Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0248 Transporter Info
Gene Name SLC29A2
Transporter Name Equilibrative nucleoside transporter 2
Gene ID
3177
UniProt ID
Q14542
Epigenetic Regulations of This DT (EGR)

Methylation

  Prostate cancer

            8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC29A2 in prostate cancer [ 1 ]

Location

 5'UTR (cg25099065)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.43E+00 Statistic Test p-value:5.92E-03; Z-score:3.04E+00

Methylation in Case

 8.65E-01 (Median) Methylation in Control 6.06E-01 (Median)

Studied Phenotype

 Prostate cancer[ ICD-11:2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC29A2 in prostate cancer [ 1 ]

Location

 TSS1500 (cg03616221)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.46E+00 Statistic Test p-value:2.37E-03; Z-score:3.60E+00

Methylation in Case

 5.30E-01 (Median) Methylation in Control 3.64E-01 (Median)

Studied Phenotype

 Prostate cancer[ ICD-11:2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC29A2 in prostate cancer [ 1 ]

Location

 TSS1500 (cg04660577)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.06E+00 Statistic Test p-value:7.95E-03; Z-score:2.14E+00

Methylation in Case

 8.93E-01 (Median) Methylation in Control 8.43E-01 (Median)

Studied Phenotype

 Prostate cancer[ ICD-11:2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC29A2 in prostate cancer [ 1 ]

Location

 TSS200 (cg24599189)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.75E+00 Statistic Test p-value:4.04E-03; Z-score:4.04E+00

Methylation in Case

 1.05E-01 (Median) Methylation in Control 6.01E-02 (Median)

Studied Phenotype

 Prostate cancer[ ICD-11:2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC29A2 in prostate cancer [ 1 ]

Location

 TSS200 (cg09028204)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.41E+00 Statistic Test p-value:1.58E-02; Z-score:2.05E+00

Methylation in Case

 7.22E-01 (Median) Methylation in Control 5.13E-01 (Median)

Studied Phenotype

 Prostate cancer[ ICD-11:2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC29A2 in prostate cancer [ 1 ]

Location

 TSS200 (cg22466830)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.30E+00 Statistic Test p-value:1.68E-02; Z-score:-1.97E+00

Methylation in Case

 2.36E-02 (Median) Methylation in Control 3.07E-02 (Median)

Studied Phenotype

 Prostate cancer[ ICD-11:2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon7

 Methylation of SLC29A2 in prostate cancer [ 1 ]

Location

 Body (cg05976074)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.46E+00 Statistic Test p-value:3.24E-04; Z-score:4.80E+00

Methylation in Case

 5.74E-01 (Median) Methylation in Control 3.93E-01 (Median)

Studied Phenotype

 Prostate cancer[ ICD-11:2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon8

 Methylation of SLC29A2 in prostate cancer [ 1 ]

Location

 Body (cg19864416)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.61E+00 Statistic Test p-value:6.98E-04; Z-score:5.03E+00

Methylation in Case

 1.86E-01 (Median) Methylation in Control 1.16E-01 (Median)

Studied Phenotype

 Prostate cancer[ ICD-11:2C82]

Experimental Material

 Patient tissue samples

  Bladder cancer

            9 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC29A2 in bladder cancer [ 2 ]

Location

 TSS1500 (cg16909570)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.04E+00 Statistic Test p-value:2.57E-02; Z-score:-6.76E-01

Methylation in Case

 6.56E-02 (Median) Methylation in Control 6.80E-02 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC29A2 in bladder cancer [ 2 ]

Location

 Body (cg08181642)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.20E+00 Statistic Test p-value:1.25E-07; Z-score:8.17E+00

Methylation in Case

 7.15E-01 (Median) Methylation in Control 5.94E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC29A2 in bladder cancer [ 2 ]

Location

 Body (cg15128778)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.24E+00 Statistic Test p-value:5.77E-07; Z-score:-7.54E+00

Methylation in Case

 5.72E-01 (Median) Methylation in Control 7.08E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC29A2 in bladder cancer [ 2 ]

