Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0249 Transporter Info
Gene Name SLC29A3
Transporter Name Equilibrative nucleoside transporter 3
Gene ID
55315
UniProt ID
Q9BZD2
Epigenetic Regulations of This DT (EGR)

Methylation

  Pancretic ductal adenocarcinoma

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC29A3 in pancretic ductal adenocarcinoma [ 1 ]

Location

 5'UTR (cg20890210)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:2.81E+00 Statistic Test p-value:8.03E-14; Z-score:2.63E+00

Methylation in Case

 3.82E-01 (Median) Methylation in Control 1.36E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC29A3 in pancretic ductal adenocarcinoma [ 1 ]

Location

 5'UTR (cg20597714)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.18E+00 Statistic Test p-value:1.42E-02; Z-score:-7.64E-01

Methylation in Case

 3.07E-02 (Median) Methylation in Control 3.63E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC29A3 in pancretic ductal adenocarcinoma [ 1 ]

Location

 TSS1500 (cg01517431)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.08E+00 Statistic Test p-value:2.00E-02; Z-score:-8.09E-01

Methylation in Case

 7.42E-01 (Median) Methylation in Control 7.99E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC29A3 in pancretic ductal adenocarcinoma [ 1 ]

Location

 1stExon (cg17721710)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.05E+00 Statistic Test p-value:1.16E-05; Z-score:1.89E-01

Methylation in Case

 7.89E-02 (Median) Methylation in Control 7.52E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC29A3 in pancretic ductal adenocarcinoma [ 1 ]

Location

 Body (cg10208461)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.07E+00 Statistic Test p-value:1.26E-02; Z-score:-3.51E-01

Methylation in Case

 9.07E-02 (Median) Methylation in Control 9.66E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Bladder cancer

          11 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC29A3 in bladder cancer [ 2 ]

Location

 TSS1500 (cg09378339)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.24E+00 Statistic Test p-value:1.57E-07; Z-score:-1.12E+01

Methylation in Case

 6.93E-01 (Median) Methylation in Control 8.62E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC29A3 in bladder cancer [ 2 ]

Location

 TSS1500 (cg19241744)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-2.17E+00 Statistic Test p-value:9.26E-07; Z-score:-6.22E+00

Methylation in Case

 1.13E-01 (Median) Methylation in Control 2.45E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC29A3 in bladder cancer [ 2 ]

Location

 TSS1500 (cg05950509)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.19E+00 Statistic Test p-value:9.88E-06; Z-score:-8.03E+00

Methylation in Case

 6.45E-01 (Median) Methylation in Control 7.66E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC29A3 in bladder cancer [ 2 ]

Location

 TSS200 (cg04402744)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.66E+00 Statistic Test p-value:2.23E-03; Z-score:-1.98E+00

Methylation in Case

 1.28E-02 (Median) Methylation in Control 2.12E-02 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC29A3 in bladder cancer [ 2 ]

Location

 TSS200 (cg06270147)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.24E+00 Statistic Test p-value:9.56E-03; Z-score:1.28E+00

Methylation in Case

 4.53E-02 (Median) Methylation in Control 3.65E-02 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC29A3 in bladder cancer [ 2 ]

Location

 Body (cg11480762)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.97E+00 Statistic Test p-value:6.02E-12; Z-score:-2.33E+01

Methylation in Case

 3.22E-01 (Median) Methylation in Control 6.36E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon7

 Methylation of SLC29A3 in bladder cancer [ 2 ]

Location

 Body (cg08874645)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.70E+00 Statistic Test p-value:9.85E-09; Z-score:-6.95E+00

Methylation in Case

 3.30E-01 (Median) Methylation in Control 5.60E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon8

 Methylation of SLC29A3 in bladder cancer [ 2 ]

Location

 Body (cg02354828)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.10E+00 Statistic Test p-value:1.69E-05; Z-score:-4.29E+00

Methylation in Case

 7.85E-01 (Median) Methylation in Control 8.62E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon9

 Methylation of SLC29A3 in bladder cancer [ 2 ]

Location

 Body (cg24631518)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.02E+00 Statistic Test p-value:1.97E-03; Z-score:-4.10E+00

Methylation in Case

 8.67E-01 (Median) Methylation in Control 8.85E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon10

 Methylation of SLC29A3 in bladder cancer [ 2 ]

Location

 Body (cg22704915)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.42E+00 Statistic Test p-value:4.58E-03; Z-score:1.95E+00

Methylation in Case

 5.58E-02 (Median) Methylation in Control 3.92E-02 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon11

 Methylation of SLC29A3 in bladder cancer [ 2 ]

