General Information of Drug Transporter (DT)
DT ID DTD0256 Transporter Info
Gene Name SLC2A14
Transporter Name Glucose transporter type 14
Gene ID
144195
UniProt ID
Q8TDB8
Epigenetic Regulations of This DT (EGR)

Methylation

  Acute lymphoblastic leukemia

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Hypermethylation of SLC2A14 in acute lymphoblastic leukemia [ 1 ]

Location

Promoter

Epigenetic Type

Methylation Experiment Method Bisulfite sequencing

Related Molecular Changes

Down regulation ofSLC2A14 Experiment Method RT-qPCR

Studied Phenotype

Acute lymphoblastic leukemia[ ICD-11:2B33.0]

Experimental Material

Patient tissue samples

  Atypical teratoid rhabdoid tumor

           6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC2A14 in atypical teratoid rhabdoid tumor [ 2 ]

Location

5'UTR (cg06645921)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.22E+00 Statistic Test p-value:6.62E-08; Z-score:1.48E+00

Methylation in Case

1.18E-01 (Median) Methylation in Control 5.31E-02 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC2A14 in atypical teratoid rhabdoid tumor [ 2 ]

Location

5'UTR (cg17537007)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.42E+00 Statistic Test p-value:1.99E-06; Z-score:-1.17E+00

Methylation in Case

1.51E-01 (Median) Methylation in Control 2.14E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC2A14 in atypical teratoid rhabdoid tumor [ 2 ]

Location

5'UTR (cg25020919)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.17E+00 Statistic Test p-value:8.85E-06; Z-score:1.10E+00

Methylation in Case

7.97E-01 (Median) Methylation in Control 6.84E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC2A14 in atypical teratoid rhabdoid tumor [ 2 ]

Location

Body (cg09592224)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.03E+00 Statistic Test p-value:1.13E-02; Z-score:3.21E-01

Methylation in Case

9.18E-01 (Median) Methylation in Control 8.94E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC2A14 in atypical teratoid rhabdoid tumor [ 2 ]

Location

Body (cg12970757)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:3.22E-02; Z-score:-8.66E-02

Methylation in Case

7.48E-02 (Median) Methylation in Control 8.32E-02 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC2A14 in atypical teratoid rhabdoid tumor [ 2 ]

Location

3'UTR (cg10097316)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:2.09E-12; Z-score:-2.54E+00

Methylation in Case

8.29E-01 (Median) Methylation in Control 9.05E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Bladder cancer

         14 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC2A14 in bladder cancer [ 3 ]

Location

5'UTR (cg25020919)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.92E+00 Statistic Test p-value:2.84E-12; Z-score:-2.62E+01

Methylation in Case

4.40E-01 (Median) Methylation in Control 8.46E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC2A14 in bladder cancer [ 3 ]

Location

5'UTR (cg06645921)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.60E+00 Statistic Test p-value:3.47E-10; Z-score:8.56E+00

Methylation in Case

6.89E-01 (Median) Methylation in Control 2.65E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC2A14 in bladder cancer [ 3 ]

Location

5'UTR (cg17537007)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.42E+00 Statistic Test p-value:5.48E-07; Z-score:-1.63E+01

Methylation in Case

6.16E-01 (Median) Methylation in Control 8.73E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC2A14 in bladder cancer [ 3 ]

Location

TSS1500 (cg07931785)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.27E+00 Statistic Test p-value:8.21E-06; Z-score:-6.48E+00

Methylation in Case

6.56E-01 (Median) Methylation in Control 8.35E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC2A14 in bladder cancer [ 3 ]

Location

TSS1500 (cg00955780)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.42E+00 Statistic Test p-value:2.11E-05; Z-score:4.78E+00

Methylation in Case

7.71E-01 (Median) Methylation in Control 5.45E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC2A14 in bladder cancer [ 3 ]

Location

TSS200 (cg06122660)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.89E+00 Statistic Test p-value:9.22E-14; Z-score:1.33E+01

Methylation in Case

4.43E-01 (Median) Methylation in Control 1.53E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC2A14 in bladder cancer [ 3 ]

Location

TSS200 (cg11207307)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.03E+00 Statistic Test p-value:1.28E-13; Z-score:1.49E+01

Methylation in Case

6.39E-01 (Median) Methylation in Control 3.15E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC2A14 in bladder cancer [ 3 ]

Location

TSS200 (cg15251385)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:3.67E+00 Statistic Test p-value:3.73E-13; Z-score:1.22E+01

Methylation in Case

6.41E-01 (Median) Methylation in Control 1.75E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC2A14 in bladder cancer [ 3 ]

