Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0252 Transporter Info
Gene Name SLC2A10
Transporter Name Glucose transporter type 10
Gene ID
81031
UniProt ID
O95528
Epigenetic Regulations of This DT (EGR)

Methylation

  Bladder cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC2A10 in bladder cancer [ 1 ]

Location

 TSS1500 (cg27610561)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-2.34E+00 Statistic Test p-value:5.41E-11; Z-score:-9.52E+00

Methylation in Case

 2.56E-01 (Median) Methylation in Control 5.99E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC2A10 in bladder cancer [ 1 ]

Location

 TSS200 (cg08038974)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.43E+00 Statistic Test p-value:4.38E-02; Z-score:-1.58E+00

Methylation in Case

 9.26E-02 (Median) Methylation in Control 1.33E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC2A10 in bladder cancer [ 1 ]

Location

 TSS200 (cg03940556)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.24E+00 Statistic Test p-value:4.78E-02; Z-score:-1.64E+00

Methylation in Case

 8.29E-02 (Median) Methylation in Control 1.03E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC2A10 in bladder cancer [ 1 ]

Location

 Body (cg10156714)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.35E+00 Statistic Test p-value:4.10E-09; Z-score:-1.46E+01

Methylation in Case

 6.40E-01 (Median) Methylation in Control 8.67E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC2A10 in breast cancer [ 2 ]

Location

 TSS1500 (cg27610561)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.25E+00 Statistic Test p-value:2.57E-09; Z-score:-2.94E+00

Methylation in Case

 6.13E-01 (Median) Methylation in Control 7.64E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC2A10 in breast cancer [ 2 ]

Location

 TSS1500 (cg23514532)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.27E+00 Statistic Test p-value:3.20E-06; Z-score:1.07E+00

Methylation in Case

 1.61E-01 (Median) Methylation in Control 1.27E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC2A10 in breast cancer [ 2 ]

Location

 TSS200 (cg03940556)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.16E+00 Statistic Test p-value:1.38E-03; Z-score:6.24E-01

Methylation in Case

 9.34E-02 (Median) Methylation in Control 8.08E-02 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC2A10 in breast cancer [ 2 ]

Location

 Body (cg10156714)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.23E+00 Statistic Test p-value:1.95E-07; Z-score:-1.61E+00

Methylation in Case

 6.98E-01 (Median) Methylation in Control 8.60E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC2A10 in breast cancer [ 2 ]

Location

 Body (cg07162198)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.86E+00 Statistic Test p-value:4.24E-02; Z-score:-8.70E-01

Methylation in Case

 7.21E-02 (Median) Methylation in Control 1.34E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC2A10 in clear cell renal cell carcinoma [ 3 ]

Location

 TSS1500 (cg23514532)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.48E+00 Statistic Test p-value:4.60E-05; Z-score:1.43E+00

Methylation in Case

 1.65E-01 (Median) Methylation in Control 1.12E-01 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC2A10 in clear cell renal cell carcinoma [ 3 ]

Location

 TSS200 (cg17298269)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.13E+00 Statistic Test p-value:2.85E-02; Z-score:3.87E-01

Methylation in Case

 9.83E-02 (Median) Methylation in Control 8.68E-02 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC2A10 in clear cell renal cell carcinoma [ 3 ]

Location

 Body (cg07162198)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.75E+00 Statistic Test p-value:7.72E-05; Z-score:2.89E+00

Methylation in Case

 1.96E-01 (Median) Methylation in Control 1.12E-01 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC2A10 in clear cell renal cell carcinoma [ 3 ]

Location

 Body (cg16117472)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.45E+00 Statistic Test p-value:2.58E-03; Z-score:1.64E+00

Methylation in Case

 4.85E-02 (Median) Methylation in Control 3.34E-02 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC2A10 in clear cell renal cell carcinoma [ 3 ]

Location

 Body (cg17550582)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.20E+00 Statistic Test p-value:5.18E-03; Z-score:6.88E-01