Location

 Body (cg02114341)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.02E+00 Statistic Test p-value:3.80E-02; Z-score:-1.20E+00

Methylation in Case

 8.23E-01 (Median) Methylation in Control 8.44E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC29A3 in breast cancer [ 3 ]

Location

 TSS1500 (cg09378339)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.03E+00 Statistic Test p-value:4.30E-02; Z-score:1.84E-01

Methylation in Case

 8.01E-01 (Median) Methylation in Control 7.76E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC29A3 in breast cancer [ 3 ]

Location

 TSS200 (cg06270147)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.59E+00 Statistic Test p-value:4.06E-04; Z-score:7.11E-01

Methylation in Case

 5.75E-02 (Median) Methylation in Control 3.62E-02 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC29A3 in breast cancer [ 3 ]

Location

 Body (cg11480762)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.17E+00 Statistic Test p-value:1.26E-14; Z-score:-2.21E+00

Methylation in Case

 6.65E-01 (Median) Methylation in Control 7.78E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC29A3 in breast cancer [ 3 ]

Location

 Body (cg24631518)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.02E+00 Statistic Test p-value:9.84E-07; Z-score:-1.07E+00

Methylation in Case

 8.44E-01 (Median) Methylation in Control 8.64E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC29A3 in breast cancer [ 3 ]

Location

 Body (cg22704915)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.31E+00 Statistic Test p-value:3.06E-02; Z-score:2.43E-01

Methylation in Case

 3.98E-02 (Median) Methylation in Control 3.03E-02 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC29A3 in breast cancer [ 3 ]

Location

 Body (cg01478450)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.15E+00 Statistic Test p-value:3.31E-02; Z-score:-6.19E-01

Methylation in Case

 6.35E-02 (Median) Methylation in Control 7.29E-02 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC29A3 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS1500 (cg19241744)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.32E+00 Statistic Test p-value:1.92E-07; Z-score:-3.54E+00

Methylation in Case

 3.45E-01 (Median) Methylation in Control 4.55E-01 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC29A3 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS200 (cg23634459)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.19E+00 Statistic Test p-value:7.94E-04; Z-score:-6.85E-01

Methylation in Case

 2.44E-02 (Median) Methylation in Control 2.91E-02 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC29A3 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS200 (cg06270147)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.11E+00 Statistic Test p-value:1.49E-03; Z-score:8.11E-01

Methylation in Case

 3.20E-02 (Median) Methylation in Control 2.89E-02 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC29A3 in clear cell renal cell carcinoma [ 4 ]

Location

 Body (cg01478450)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.13E+00 Statistic Test p-value:3.71E-03; Z-score:6.02E-01

Methylation in Case

 2.77E-02 (Median) Methylation in Control 2.45E-02 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Colon cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC29A3 in colon adenocarcinoma [ 5 ]

Location

 TSS1500 (cg27645544)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.27E+00 Statistic Test p-value:1.60E-04; Z-score:-1.74E+00

Methylation in Case

 4.64E-01 (Median) Methylation in Control 5.91E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC29A3 in colon adenocarcinoma [ 5 ]

Location

 TSS1500 (cg23702688)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.33E+00 Statistic Test p-value:2.65E-04; Z-score:-1.61E+00

Methylation in Case

 2.13E-01 (Median) Methylation in Control 2.84E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC29A3 in colon adenocarcinoma [ 5 ]

Location

 TSS200 (cg22821560)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.32E+00 Statistic Test p-value:5.91E-07; Z-score:-5.21E+00

Methylation in Case

 5.60E-01 (Median) Methylation in Control 7.41E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC29A3 in colon adenocarcinoma [ 5 ]

Location

 Body (cg21156276)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.20E+00 Statistic Test p-value:6.02E-04; Z-score:-1.19E+00

Methylation in Case

 3.70E-01 (Median) Methylation in Control 4.43E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  HIV infection

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC29A3 in HIV infection [ 6 ]

Location

 TSS1500 (cg19241744)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.14E+00 Statistic Test p-value:1.19E-04; Z-score:-8.73E-01

Methylation in Case

 2.94E-01 (Median) Methylation in Control 3.35E-01 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC29A3 in HIV infection [ 6 ]

Location

 TSS1500 (cg05950509)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.04E+00 Statistic Test p-value:3.24E-03; Z-score:-1.21E+00

Methylation in Case

 8.30E-01 (Median) Methylation in Control 8.60E-01 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC29A3 in HIV infection [ 6 ]

Location

 Body (cg23761815)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.14E+00 Statistic Test p-value:7.68E-21; Z-score:3.21E+00

Methylation in Case

 9.05E-01 (Median) Methylation in Control 7.93E-01 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC29A3 in HIV infection [ 6 ]