Location

TSS200 (cg16404371)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:6.01E+00 Statistic Test p-value:2.10E-10; Z-score:1.02E+01

Methylation in Case

5.25E-01 (Median) Methylation in Control 8.73E-02 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC2A14 in bladder cancer [ 3 ]

Location

TSS200 (cg13323752)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.57E+00 Statistic Test p-value:4.93E-07; Z-score:6.07E+00

Methylation in Case

2.00E-01 (Median) Methylation in Control 7.79E-02 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC2A14 in bladder cancer [ 3 ]

Location

TSS200 (cg19556774)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.64E+00 Statistic Test p-value:2.84E-05; Z-score:4.49E+00

Methylation in Case

3.75E-01 (Median) Methylation in Control 1.42E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC2A14 in bladder cancer [ 3 ]

Location

Body (cg16496592)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.22E+00 Statistic Test p-value:6.71E-09; Z-score:8.13E+00

Methylation in Case

7.93E-01 (Median) Methylation in Control 6.49E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC2A14 in bladder cancer [ 3 ]

Location

Body (cg12970757)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.27E+00 Statistic Test p-value:4.28E-04; Z-score:2.99E+00

Methylation in Case

7.86E-01 (Median) Methylation in Control 6.20E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLC2A14 in bladder cancer [ 3 ]

Location

3'UTR (cg10097316)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.52E+00 Statistic Test p-value:3.82E-11; Z-score:-1.32E+01

Methylation in Case

5.29E-01 (Median) Methylation in Control 8.07E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Breast cancer

         14 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC2A14 in breast cancer [ 4 ]

Location

5'UTR (cg06645921)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.66E+00 Statistic Test p-value:9.91E-11; Z-score:1.53E+00

Methylation in Case

3.33E-01 (Median) Methylation in Control 2.01E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC2A14 in breast cancer [ 4 ]

Location

5'UTR (cg17537007)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:5.69E-10; Z-score:-2.15E+00

Methylation in Case

7.99E-01 (Median) Methylation in Control 8.55E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC2A14 in breast cancer [ 4 ]

Location

5'UTR (cg25020919)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:7.15E-07; Z-score:-1.13E+00

Methylation in Case

7.45E-01 (Median) Methylation in Control 7.91E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC2A14 in breast cancer [ 4 ]

Location

TSS1500 (cg07931785)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:8.65E-13; Z-score:-2.62E+00

Methylation in Case

8.13E-01 (Median) Methylation in Control 8.73E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC2A14 in breast cancer [ 4 ]

Location

TSS1500 (cg00955780)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.14E+00 Statistic Test p-value:2.63E-10; Z-score:1.32E+00

Methylation in Case

7.26E-01 (Median) Methylation in Control 6.37E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC2A14 in breast cancer [ 4 ]

Location

TSS200 (cg15251385)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.60E+00 Statistic Test p-value:2.07E-22; Z-score:3.66E+00

Methylation in Case

4.83E-01 (Median) Methylation in Control 1.86E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC2A14 in breast cancer [ 4 ]

Location

TSS200 (cg06122660)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.36E+00 Statistic Test p-value:3.18E-21; Z-score:3.40E+00

Methylation in Case

3.16E-01 (Median) Methylation in Control 1.34E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC2A14 in breast cancer [ 4 ]

Location

TSS200 (cg16404371)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:3.47E+00 Statistic Test p-value:1.02E-19; Z-score:5.89E+00

Methylation in Case

3.79E-01 (Median) Methylation in Control 1.09E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC2A14 in breast cancer [ 4 ]

Location

TSS200 (cg19556774)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.73E+00 Statistic Test p-value:1.03E-18; Z-score:3.64E+00

Methylation in Case

3.50E-01 (Median) Methylation in Control 1.28E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC2A14 in breast cancer [ 4 ]

Location

TSS200 (cg11207307)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.65E+00 Statistic Test p-value:1.38E-16; Z-score:2.67E+00

Methylation in Case

5.24E-01 (Median) Methylation in Control 3.18E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC2A14 in breast cancer [ 4 ]

Location

TSS200 (cg13323752)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.99E+00 Statistic Test p-value:1.71E-14; Z-score:3.98E+00

Methylation in Case

2.42E-01 (Median) Methylation in Control 8.10E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC2A14 in breast cancer [ 4 ]

Location

Body (cg12970757)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.08E+00 Statistic Test p-value:7.04E-05; Z-score:-1.04E+00

Methylation in Case

7.68E-01 (Median) Methylation in Control 8.30E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC2A14 in breast cancer [ 4 ]