Location

 Body (cg23250019)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.34E+00 Statistic Test p-value:7.49E-06; Z-score:-6.78E+00

Methylation in Case

 4.75E-01 (Median) Methylation in Control 6.37E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC29A2 in bladder cancer [ 2 ]

Location

 Body (cg10616300)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.46E+00 Statistic Test p-value:1.24E-04; Z-score:-3.36E+00

Methylation in Case

 8.59E-02 (Median) Methylation in Control 1.25E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC29A2 in bladder cancer [ 2 ]

Location

 Body (cg18002602)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.46E+00 Statistic Test p-value:8.31E-04; Z-score:-3.12E+00

Methylation in Case

 1.70E-01 (Median) Methylation in Control 2.49E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon7

 Methylation of SLC29A2 in bladder cancer [ 2 ]

Location

 Body (cg15022049)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.07E+00 Statistic Test p-value:1.72E-03; Z-score:2.81E+00

Methylation in Case

 8.47E-01 (Median) Methylation in Control 7.94E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon8

 Methylation of SLC29A2 in bladder cancer [ 2 ]

Location

 Body (cg18145189)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.08E+00 Statistic Test p-value:9.38E-03; Z-score:2.66E+00

Methylation in Case

 8.38E-01 (Median) Methylation in Control 7.75E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon9

 Methylation of SLC29A2 in bladder cancer [ 2 ]

Location

 3'UTR (cg24151204)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.07E+00 Statistic Test p-value:1.42E-02; Z-score:2.80E+00

Methylation in Case

 7.66E-01 (Median) Methylation in Control 7.18E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

          13 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC29A2 in breast cancer [ 3 ]

Location

 TSS1500 (cg14684675)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.30E+00 Statistic Test p-value:7.43E-06; Z-score:1.21E+00

Methylation in Case

 2.35E-01 (Median) Methylation in Control 1.80E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC29A2 in breast cancer [ 3 ]

Location

 TSS1500 (cg16909570)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.28E+00 Statistic Test p-value:1.58E-05; Z-score:-1.11E+00

Methylation in Case

 5.94E-02 (Median) Methylation in Control 7.59E-02 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC29A2 in breast cancer [ 3 ]

Location

 TSS1500 (cg17415721)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.21E+00 Statistic Test p-value:6.96E-05; Z-score:-7.39E-01

Methylation in Case

 6.43E-02 (Median) Methylation in Control 7.78E-02 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC29A2 in breast cancer [ 3 ]

Location

 TSS200 (cg22725847)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.18E+00 Statistic Test p-value:1.00E-03; Z-score:-5.78E-01

Methylation in Case

 4.63E-02 (Median) Methylation in Control 5.46E-02 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC29A2 in breast cancer [ 3 ]

Location

 Body (cg18145189)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.18E+00 Statistic Test p-value:5.29E-26; Z-score:3.36E+00

Methylation in Case

 7.92E-01 (Median) Methylation in Control 6.72E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC29A2 in breast cancer [ 3 ]

Location

 Body (cg15022049)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.14E+00 Statistic Test p-value:8.31E-20; Z-score:2.56E+00

Methylation in Case

 7.81E-01 (Median) Methylation in Control 6.86E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon7

 Methylation of SLC29A2 in breast cancer [ 3 ]

Location

 Body (cg08181642)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.16E+00 Statistic Test p-value:1.84E-17; Z-score:2.30E+00

Methylation in Case

 6.40E-01 (Median) Methylation in Control 5.51E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon8

 Methylation of SLC29A2 in breast cancer [ 3 ]

Location

 Body (cg19347288)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.13E+00 Statistic Test p-value:7.84E-16; Z-score:2.27E+00

Methylation in Case

 6.73E-01 (Median) Methylation in Control 5.96E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon9

 Methylation of SLC29A2 in breast cancer [ 3 ]

Location

 Body (cg26056527)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.08E+00 Statistic Test p-value:3.80E-12; Z-score:1.78E+00

Methylation in Case

 7.34E-01 (Median) Methylation in Control 6.79E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon10

 Methylation of SLC29A2 in breast cancer [ 3 ]

