11;35(5):610-25.
17 Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.
18 Genome-wide characterization of miR-34a induced changes in protein and mRNA expression by a combined pulsed SILAC and microarray analysis. Mol Cell Proteomics. 2011 Aug;10(8):M111.010462.
19 MicroRNA target prediction by expression analysis of host genes. Genome Res. 2009 Mar;19(3):481-90.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.