Location

Body (cg09592224)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.08E+00 Statistic Test p-value:3.88E-02; Z-score:-4.44E-01

Methylation in Case

7.21E-01 (Median) Methylation in Control 7.80E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLC2A14 in breast cancer [ 4 ]

Location

3'UTR (cg10097316)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:5.75E-03; Z-score:-5.35E-01

Methylation in Case

7.39E-01 (Median) Methylation in Control 7.59E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Celiac disease

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC2A14 in celiac disease [ 5 ]

Location

5'UTR (cg06645921)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.41E+00 Statistic Test p-value:4.31E-02; Z-score:6.90E-01

Methylation in Case

2.68E-01 (Median) Methylation in Control 1.90E-01 (Median)

Studied Phenotype

Celiac disease[ ICD-11:DA95]

Experimental Material

Patient tissue samples

  Renal cell carcinoma

         10 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC2A14 in clear cell renal cell carcinoma [ 6 ]

Location

5'UTR (cg06645921)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.55E+00 Statistic Test p-value:5.11E-08; Z-score:1.75E+00

Methylation in Case

4.39E-01 (Median) Methylation in Control 2.83E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC2A14 in clear cell renal cell carcinoma [ 6 ]

Location

5'UTR (cg17537007)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:1.21E-06; Z-score:-3.94E+00

Methylation in Case

9.38E-01 (Median) Methylation in Control 9.66E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC2A14 in clear cell renal cell carcinoma [ 6 ]

Location

TSS1500 (cg00955780)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.15E+00 Statistic Test p-value:1.14E-10; Z-score:1.99E+00

Methylation in Case

8.45E-01 (Median) Methylation in Control 7.35E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC2A14 in clear cell renal cell carcinoma [ 6 ]

Location

TSS1500 (cg07931785)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.11E-03; Z-score:-7.83E-01

Methylation in Case

9.51E-01 (Median) Methylation in Control 9.64E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC2A14 in clear cell renal cell carcinoma [ 6 ]

Location

TSS200 (cg11207307)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.30E+00 Statistic Test p-value:9.23E-06; Z-score:1.53E+00

Methylation in Case

3.57E-01 (Median) Methylation in Control 2.76E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC2A14 in clear cell renal cell carcinoma [ 6 ]

Location

TSS200 (cg06122660)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.79E+00 Statistic Test p-value:9.38E-06; Z-score:1.96E+00

Methylation in Case

2.55E-01 (Median) Methylation in Control 1.42E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC2A14 in clear cell renal cell carcinoma [ 6 ]

Location

TSS200 (cg15251385)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.78E+00 Statistic Test p-value:1.09E-05; Z-score:1.68E+00

Methylation in Case

2.74E-01 (Median) Methylation in Control 1.54E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC2A14 in clear cell renal cell carcinoma [ 6 ]

Location

TSS200 (cg16404371)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.68E+00 Statistic Test p-value:1.92E-05; Z-score:7.14E-01

Methylation in Case

8.58E-02 (Median) Methylation in Control 5.10E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC2A14 in clear cell renal cell carcinoma [ 6 ]

Location

TSS200 (cg19556774)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.43E+00 Statistic Test p-value:1.75E-03; Z-score:7.24E-01

Methylation in Case

1.46E-01 (Median) Methylation in Control 1.02E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC2A14 in clear cell renal cell carcinoma [ 6 ]

Location

TSS200 (cg13323752)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.36E+00 Statistic Test p-value:1.81E-03; Z-score:3.29E-01

Methylation in Case

4.65E-02 (Median) Methylation in Control 3.42E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Colon cancer

         10 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC2A14 in colon adenocarcinoma [ 7 ]

Location

5'UTR (cg13774987)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.20E+00 Statistic Test p-value:1.47E-06; Z-score:1.53E+00

Methylation in Case

8.07E-01 (Median) Methylation in Control 6.71E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC2A14 in colon adenocarcinoma [ 7 ]

Location

5'UTR (cg07186154)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.52E+00 Statistic Test p-value:6.86E-06; Z-score:2.52E+00

Methylation in Case

5.02E-01 (Median) Methylation in Control 3.30E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC2A14 in colon adenocarcinoma [ 7 ]

Location

5'UTR (cg20018106)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.25E+00 Statistic Test p-value:2.02E-04; Z-score:-2.27E+00

Methylation in Case

5.93E-01 (Median) Methylation in Control 7.39E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC2A14 in colon adenocarcinoma [ 7 ]

Location

TSS1500 (cg00161955)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.22E+00 Statistic Test p-value:1.19E-05; Z-score:-3.56E+00