Location

 Body (cg08874645)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.47E+00 Statistic Test p-value:5.93E-08; Z-score:2.90E+00

Methylation in Case

 4.16E-01 (Median) Methylation in Control 2.83E-01 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC29A3 in HIV infection [ 6 ]

Location

 Body (cg02354828)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.01E+00 Statistic Test p-value:3.71E-03; Z-score:7.14E-01

Methylation in Case

 9.32E-01 (Median) Methylation in Control 9.22E-01 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC29A3 in HIV infection [ 6 ]

Location

 Body (cg11480762)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.14E+00 Statistic Test p-value:3.20E-02; Z-score:1.74E+00

Methylation in Case

 6.78E-01 (Median) Methylation in Control 5.92E-01 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC29A3 in lung adenocarcinoma [ 7 ]

Location

 TSS1500 (cg19241744)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.16E+00 Statistic Test p-value:4.34E-02; Z-score:-1.67E+00

Methylation in Case

 3.20E-01 (Median) Methylation in Control 3.72E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC29A3 in lung adenocarcinoma [ 7 ]

Location

 TSS1500 (cg05950509)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.06E+00 Statistic Test p-value:4.87E-02; Z-score:-9.14E-01

Methylation in Case

 7.63E-01 (Median) Methylation in Control 8.09E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC29A3 in papillary thyroid cancer [ 8 ]

Location

 TSS1500 (cg09378339)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.04E+00 Statistic Test p-value:4.29E-02; Z-score:1.34E+00

Methylation in Case

 8.63E-01 (Median) Methylation in Control 8.28E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC29A3 in papillary thyroid cancer [ 8 ]

Location

 TSS200 (cg06270147)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.08E+00 Statistic Test p-value:3.62E-02; Z-score:6.62E-01

Methylation in Case

 9.25E-02 (Median) Methylation in Control 8.59E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC29A3 in papillary thyroid cancer [ 8 ]

Location

 Body (cg11480762)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.04E+00 Statistic Test p-value:1.84E-08; Z-score:-1.73E+00

Methylation in Case

 8.90E-01 (Median) Methylation in Control 9.23E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC29A3 in papillary thyroid cancer [ 8 ]

Location

 Body (cg06702884)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.10E+00 Statistic Test p-value:6.08E-04; Z-score:7.46E-01

Methylation in Case

 8.05E-01 (Median) Methylation in Control 7.32E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC29A3 in hepatocellular carcinoma [ 9 ]

Location

 TSS200 (cg06270147)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.25E+00 Statistic Test p-value:9.29E-03; Z-score:4.76E-01

Methylation in Case

 4.11E-02 (Median) Methylation in Control 3.30E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC29A3 in hepatocellular carcinoma [ 9 ]

Location

 TSS200 (cg04402744)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.02E+00 Statistic Test p-value:9.94E-03; Z-score:3.95E-02

Methylation in Case

 5.21E-02 (Median) Methylation in Control 5.12E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC29A3 in hepatocellular carcinoma [ 9 ]

Location

 Body (cg06702884)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.04E+00 Statistic Test p-value:2.43E-03; Z-score:-4.79E-01

Methylation in Case

 7.56E-01 (Median) Methylation in Control 7.84E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC29A3 in hepatocellular carcinoma [ 9 ]

Location

 Body (cg02354828)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.01E+00 Statistic Test p-value:3.87E-03; Z-score:-3.88E-01

Methylation in Case

 8.59E-01 (Median) Methylation in Control 8.65E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC29A3 in hepatocellular carcinoma [ 9 ]

Location

 Body (cg01478450)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.05E+00 Statistic Test p-value:4.79E-02; Z-score:-2.53E-01

Methylation in Case

 6.36E-02 (Median) Methylation in Control 6.66E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC29A3 in hepatocellular carcinoma [ 9 ]

Location

 3'UTR (cg10366878)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.19E+00 Statistic Test p-value:4.46E-10; Z-score:-2.54E+00

Methylation in Case

 6.33E-01 (Median) Methylation in Control 7.53E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon7

 Methylation of SLC29A3 in hepatocellular carcinoma [ 9 ]

Location

 3'UTR (cg01442319)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.14E+00 Statistic Test p-value:1.27E-09; Z-score:-3.04E+00

Methylation in Case

 7.24E-01 (Median) Methylation in Control 8.28E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Atypical teratoid rhabdoid tumor

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC29A3 in atypical teratoid rhabdoid tumor [ 10 ]

Location

 Body (cg01478450)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.03E+00 Statistic Test p-value:7.00E-05; Z-score:-8.33E-01