Methylation in Case

 2.99E-02 (Median) Methylation in Control 2.48E-02 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Colon cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC2A10 in colon adenocarcinoma [ 4 ]

Location

 TSS1500 (cg07176692)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.64E+00 Statistic Test p-value:2.00E-05; Z-score:-2.25E+00

Methylation in Case

 2.58E-01 (Median) Methylation in Control 4.24E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC2A10 in colon adenocarcinoma [ 4 ]

Location

 TSS1500 (cg04934807)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:2.06E+00 Statistic Test p-value:4.23E-04; Z-score:7.24E+00

Methylation in Case

 2.60E-01 (Median) Methylation in Control 1.26E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC2A10 in colon adenocarcinoma [ 4 ]

Location

 Body (cg19881928)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.45E+00 Statistic Test p-value:8.24E-04; Z-score:1.51E+00

Methylation in Case

 2.92E-01 (Median) Methylation in Control 2.01E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC2A10 in colon adenocarcinoma [ 4 ]

Location

 Body (cg02262187)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.33E+00 Statistic Test p-value:4.22E-03; Z-score:-1.28E+00

Methylation in Case

 1.35E-01 (Median) Methylation in Control 1.80E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC2A10 in colon adenocarcinoma [ 4 ]

Location

 3'UTR (cg22669120)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.33E+00 Statistic Test p-value:2.73E-05; Z-score:-1.50E+00

Methylation in Case

 3.90E-01 (Median) Methylation in Control 5.18E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC2A10 in colorectal cancer [ 5 ]

Location

 TSS1500 (cg23514532)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.01E+00 Statistic Test p-value:3.71E-02; Z-score:5.11E-02

Methylation in Case

 2.13E-01 (Median) Methylation in Control 2.10E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC2A10 in colorectal cancer [ 5 ]

Location

 TSS200 (cg03940556)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.03E+00 Statistic Test p-value:6.61E-03; Z-score:-1.56E-01

Methylation in Case

 6.94E-02 (Median) Methylation in Control 7.15E-02 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC2A10 in colorectal cancer [ 5 ]

Location

 TSS200 (cg17298269)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.01E+00 Statistic Test p-value:8.91E-03; Z-score:7.80E-02

Methylation in Case

 2.41E-01 (Median) Methylation in Control 2.39E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC2A10 in colorectal cancer [ 5 ]

Location

 Body (cg10156714)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.09E+00 Statistic Test p-value:5.32E-12; Z-score:-4.87E+00

Methylation in Case

 8.44E-01 (Median) Methylation in Control 9.21E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC2A10 in colorectal cancer [ 5 ]

Location

 Body (cg07162198)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:3.42E+00 Statistic Test p-value:3.05E-09; Z-score:3.35E+00

Methylation in Case

 2.24E-01 (Median) Methylation in Control 6.54E-02 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC2A10 in colorectal cancer [ 5 ]

Location

 Body (cg17550582)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.28E+00 Statistic Test p-value:8.42E-06; Z-score:1.40E+00

Methylation in Case

 1.25E-01 (Median) Methylation in Control 9.79E-02 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon7

 Methylation of SLC2A10 in colorectal cancer [ 5 ]

Location

 Body (cg16117472)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.06E+00 Statistic Test p-value:1.97E-04; Z-score:3.99E-01

Methylation in Case

 1.35E-01 (Median) Methylation in Control 1.27E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC2A10 in hepatocellular carcinoma [ 6 ]

Location

 TSS1500 (cg19631365)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.28E+00 Statistic Test p-value:2.60E-11; Z-score:-2.80E+00

Methylation in Case

 5.59E-01 (Median) Methylation in Control 7.15E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC2A10 in hepatocellular carcinoma [ 6 ]

Location

 TSS1500 (cg27610561)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.01E+00 Statistic Test p-value:1.11E-04; Z-score:-4.82E-01