Methylation in Case

6.42E-01 (Median) Methylation in Control 7.85E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC2A14 in colon adenocarcinoma [ 7 ]

Location

TSS1500 (cg26590082)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.20E+00 Statistic Test p-value:3.13E-04; Z-score:1.47E+00

Methylation in Case

4.65E-01 (Median) Methylation in Control 3.87E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC2A14 in colon adenocarcinoma [ 7 ]

Location

TSS200 (cg23752563)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.56E+00 Statistic Test p-value:7.63E-06; Z-score:2.62E+00

Methylation in Case

4.81E-01 (Median) Methylation in Control 3.09E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC2A14 in colon adenocarcinoma [ 7 ]

Location

TSS200 (cg18314695)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.12E+00 Statistic Test p-value:3.22E-04; Z-score:-2.96E+00

Methylation in Case

6.79E-01 (Median) Methylation in Control 7.59E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC2A14 in colon adenocarcinoma [ 7 ]

Location

Body (cg24069602)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.35E+00 Statistic Test p-value:2.02E-08; Z-score:-2.83E+00

Methylation in Case

4.43E-01 (Median) Methylation in Control 5.99E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC2A14 in colon adenocarcinoma [ 7 ]

Location

Body (cg14055896)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.62E+00 Statistic Test p-value:3.22E-07; Z-score:2.07E+00

Methylation in Case

6.57E-01 (Median) Methylation in Control 4.05E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC2A14 in colon adenocarcinoma [ 7 ]

Location

Body (cg19503341)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.17E+00 Statistic Test p-value:6.86E-06; Z-score:-3.02E+00

Methylation in Case

4.35E-01 (Median) Methylation in Control 5.08E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Colorectal cancer

           9 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC2A14 in colorectal cancer [ 8 ]

Location

5'UTR (cg17537007)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:1.79E-07; Z-score:-3.63E+00

Methylation in Case

8.68E-01 (Median) Methylation in Control 9.18E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC2A14 in colorectal cancer [ 8 ]

Location

5'UTR (cg25020919)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.20E-03; Z-score:-7.11E-01

Methylation in Case

8.93E-01 (Median) Methylation in Control 9.02E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC2A14 in colorectal cancer [ 8 ]

Location

TSS1500 (cg07931785)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:1.97E-07; Z-score:-2.90E+00

Methylation in Case

8.37E-01 (Median) Methylation in Control 8.96E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC2A14 in colorectal cancer [ 8 ]

Location

TSS200 (cg06122660)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.26E+00 Statistic Test p-value:1.41E-05; Z-score:1.08E+00

Methylation in Case

5.70E-01 (Median) Methylation in Control 4.51E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC2A14 in colorectal cancer [ 8 ]

Location

TSS200 (cg15251385)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.20E+00 Statistic Test p-value:1.96E-04; Z-score:7.06E-01

Methylation in Case

6.11E-01 (Median) Methylation in Control 5.08E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC2A14 in colorectal cancer [ 8 ]

Location

TSS200 (cg19556774)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.18E+00 Statistic Test p-value:7.63E-04; Z-score:6.70E-01

Methylation in Case

4.69E-01 (Median) Methylation in Control 3.98E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC2A14 in colorectal cancer [ 8 ]

Location

TSS200 (cg13323752)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.14E+00 Statistic Test p-value:1.31E-02; Z-score:4.97E-01

Methylation in Case

4.34E-01 (Median) Methylation in Control 3.80E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC2A14 in colorectal cancer [ 8 ]

Location

TSS200 (cg11207307)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.17E+00 Statistic Test p-value:1.39E-02; Z-score:6.75E-01

Methylation in Case

6.73E-01 (Median) Methylation in Control 5.75E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC2A14 in colorectal cancer [ 8 ]

Location

3'UTR (cg10097316)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:3.75E-07; Z-score:-1.73E+00

Methylation in Case

7.97E-01 (Median) Methylation in Control 8.54E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Hepatocellular carcinoma

         10 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC2A14 in hepatocellular carcinoma [ 9 ]

Location

5'UTR (cg00308503)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.49E+00 Statistic Test p-value:7.09E-12; Z-score:-3.03E+00

Methylation in Case

4.31E-01 (Median) Methylation in Control 6.43E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC2A14 in hepatocellular carcinoma [ 9 ]

Location

5'UTR (cg17537007)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:2.75E-05; Z-score:-9.94E-01

Methylation in Case

8.22E-01 (Median) Methylation in Control 8.48E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC2A14 in hepatocellular carcinoma [ 9 ]

Location

5'UTR (cg25020919)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:1.31E-03; Z-score:-4.36E-01