Methylation in Case

 8.72E-01 (Median) Methylation in Control 9.00E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC29A3 in atypical teratoid rhabdoid tumor [ 10 ]

Location

 Body (cg02114341)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.11E+00 Statistic Test p-value:1.16E-04; Z-score:-8.83E-01

Methylation in Case

 7.03E-01 (Median) Methylation in Control 7.80E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC29A3 in atypical teratoid rhabdoid tumor [ 10 ]

Location

 Body (cg02354828)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.15E+00 Statistic Test p-value:1.57E-04; Z-score:8.85E-01

Methylation in Case

 8.71E-01 (Median) Methylation in Control 7.60E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC29A3 in atypical teratoid rhabdoid tumor [ 10 ]

Location

 Body (cg06702884)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.11E+00 Statistic Test p-value:2.83E-03; Z-score:-6.18E-01

Methylation in Case

 6.69E-01 (Median) Methylation in Control 7.44E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC29A3 in atypical teratoid rhabdoid tumor [ 10 ]

Location

 Body (cg08874645)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.04E+00 Statistic Test p-value:8.56E-03; Z-score:5.92E-01

Methylation in Case

 9.12E-01 (Median) Methylation in Control 8.80E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC29A3 in atypical teratoid rhabdoid tumor [ 10 ]

Location

 Body (cg11480762)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.01E+00 Statistic Test p-value:2.29E-02; Z-score:-6.53E-02

Methylation in Case

 6.11E-01 (Median) Methylation in Control 6.20E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon7

 Methylation of SLC29A3 in atypical teratoid rhabdoid tumor [ 10 ]

Location

 3'UTR (cg15937155)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.97E+00 Statistic Test p-value:6.93E-11; Z-score:1.92E+00

Methylation in Case

 2.26E-01 (Median) Methylation in Control 1.14E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC29A3 in colorectal cancer [ 11 ]

Location

 Body (cg23761815)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.01E+00 Statistic Test p-value:5.68E-05; Z-score:-1.04E+00

Methylation in Case

 9.34E-01 (Median) Methylation in Control 9.44E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC29A3 in colorectal cancer [ 11 ]

Location

 Body (cg22704915)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.29E+00 Statistic Test p-value:5.99E-04; Z-score:8.73E-01

Methylation in Case

 2.40E-02 (Median) Methylation in Control 1.86E-02 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC29A3 in colorectal cancer [ 11 ]

Location

 Body (cg02354828)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.01E+00 Statistic Test p-value:5.66E-03; Z-score:-5.40E-01

Methylation in Case

 9.49E-01 (Median) Methylation in Control 9.54E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC29A3 in colorectal cancer [ 11 ]

Location

 Body (cg24631518)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.00E+00 Statistic Test p-value:2.89E-02; Z-score:-2.67E-02

Methylation in Case

 9.38E-01 (Median) Methylation in Control 9.38E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Panic disorder

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC29A3 in panic disorder [ 12 ]

Location

 Body (cg08874645)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-9.21E-01 Statistic Test p-value:8.38E-03; Z-score:-4.77E-01

Methylation in Case

 -2.21E+00 (Median) Methylation in Control -2.04E+00 (Median)

Studied Phenotype

 Panic disorder[ ICD-11:6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC29A3 in panic disorder [ 12 ]

Location

 Body (cg17434453)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.05E+00 Statistic Test p-value:4.52E-02; Z-score:4.63E-01

Methylation in Case

 2.71E+00 (Median) Methylation in Control 2.58E+00 (Median)

Studied Phenotype

 Panic disorder[ ICD-11:6B01]

Experimental Material

 Patient tissue samples

  Prostate cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC29A3 in prostate cancer [ 13 ]

Location

 Body (cg21799607)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.52E+00 Statistic Test p-value:9.20E-03; Z-score:-5.94E+00

Methylation in Case

 5.41E-01 (Median) Methylation in Control 8.25E-01 (Median)

Studied Phenotype

 Prostate cancer[ ICD-11:2C82]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC29A3 in systemic lupus erythematosus [ 14 ]

Location

 Body (cg02114341)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.01E+00 Statistic Test p-value:7.17E-03; Z-score:-1.12E-01

Methylation in Case

 8.43E-01 (Median) Methylation in Control 8.48E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 miR-335 directly targets SLC29A3 [ 15 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-335 miRNA Mature ID miR-335-5p

miRNA Sequence

 UCAAGAGCAAUAACGAAAAAUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
2 DNA Methylation Dynamics in Urological Tumors.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
5 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
6 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
7 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
8 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
9 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
10 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
11 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
12 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
13 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
14 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
15 Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.