Methylation in Case

 8.33E-01 (Median) Methylation in Control 8.40E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC2A10 in hepatocellular carcinoma [ 6 ]

Location

 TSS200 (cg08038974)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.13E+00 Statistic Test p-value:1.46E-02; Z-score:-3.06E-01

Methylation in Case

 9.14E-02 (Median) Methylation in Control 1.03E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC2A10 in hepatocellular carcinoma [ 6 ]

Location

 TSS200 (cg03940556)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.08E+00 Statistic Test p-value:2.14E-02; Z-score:-2.59E-01

Methylation in Case

 9.12E-02 (Median) Methylation in Control 9.88E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC2A10 in hepatocellular carcinoma [ 6 ]

Location

 Body (cg21207636)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.45E+00 Statistic Test p-value:1.68E-15; Z-score:-8.32E+00

Methylation in Case

 5.90E-01 (Median) Methylation in Control 8.52E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  HIV infection

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC2A10 in HIV infection [ 7 ]

Location

 TSS1500 (cg23514532)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.42E+00 Statistic Test p-value:3.18E-05; Z-score:1.57E+00

Methylation in Case

 2.83E-01 (Median) Methylation in Control 1.99E-01 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC2A10 in HIV infection [ 7 ]

Location

 TSS200 (cg08038974)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.28E+00 Statistic Test p-value:2.97E-06; Z-score:1.45E+00

Methylation in Case

 2.76E-01 (Median) Methylation in Control 2.16E-01 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC2A10 in HIV infection [ 7 ]

Location

 TSS200 (cg03940556)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.25E+00 Statistic Test p-value:3.93E-05; Z-score:9.96E-01

Methylation in Case

 1.37E-01 (Median) Methylation in Control 1.10E-01 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC2A10 in HIV infection [ 7 ]

Location

 Body (cg07162198)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:2.00E+00 Statistic Test p-value:2.20E-05; Z-score:2.16E+00

Methylation in Case

 1.67E-01 (Median) Methylation in Control 8.37E-02 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC2A10 in HIV infection [ 7 ]

Location

 Body (cg10156714)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.03E+00 Statistic Test p-value:2.49E-03; Z-score:-1.16E+00

Methylation in Case

 8.59E-01 (Median) Methylation in Control 8.88E-01 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC2A10 in HIV infection [ 7 ]

Location

 Body (cg17550582)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.16E+00 Statistic Test p-value:2.95E-03; Z-score:7.30E-01

Methylation in Case

 7.90E-02 (Median) Methylation in Control 6.78E-02 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Panic disorder

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC2A10 in panic disorder [ 8 ]

Location

 TSS1500 (cg27610561)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.07E+00 Statistic Test p-value:1.34E-02; Z-score:4.95E-01

Methylation in Case

 3.38E+00 (Median) Methylation in Control 3.17E+00 (Median)

Studied Phenotype

 Panic disorder[ ICD-11:6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC2A10 in panic disorder [ 8 ]

Location

 Body (cg07162198)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-9.02E-01 Statistic Test p-value:5.45E-03; Z-score:-4.84E-01

Methylation in Case

 -4.67E+00 (Median) Methylation in Control -4.22E+00 (Median)

Studied Phenotype

 Panic disorder[ ICD-11:6B01]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC2A10 in papillary thyroid cancer [ 9 ]

Location

 TSS1500 (cg27610561)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.06E+00 Statistic Test p-value:1.36E-03; Z-score:-1.03E+00

Methylation in Case

 7.67E-01 (Median) Methylation in Control 8.12E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC2A10 in papillary thyroid cancer [ 9 ]

Location

 Body (cg16117472)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.07E+00 Statistic Test p-value:2.14E-03; Z-score:5.00E-01

Methylation in Case

 7.41E-02 (Median) Methylation in Control 6.92E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC2A10 in papillary thyroid cancer [ 9 ]