Methylation in Case

8.01E-01 (Median) Methylation in Control 8.17E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC2A14 in hepatocellular carcinoma [ 9 ]

Location

TSS1500 (cg00955780)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.11E+00 Statistic Test p-value:7.64E-08; Z-score:1.80E+00

Methylation in Case

7.56E-01 (Median) Methylation in Control 6.81E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC2A14 in hepatocellular carcinoma [ 9 ]

Location

TSS1500 (cg07931785)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:4.33E-03; Z-score:-6.14E-01

Methylation in Case

7.94E-01 (Median) Methylation in Control 8.21E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC2A14 in hepatocellular carcinoma [ 9 ]

Location

Body (cg02576220)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.53E+00 Statistic Test p-value:1.13E-21; Z-score:-1.99E+01

Methylation in Case

6.26E-01 (Median) Methylation in Control 9.61E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC2A14 in hepatocellular carcinoma [ 9 ]

Location

Body (cg11306735)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.43E+00 Statistic Test p-value:1.13E-13; Z-score:-2.96E+00

Methylation in Case

4.16E-01 (Median) Methylation in Control 5.96E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC2A14 in hepatocellular carcinoma [ 9 ]

Location

Body (cg19221303)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.20E+00 Statistic Test p-value:8.11E-11; Z-score:-3.14E+00

Methylation in Case

6.94E-01 (Median) Methylation in Control 8.32E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC2A14 in hepatocellular carcinoma [ 9 ]

Location

Body (cg24701309)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.13E+00 Statistic Test p-value:9.12E-10; Z-score:-3.06E+00

Methylation in Case

6.64E-01 (Median) Methylation in Control 7.53E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC2A14 in hepatocellular carcinoma [ 9 ]

Location

Body (cg16496592)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.37E-02; Z-score:-2.67E-01

Methylation in Case

8.08E-01 (Median) Methylation in Control 8.17E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  HIV infection

         12 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC2A14 in HIV infection [ 10 ]

Location

5'UTR (cg17537007)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:3.73E-05; Z-score:-7.83E-01

Methylation in Case

8.61E-01 (Median) Methylation in Control 8.78E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC2A14 in HIV infection [ 10 ]

Location

5'UTR (cg06645921)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.35E+00 Statistic Test p-value:5.79E-03; Z-score:8.45E-01

Methylation in Case

1.92E-01 (Median) Methylation in Control 1.43E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC2A14 in HIV infection [ 10 ]

Location

TSS1500 (cg07931785)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:8.83E-03; Z-score:-1.00E+00

Methylation in Case

8.45E-01 (Median) Methylation in Control 8.82E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC2A14 in HIV infection [ 10 ]

Location

TSS200 (cg11207307)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.17E+00 Statistic Test p-value:2.71E-03; Z-score:9.09E-01

Methylation in Case

3.16E-01 (Median) Methylation in Control 2.69E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC2A14 in HIV infection [ 10 ]

Location

TSS200 (cg15251385)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.66E+00 Statistic Test p-value:3.81E-03; Z-score:8.30E-01

Methylation in Case

1.48E-01 (Median) Methylation in Control 8.95E-02 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC2A14 in HIV infection [ 10 ]

Location

TSS200 (cg19556774)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.18E+00 Statistic Test p-value:6.02E-03; Z-score:1.32E+00

Methylation in Case

1.55E-01 (Median) Methylation in Control 7.11E-02 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC2A14 in HIV infection [ 10 ]

Location

TSS200 (cg16404371)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.33E+00 Statistic Test p-value:2.82E-02; Z-score:4.31E-01

Methylation in Case

8.65E-02 (Median) Methylation in Control 6.50E-02 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC2A14 in HIV infection [ 10 ]

Location

Body (cg12970757)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.12E+00 Statistic Test p-value:2.03E-04; Z-score:7.92E-01

Methylation in Case

6.77E-01 (Median) Methylation in Control 6.05E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC2A14 in HIV infection [ 10 ]

Location

Body (cg09592224)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.03E+00 Statistic Test p-value:2.37E-04; Z-score:1.53E+00

Methylation in Case

8.39E-01 (Median) Methylation in Control 8.12E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC2A14 in HIV infection [ 10 ]

Location

Body (cg16496592)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:5.65E-04; Z-score:6.95E-01

Methylation in Case

7.61E-01 (Median) Methylation in Control 7.34E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC2A14 in HIV infection [ 10 ]

Location

Body (cg19016972)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.03E+00 Statistic Test p-value:7.37E-04; Z-score:8.26E-01