Location

 Body (cg15128778)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.13E+00 Statistic Test p-value:6.96E-12; Z-score:1.80E+00

Methylation in Case

 6.97E-01 (Median) Methylation in Control 6.16E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon11

 Methylation of SLC29A2 in breast cancer [ 3 ]

Location

 Body (cg22125754)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.06E+00 Statistic Test p-value:3.05E-07; Z-score:1.30E+00

Methylation in Case

 7.84E-01 (Median) Methylation in Control 7.43E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon12

 Methylation of SLC29A2 in breast cancer [ 3 ]

Location

 Body (cg23250019)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.15E+00 Statistic Test p-value:1.26E-04; Z-score:-1.45E+00

Methylation in Case

 5.23E-01 (Median) Methylation in Control 6.03E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon13

 Methylation of SLC29A2 in breast cancer [ 3 ]

Location

 3'UTR (cg24151204)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.14E+00 Statistic Test p-value:2.48E-07; Z-score:1.90E+00

Methylation in Case

 6.33E-01 (Median) Methylation in Control 5.53E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC29A2 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS1500 (cg14684675)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.07E+00 Statistic Test p-value:4.09E-02; Z-score:3.02E-01

Methylation in Case

 1.45E-01 (Median) Methylation in Control 1.35E-01 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC29A2 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS200 (cg17208577)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.02E+00 Statistic Test p-value:3.83E-02; Z-score:1.92E-01

Methylation in Case

 2.92E-02 (Median) Methylation in Control 2.85E-02 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC29A2 in clear cell renal cell carcinoma [ 4 ]

Location

 Body (cg18002602)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.52E+00 Statistic Test p-value:1.11E-05; Z-score:2.21E+00

Methylation in Case

 3.25E-01 (Median) Methylation in Control 2.13E-01 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC29A2 in clear cell renal cell carcinoma [ 4 ]

Location

 Body (cg18145189)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.19E+00 Statistic Test p-value:2.82E-05; Z-score:4.00E+00

Methylation in Case

 9.40E-01 (Median) Methylation in Control 7.89E-01 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC29A2 in clear cell renal cell carcinoma [ 4 ]

Location

 Body (cg10616300)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.46E+00 Statistic Test p-value:1.77E-04; Z-score:1.53E+00

Methylation in Case

 9.64E-02 (Median) Methylation in Control 6.62E-02 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC29A2 in clear cell renal cell carcinoma [ 4 ]

Location

 Body (cg15022049)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.18E+00 Statistic Test p-value:3.68E-03; Z-score:3.25E+00

Methylation in Case

 9.19E-01 (Median) Methylation in Control 7.81E-01 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon7

 Methylation of SLC29A2 in clear cell renal cell carcinoma [ 4 ]

Location

 Body (cg23250019)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.16E+00 Statistic Test p-value:4.04E-03; Z-score:2.66E+00

Methylation in Case

 8.41E-01 (Median) Methylation in Control 7.25E-01 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon8

 Methylation of SLC29A2 in clear cell renal cell carcinoma [ 4 ]

Location

 Body (cg23758765)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.07E+00 Statistic Test p-value:5.00E-03; Z-score:7.19E-01

Methylation in Case

 2.56E-02 (Median) Methylation in Control 2.39E-02 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Colon cancer

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC29A2 in colon adenocarcinoma [ 5 ]

Location

 TSS1500 (cg15930596)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.99E+00 Statistic Test p-value:7.66E-06; Z-score:3.82E+00

Methylation in Case

 4.17E-01 (Median) Methylation in Control 2.10E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC29A2 in colon adenocarcinoma [ 5 ]

Location

 TSS1500 (cg00995520)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.20E+00 Statistic Test p-value:1.44E-05; Z-score:1.52E+00

Methylation in Case

 7.46E-01 (Median) Methylation in Control 6.21E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC29A2 in colon adenocarcinoma [ 5 ]

Location

 TSS200 (cg21636683)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.08E+00 Statistic Test p-value:5.18E-05; Z-score:9.70E-01