Location

 Body (cg07162198)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.15E+00 Statistic Test p-value:5.51E-03; Z-score:4.96E-01

Methylation in Case

 1.20E-01 (Median) Methylation in Control 1.05E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Atypical teratoid rhabdoid tumor

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC2A10 in atypical teratoid rhabdoid tumor [ 10 ]

Location

 Body (cg07162198)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.14E+00 Statistic Test p-value:3.42E-03; Z-score:1.10E+00

Methylation in Case

 7.09E-01 (Median) Methylation in Control 6.22E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC2A10 in atypical teratoid rhabdoid tumor [ 10 ]

Location

 Body (cg10156714)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.09E+00 Statistic Test p-value:1.37E-02; Z-score:-4.83E-01

Methylation in Case

 6.44E-01 (Median) Methylation in Control 7.00E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC2A10 in lung adenocarcinoma [ 11 ]

Location

 Body (cg07162198)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.88E+00 Statistic Test p-value:9.10E-03; Z-score:3.43E+00

Methylation in Case

 2.01E-01 (Median) Methylation in Control 1.07E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC2A10 in lung adenocarcinoma [ 11 ]

Location

 Body (cg17550582)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.23E+00 Statistic Test p-value:3.13E-02; Z-score:1.69E+00

Methylation in Case

 1.18E-01 (Median) Methylation in Control 9.58E-02 (Median)

Studied Phenotype

 Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC2A10 in pancretic ductal adenocarcinoma [ 12 ]

Location

 Body (cg16909495)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.40E+00 Statistic Test p-value:5.94E-21; Z-score:3.06E+00

Methylation in Case

 5.05E-01 (Median) Methylation in Control 3.62E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC2A10 in pancretic ductal adenocarcinoma [ 12 ]

Location

 Body (cg15828364)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.36E+00 Statistic Test p-value:3.03E-11; Z-score:1.63E+00

Methylation in Case

 3.62E-01 (Median) Methylation in Control 2.66E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC2A10 in pancretic ductal adenocarcinoma [ 12 ]

Location

 Body (cg20209499)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.26E+00 Statistic Test p-value:9.98E-05; Z-score:1.20E+00

Methylation in Case

 6.72E-01 (Median) Methylation in Control 5.33E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC2A10 in pancretic ductal adenocarcinoma [ 12 ]

Location

 Body (cg04066400)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.00E+00 Statistic Test p-value:1.97E-02; Z-score:-2.50E-02

Methylation in Case

 8.80E-01 (Median) Methylation in Control 8.80E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Prostate cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC2A10 in prostate cancer [ 13 ]

Location

 Body (cg18869815)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.11E+00 Statistic Test p-value:3.37E-02; Z-score:1.48E+00

Methylation in Case

 8.38E-01 (Median) Methylation in Control 7.52E-01 (Median)

Studied Phenotype

 Prostate cancer[ ICD-11:2C82]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC2A10 in systemic lupus erythematosus [ 14 ]

Location

 Body (cg10156714)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.01E+00 Statistic Test p-value:4.40E-03; Z-score:-3.20E-01

Methylation in Case

 8.76E-01 (Median) Methylation in Control 8.86E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

 Patient tissue samples

  Lymphoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Significant hypermethylation of SLC2A10 in lymphoma than that in healthy individual

Studied Phenotype

 Lymphoma [ICD-11:2B30]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value:1.55E-26; Fold-change:0.532619712; Z-score:25.31383139
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

microRNA

  Unclear Phenotype

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 miR-335 directly targets SLC2A10 [ 15 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-335 miRNA Mature ID miR-335-5p

miRNA Sequence

 UCAAGAGCAAUAACGAAAAAUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 DNA Methylation Dynamics in Urological Tumors.
2 Genome-wide Scan for Methylation Profiles in Breast Cancer
3 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
4 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
5 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
7 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
8 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
9 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
10 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
11 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
12 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
13 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
14 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
15 Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.