Methylation in Case

8.67E-01 (Median) Methylation in Control 8.45E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC2A14 in HIV infection [ 10 ]

Location

3'UTR (cg10097316)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:3.23E-04; Z-score:-1.40E+00

Methylation in Case

8.54E-01 (Median) Methylation in Control 8.94E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Lung adenocarcinoma

           5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC2A14 in lung adenocarcinoma [ 11 ]

Location

5'UTR (cg17537007)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:3.66E-02; Z-score:-1.48E+00

Methylation in Case

8.22E-01 (Median) Methylation in Control 8.54E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC2A14 in lung adenocarcinoma [ 11 ]

Location

TSS1500 (cg00955780)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.20E+00 Statistic Test p-value:1.82E-03; Z-score:2.08E+00

Methylation in Case

7.73E-01 (Median) Methylation in Control 6.46E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC2A14 in lung adenocarcinoma [ 11 ]

Location

TSS200 (cg19556774)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.85E+00 Statistic Test p-value:1.61E-02; Z-score:1.43E+00

Methylation in Case

3.80E-01 (Median) Methylation in Control 2.05E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC2A14 in lung adenocarcinoma [ 11 ]

Location

TSS200 (cg15251385)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.78E+00 Statistic Test p-value:4.68E-02; Z-score:1.37E+00

Methylation in Case

4.55E-01 (Median) Methylation in Control 2.55E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC2A14 in lung adenocarcinoma [ 11 ]

Location

Body (cg09592224)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:2.75E-02; Z-score:-2.01E+00

Methylation in Case

8.35E-01 (Median) Methylation in Control 8.55E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Pancretic ductal adenocarcinoma

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC2A14 in pancretic ductal adenocarcinoma [ 12 ]

Location

5'UTR (cg00141548)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.25E+00 Statistic Test p-value:3.58E-07; Z-score:8.19E-01

Methylation in Case

2.38E-01 (Median) Methylation in Control 1.91E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC2A14 in pancretic ductal adenocarcinoma [ 12 ]

Location

TSS1500 (cg23615676)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:3.03E+00 Statistic Test p-value:1.80E-14; Z-score:2.99E+00

Methylation in Case

3.55E-01 (Median) Methylation in Control 1.17E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC2A14 in pancretic ductal adenocarcinoma [ 12 ]

Location

TSS1500 (cg04818947)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:1.04E-03; Z-score:5.35E-01

Methylation in Case

9.04E-01 (Median) Methylation in Control 8.91E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC2A14 in pancretic ductal adenocarcinoma [ 12 ]

Location

Body (cg25034117)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:1.71E-02; Z-score:-4.70E-01

Methylation in Case

7.25E-01 (Median) Methylation in Control 7.45E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

           6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC2A14 in papillary thyroid cancer [ 13 ]

Location

5'UTR (cg17537007)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:4.53E-06; Z-score:-1.36E+00

Methylation in Case

9.00E-01 (Median) Methylation in Control 9.24E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC2A14 in papillary thyroid cancer [ 13 ]

Location

5'UTR (cg06645921)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:1.87E-02; Z-score:2.33E-01

Methylation in Case

1.91E-01 (Median) Methylation in Control 1.81E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC2A14 in papillary thyroid cancer [ 13 ]

Location

TSS1500 (cg00955780)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.20E+00 Statistic Test p-value:2.81E-04; Z-score:1.39E+00

Methylation in Case

5.29E-01 (Median) Methylation in Control 4.42E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC2A14 in papillary thyroid cancer [ 13 ]

Location

TSS200 (cg15251385)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.12E+00 Statistic Test p-value:9.89E-04; Z-score:6.08E-01

Methylation in Case

1.58E-01 (Median) Methylation in Control 1.41E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC2A14 in papillary thyroid cancer [ 13 ]

Location

TSS200 (cg16404371)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:3.31E-02; Z-score:3.12E-01

Methylation in Case

1.08E-01 (Median) Methylation in Control 1.01E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC2A14 in papillary thyroid cancer [ 13 ]

Location

Body (cg19016972)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:1.01E-04; Z-score:-9.41E-01

Methylation in Case

8.50E-01 (Median) Methylation in Control 8.75E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Prostate cancer

         10 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC2A14 in prostate cancer [ 14 ]

Location

5'UTR (cg17566867)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.06E+00 Statistic Test p-value:3.05E-03; Z-score:3.56E+00

Methylation in Case

8.41E-01 (Median) Methylation in Control 7.93E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC2A14 in prostate cancer [ 14 ]

Location

TSS1500 (cg17032646)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.38E+00 Statistic Test p-value:4.09E-03; Z-score:3.89E+00