Methylation in Case

 7.76E-01 (Median) Methylation in Control 7.21E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC29A2 in colon adenocarcinoma [ 5 ]

Location

 TSS200 (cg20095851)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.16E+00 Statistic Test p-value:6.47E-04; Z-score:-2.18E+00

Methylation in Case

 6.61E-01 (Median) Methylation in Control 7.67E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC29A2 in colon adenocarcinoma [ 5 ]

Location

 TSS200 (cg24707219)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.11E+00 Statistic Test p-value:7.91E-04; Z-score:-1.41E+00

Methylation in Case

 5.35E-01 (Median) Methylation in Control 5.94E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC29A2 in colon adenocarcinoma [ 5 ]

Location

 Body (cg06593603)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.31E+00 Statistic Test p-value:5.99E-04; Z-score:-1.30E+00

Methylation in Case

 4.25E-01 (Median) Methylation in Control 5.56E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC29A2 in colorectal cancer [ 6 ]

Location

 TSS1500 (cg14684675)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.78E+00 Statistic Test p-value:2.43E-14; Z-score:3.60E+00

Methylation in Case

 1.62E-01 (Median) Methylation in Control 9.08E-02 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC29A2 in colorectal cancer [ 6 ]

Location

 TSS1500 (cg01470323)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.34E+00 Statistic Test p-value:1.56E-09; Z-score:2.01E+00

Methylation in Case

 1.89E-01 (Median) Methylation in Control 1.40E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC29A2 in colorectal cancer [ 6 ]

Location

 TSS1500 (cg23375719)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.25E+00 Statistic Test p-value:1.86E-04; Z-score:1.03E+00

Methylation in Case

 1.27E-01 (Median) Methylation in Control 1.02E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC29A2 in colorectal cancer [ 6 ]

Location

 TSS200 (cg17208577)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.15E+00 Statistic Test p-value:3.31E-02; Z-score:-5.19E-01

Methylation in Case

 3.91E-02 (Median) Methylation in Control 4.50E-02 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC29A2 in colorectal cancer [ 6 ]

Location

 Body (cg19347288)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.00E+00 Statistic Test p-value:5.12E-03; Z-score:-8.21E-02

Methylation in Case

 8.88E-01 (Median) Methylation in Control 8.89E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC29A2 in colorectal cancer [ 6 ]

Location

 Body (cg23758765)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.10E+00 Statistic Test p-value:2.28E-02; Z-score:-1.11E-01

Methylation in Case

 2.97E-02 (Median) Methylation in Control 3.26E-02 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon7

 Methylation of SLC29A2 in colorectal cancer [ 6 ]

Location

 Body (cg18002602)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.04E+00 Statistic Test p-value:4.63E-02; Z-score:-2.74E-01

Methylation in Case

 3.54E-01 (Median) Methylation in Control 3.70E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

          14 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC29A2 in hepatocellular carcinoma [ 7 ]

Location

 TSS1500 (cg14684675)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.21E+00 Statistic Test p-value:2.68E-05; Z-score:6.35E-01

Methylation in Case

 1.77E-01 (Median) Methylation in Control 1.46E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC29A2 in hepatocellular carcinoma [ 7 ]

Location

 TSS1500 (cg23375719)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.17E+00 Statistic Test p-value:2.13E-03; Z-score:3.97E-01

Methylation in Case

 1.11E-01 (Median) Methylation in Control 9.47E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC29A2 in hepatocellular carcinoma [ 7 ]

Location

 TSS1500 (cg01470323)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.02E+00 Statistic Test p-value:1.02E-02; Z-score:5.33E-02

Methylation in Case

 1.38E-01 (Median) Methylation in Control 1.36E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC29A2 in hepatocellular carcinoma [ 7 ]

Location

 TSS1500 (cg16909570)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.05E+00 Statistic Test p-value:3.42E-02; Z-score:2.26E-01

Methylation in Case

 6.78E-02 (Median) Methylation in Control 6.47E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC29A2 in hepatocellular carcinoma [ 7 ]

Location

 TSS200 (cg22725847)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.10E+00 Statistic Test p-value:3.68E-04; Z-score:4.07E-01