Methylation in Case

5.16E-01 (Median) Methylation in Control 3.75E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC2A14 in prostate cancer [ 14 ]

Location

TSS1500 (cg17306747)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.92E+00 Statistic Test p-value:6.69E-03; Z-score:4.21E+00

Methylation in Case

5.39E-01 (Median) Methylation in Control 2.81E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC2A14 in prostate cancer [ 14 ]

Location

TSS1500 (cg03963113)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.34E+00 Statistic Test p-value:9.41E-03; Z-score:-5.48E+00

Methylation in Case

5.84E-01 (Median) Methylation in Control 7.80E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC2A14 in prostate cancer [ 14 ]

Location

TSS1500 (cg24079038)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.53E+00 Statistic Test p-value:2.57E-02; Z-score:5.26E+00

Methylation in Case

5.44E-01 (Median) Methylation in Control 3.56E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC2A14 in prostate cancer [ 14 ]

Location

TSS200 (cg05534403)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.60E+00 Statistic Test p-value:4.92E-03; Z-score:7.55E+00

Methylation in Case

5.98E-01 (Median) Methylation in Control 2.30E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC2A14 in prostate cancer [ 14 ]

Location

Body (cg05603680)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.10E+00 Statistic Test p-value:3.45E-03; Z-score:3.65E+00

Methylation in Case

9.07E-01 (Median) Methylation in Control 8.23E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC2A14 in prostate cancer [ 14 ]

Location

Body (cg27000496)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.40E+00 Statistic Test p-value:1.36E-02; Z-score:6.39E+00

Methylation in Case

8.66E-01 (Median) Methylation in Control 6.17E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC2A14 in prostate cancer [ 14 ]

Location

Body (cg08702805)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.12E+00 Statistic Test p-value:2.81E-02; Z-score:1.81E+00

Methylation in Case

8.86E-01 (Median) Methylation in Control 7.90E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC2A14 in prostate cancer [ 14 ]

Location

3'UTR (cg07737682)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.09E+00 Statistic Test p-value:2.29E-02; Z-score:2.29E+00

Methylation in Case

8.84E-01 (Median) Methylation in Control 8.12E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Systemic lupus erythematosus

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC2A14 in systemic lupus erythematosus [ 15 ]

Location

5'UTR (cg17537007)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.00E+00 Statistic Test p-value:3.62E-02; Z-score:-2.67E-02

Methylation in Case

8.80E-01 (Median) Methylation in Control 8.81E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC2A14 in systemic lupus erythematosus [ 15 ]

Location

TSS1500 (cg00955780)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:7.13E-03; Z-score:-3.10E-01

Methylation in Case

7.84E-01 (Median) Methylation in Control 7.95E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC2A14 in systemic lupus erythematosus [ 15 ]

Location

TSS200 (cg13323752)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.14E+00 Statistic Test p-value:3.91E-03; Z-score:-2.61E-01

Methylation in Case

7.07E-02 (Median) Methylation in Control 8.09E-02 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

microRNA

  Unclear Phenotype

         27 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-1182 directly targets SLC2A14 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1182 miRNA Mature ID miR-1182

miRNA Sequence

GAGGGUCUUGGGAGGGAUGUGAC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon2

miR-143 directly targets SLC2A14 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-143 miRNA Mature ID miR-143-3p

miRNA Sequence

UGAGAUGAAGCACUGUAGCUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon3

miR-29a directly targets SLC2A14 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-29a miRNA Mature ID miR-29a-3p

miRNA Sequence

UAGCACCAUCUGAAAUCGGUUA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon4

miR-29b directly targets SLC2A14 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-29b miRNA Mature ID miR-29b-3p

miRNA Sequence

UAGCACCAUUUGAAAUCAGUGUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon5

miR-29c directly targets SLC2A14 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-29c miRNA Mature ID miR-29c-3p

miRNA Sequence

UAGCACCAUUUGAAAUCGGUUA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon6

miR-3153 directly targets SLC2A14 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3153 miRNA Mature ID miR-3153

miRNA Sequence

GGGGAAAGCGAGUAGGGACAUUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon7

miR-3154 directly targets SLC2A14 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3154 miRNA Mature ID miR-3154

miRNA Sequence

CAGAAGGGGAGUUGGGAGCAGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon8

miR-335 directly targets SLC2A14 [ 17 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-335 miRNA Mature ID miR-335-5p

miRNA Sequence

UCAAGAGCAAUAACGAAAAAUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon9

miR-34a directly targets SLC2A14 [ 18 ]

Epigenetic Type

microRNA Experiment Method Proteomics

miRNA Stemloop ID

miR-34a miRNA Mature ID miR-34a-5p

miRNA Sequence

UGGCAGUGUCUUAGCUGGUUGU

miRNA Target Type

Direct

Experimental Material

Human colorectal cancer cell line (SW480)

  Epigenetic Phenomenon10

miR-4251 directly targets SLC2A14 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4251 miRNA Mature ID miR-4251

miRNA Sequence

CCUGAGAAAAGGGCCAA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon11

miR-4329 directly targets SLC2A14 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4329 miRNA Mature ID miR-4329

miRNA Sequence

CCUGAGACCCUAGUUCCAC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon12

miR-4499 directly targets SLC2A14 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4499 miRNA Mature ID miR-4499

miRNA Sequence

AAGACUGAGAGGAGGGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon13

miR-4708 directly targets SLC2A14 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4708 miRNA Mature ID miR-4708-5p

miRNA Sequence

AGAGAUGCCGCCUUGCUCCUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon14

miR-4770 directly targets SLC2A14 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4770 miRNA Mature ID miR-4770

miRNA Sequence

UGAGAUGACACUGUAGCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon15

miR-511 directly targets SLC2A14 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-511 miRNA Mature ID miR-511-3p

miRNA Sequence

AAUGUGUAGCAAAAGACAGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon16

miR-5584 directly targets SLC2A14 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-5584 miRNA Mature ID miR-5584-5p

miRNA Sequence

CAGGGAAAUGGGAAGAACUAGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon17

miR-5681a directly targets SLC2A14 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-5681a miRNA Mature ID miR-5681a

miRNA Sequence

AGAAAGGGUGGCAAUACCUCUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon18

miR-576 directly targets SLC2A14 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-576 miRNA Mature ID miR-576-3p

miRNA Sequence

AAGAUGUGGAAAAAUUGGAAUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon19

miR-6088 directly targets SLC2A14 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6088 miRNA Mature ID miR-6088

miRNA Sequence

AGAGAUGAAGCGGGGGGGCG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon20

miR-6733 directly targets SLC2A14 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6733 miRNA Mature ID miR-6733-5p

miRNA Sequence

UGGGAAAGACAAACUCAGAGUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon21

miR-6739 directly targets SLC2A14 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6739 miRNA Mature ID miR-6739-5p

miRNA Sequence

UGGGAAAGAGAAAGAACAAGUA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon22

miR-6760 directly targets SLC2A14 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6760 miRNA Mature ID miR-6760-5p

miRNA Sequence

CAGGGAGAAGGUGGAAGUGCAGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon23

miR-6761 directly targets SLC2A14 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6761 miRNA Mature ID miR-6761-5p

miRNA Sequence

UCUGAGAGAGCUCGAUGGCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon24

miR-6857 directly targets SLC2A14 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6857 miRNA Mature ID miR-6857-3p

miRNA Sequence

UGACUGAGCUUCUCCCCACAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon25

miR-7515 directly targets SLC2A14 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-7515 miRNA Mature ID miR-7515

miRNA Sequence

AGAAGGGAAGAUGGUGAC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon26

miR-873 directly targets SLC2A14 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-873 miRNA Mature ID miR-873-3p

miRNA Sequence

GGAGACUGAUGAGUUCCCGGGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon27

miR-98 directly targets SLC2A14 [ 19 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-98 miRNA Mature ID miR-98-5p

miRNA Sequence

UGAGGUAGUAAGUUGUAUUGUU

miRNA Target Type

Direct

Experimental Material

Human cervical cancer cell line (Hela)
References
1 Large-scale CpG methylation analysis identifies novel candidate genes and reveals methylation hotspots in acute lymphoblastic leukemia. Cancer Res. 2007 Mar 15;67(6):2617-25.
2 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
3 DNA Methylation Dynamics in Urological Tumors.
4 Genome-wide Scan for Methylation Profiles in Breast Cancer
5 The methylome of the celiac intestinal epithelium harbours genotype-independent alterations in the HLA region. Mol Ther Oncolytics. 2019 Feb 5;12:235-245.
6 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
7 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
8 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
9 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
10 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
11 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
12 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
13 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
14 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
15 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
16 In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio. 2013 Apr 16;4(2):e000193.
17 Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.
18 Genome-wide characterization of miR-34a induced changes in protein and mRNA expression by a combined pulsed SILAC and microarray analysis. Mol Cell Proteomics. 2011 Aug;10(8):M111.010462.
19 MicroRNA target prediction by expression analysis of host genes. Genome Res. 2009 Mar;19(3):481-90.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.