Methylation in Case

 6.05E-02 (Median) Methylation in Control 5.51E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC29A2 in hepatocellular carcinoma [ 7 ]

Location

 Body (cg04849842)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:2.82E+00 Statistic Test p-value:3.35E-23; Z-score:1.12E+01

Methylation in Case

 5.17E-01 (Median) Methylation in Control 1.83E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon7

 Methylation of SLC29A2 in hepatocellular carcinoma [ 7 ]

Location

 Body (cg08181642)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.25E+00 Statistic Test p-value:2.91E-08; Z-score:-2.69E+00

Methylation in Case

 4.91E-01 (Median) Methylation in Control 6.15E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon8

 Methylation of SLC29A2 in hepatocellular carcinoma [ 7 ]

Location

 Body (cg22125754)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.04E+00 Statistic Test p-value:8.95E-07; Z-score:-1.22E+00

Methylation in Case

 7.77E-01 (Median) Methylation in Control 8.06E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon9

 Methylation of SLC29A2 in hepatocellular carcinoma [ 7 ]

Location

 Body (cg19347288)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.07E+00 Statistic Test p-value:9.65E-07; Z-score:-1.41E+00

Methylation in Case

 6.60E-01 (Median) Methylation in Control 7.08E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon10

 Methylation of SLC29A2 in hepatocellular carcinoma [ 7 ]

Location

 Body (cg15128778)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.07E+00 Statistic Test p-value:6.19E-06; Z-score:-1.10E+00

Methylation in Case

 6.78E-01 (Median) Methylation in Control 7.24E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon11

 Methylation of SLC29A2 in hepatocellular carcinoma [ 7 ]

Location

 Body (cg25423829)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.04E+00 Statistic Test p-value:1.04E-05; Z-score:-1.05E+00

Methylation in Case

 7.78E-01 (Median) Methylation in Control 8.07E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon12

 Methylation of SLC29A2 in hepatocellular carcinoma [ 7 ]

Location

 Body (cg23758765)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.27E+00 Statistic Test p-value:5.70E-04; Z-score:4.99E-01

Methylation in Case

 4.09E-02 (Median) Methylation in Control 3.22E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon13

 Methylation of SLC29A2 in hepatocellular carcinoma [ 7 ]

Location

 Body (cg10616300)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.14E+00 Statistic Test p-value:7.91E-04; Z-score:3.88E-01

Methylation in Case

 1.76E-01 (Median) Methylation in Control 1.55E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon14

 Methylation of SLC29A2 in hepatocellular carcinoma [ 7 ]

Location

 Body (cg18002602)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.09E+00 Statistic Test p-value:1.63E-02; Z-score:6.14E-01

Methylation in Case

 3.07E-01 (Median) Methylation in Control 2.82E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  HIV infection

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC29A2 in HIV infection [ 8 ]

Location

 TSS1500 (cg14684675)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.03E+00 Statistic Test p-value:4.72E-02; Z-score:2.12E-01

Methylation in Case

 3.03E-01 (Median) Methylation in Control 2.94E-01 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC29A2 in HIV infection [ 8 ]

Location

 Body (cg25423829)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.04E+00 Statistic Test p-value:8.98E-04; Z-score:-1.31E+00

Methylation in Case

 8.39E-01 (Median) Methylation in Control 8.69E-01 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC29A2 in HIV infection [ 8 ]

Location

 Body (cg10616300)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.25E+00 Statistic Test p-value:1.48E-03; Z-score:9.71E-01

Methylation in Case

 1.71E-01 (Median) Methylation in Control 1.37E-01 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC29A2 in HIV infection [ 8 ]

Location

 Body (cg26056527)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.02E+00 Statistic Test p-value:1.11E-02; Z-score:6.76E-01

Methylation in Case

 8.20E-01 (Median) Methylation in Control 8.06E-01 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC29A2 in pancretic ductal adenocarcinoma [ 9 ]

Location

 TSS1500 (cg16839921)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.18E+00 Statistic Test p-value:3.44E-07; Z-score:-1.27E+00

Methylation in Case

 5.40E-01 (Median) Methylation in Control 6.39E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC29A2 in pancretic ductal adenocarcinoma [ 9 ]

Location

 TSS1500 (cg08242574)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.16E+00 Statistic Test p-value:1.04E-06; Z-score:6.56E-01

Methylation in Case

 9.42E-02 (Median) Methylation in Control 8.13E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC29A2 in pancretic ductal adenocarcinoma [ 9 ]

Location

 TSS200 (cg09774787)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:5.66E+00 Statistic Test p-value:1.06E-17; Z-score:3.36E+00

Methylation in Case

 4.06E-01 (Median) Methylation in Control 7.17E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC29A2 in pancretic ductal adenocarcinoma [ 9 ]

Location

 TSS200 (cg10338338)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.85E+00 Statistic Test p-value:8.43E-09; Z-score:-1.65E+00

Methylation in Case

 1.93E-01 (Median) Methylation in Control 3.56E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC29A2 in pancretic ductal adenocarcinoma [ 9 ]

Location

 TSS200 (cg18500192)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.16E+00 Statistic Test p-value:6.14E-05; Z-score:-8.90E-01

Methylation in Case

 1.01E-01 (Median) Methylation in Control 1.17E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC29A2 in pancretic ductal adenocarcinoma [ 9 ]

Location

 Body (cg02672229)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.19E+00 Statistic Test p-value:8.35E-20; Z-score:-2.93E+00

Methylation in Case

 7.06E-01 (Median) Methylation in Control 8.42E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon7

 Methylation of SLC29A2 in pancretic ductal adenocarcinoma [ 9 ]

Location

 Body (cg20662988)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.53E+00 Statistic Test p-value:7.40E-10; Z-score:1.33E+00

Methylation in Case

 2.06E-01 (Median) Methylation in Control 1.34E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            9 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC29A2 in papillary thyroid cancer [ 10 ]

Location

 TSS1500 (cg23375719)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.12E+00 Statistic Test p-value:3.67E-04; Z-score:-9.64E-01

Methylation in Case

 1.39E-01 (Median) Methylation in Control 1.56E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC29A2 in papillary thyroid cancer [ 10 ]

Location

 TSS1500 (cg01470323)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.10E+00 Statistic Test p-value:5.05E-03; Z-score:-8.36E-01

Methylation in Case

 1.89E-01 (Median) Methylation in Control 2.08E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC29A2 in papillary thyroid cancer [ 10 ]

Location

 TSS1500 (cg14684675)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.03E+00 Statistic Test p-value:2.92E-02; Z-score:3.19E-01

Methylation in Case

 2.45E-01 (Median) Methylation in Control 2.38E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC29A2 in papillary thyroid cancer [ 10 ]

Location

 TSS200 (cg17208577)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.08E+00 Statistic Test p-value:8.58E-03; Z-score:-7.33E-01

Methylation in Case

 7.17E-02 (Median) Methylation in Control 7.71E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC29A2 in papillary thyroid cancer [ 10 ]

Location

 Body (cg25423829)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.03E+00 Statistic Test p-value:6.95E-09; Z-score:-1.54E+00

Methylation in Case

 8.85E-01 (Median) Methylation in Control 9.11E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC29A2 in papillary thyroid cancer [ 10 ]

Location

 Body (cg18002602)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.11E+00 Statistic Test p-value:4.95E-04; Z-score:5.76E-01

Methylation in Case

 2.20E-01 (Median) Methylation in Control 1.99E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon7

 Methylation of SLC29A2 in papillary thyroid cancer [ 10 ]

Location

 Body (cg22125754)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.02E+00 Statistic Test p-value:9.25E-03; Z-score:-7.39E-01

Methylation in Case

 8.72E-01 (Median) Methylation in Control 8.87E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon8

 Methylation of SLC29A2 in papillary thyroid cancer [ 10 ]

Location

 Body (cg19347288)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.02E+00 Statistic Test p-value:4.25E-02; Z-score:-6.53E-01

Methylation in Case

 8.09E-01 (Median) Methylation in Control 8.28E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon9

 Methylation of SLC29A2 in papillary thyroid cancer [ 10 ]

Location

 3'UTR (cg24151204)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.09E+00 Statistic Test p-value:4.32E-02; Z-score:-7.55E-01

Methylation in Case

 4.05E-01 (Median) Methylation in Control 4.41E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Atypical teratoid rhabdoid tumor

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC29A2 in atypical teratoid rhabdoid tumor [ 11 ]

Location

 Body (cg08181642)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.35E+00 Statistic Test p-value:5.53E-03; Z-score:-6.93E-01

Methylation in Case

 1.45E-01 (Median) Methylation in Control 1.96E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC29A2 in atypical teratoid rhabdoid tumor [ 11 ]

Location

 Body (cg10616300)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.01E+00 Statistic Test p-value:1.65E-02; Z-score:-4.66E-01

Methylation in Case

 9.70E-01 (Median) Methylation in Control 9.76E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC29A2 in atypical teratoid rhabdoid tumor [ 11 ]

Location

 3'UTR (cg24151204)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.48E+00 Statistic Test p-value:1.23E-09; Z-score:-1.51E+00

Methylation in Case

 3.96E-01 (Median) Methylation in Control 5.85E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  Panic disorder

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC29A2 in panic disorder [ 12 ]

Location

 Body (cg25423829)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.11E+00 Statistic Test p-value:2.26E-02; Z-score:4.99E-01

Methylation in Case

 2.62E+00 (Median) Methylation in Control 2.35E+00 (Median)

Studied Phenotype

 Panic disorder[ ICD-11:6B01]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC29A2 in systemic lupus erythematosus [ 13 ]

Location

 Body (cg18002602)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.05E+00 Statistic Test p-value:4.85E-04; Z-score:-2.95E-01

Methylation in Case

 3.93E-01 (Median) Methylation in Control 4.14E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC29A2 in systemic lupus erythematosus [ 13 ]

Location

 Body (cg23250019)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.02E+00 Statistic Test p-value:9.85E-04; Z-score:-4.05E-01

Methylation in Case

 8.37E-01 (Median) Methylation in Control 8.50E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC29A2 in lung adenocarcinoma [ 14 ]

Location

 3'UTR (cg24151204)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.14E+00 Statistic Test p-value:1.46E-03; Z-score:4.00E+00

Methylation in Case

 6.93E-01 (Median) Methylation in Control 6.08E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

          34 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 miR-1251 directly targets SLC29A2 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1251 miRNA Mature ID miR-1251-3p

miRNA Sequence

 CGCUUUGCUCAGCCAGUGUAG

miRNA Target Type

 Direct

Experimental Material

 Human breast adenocarcinoma cell line (MCF-7)

  Epigenetic Phenomenon2

 miR-1321 directly targets SLC29A2 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1321 miRNA Mature ID miR-1321

miRNA Sequence

 CAGGGAGGUGAAUGUGAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon3

 miR-185 directly targets SLC29A2 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-185 miRNA Mature ID miR-185-5p

miRNA Sequence

 UGGAGAGAAAGGCAGUUCCUGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon4

 miR-2467 directly targets SLC29A2 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-2467 miRNA Mature ID miR-2467-3p

miRNA Sequence

 AGCAGAGGCAGAGAGGCUCAGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon5

 miR-29a directly targets SLC29A2 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-29a miRNA Mature ID miR-29a-3p

miRNA Sequence

 UAGCACCAUCUGAAAUCGGUUA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon6

 miR-29b directly targets SLC29A2 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-29b miRNA Mature ID miR-29b-3p

miRNA Sequence

 UAGCACCAUUUGAAAUCAGUGUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon7

 miR-29c directly targets SLC29A2 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-29c miRNA Mature ID miR-29c-3p

miRNA Sequence

 UAGCACCAUUUGAAAUCGGUUA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon8

 miR-3065 directly targets SLC29A2 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3065 miRNA Mature ID miR-3065-3p

miRNA Sequence

 UCAGCACCAGGAUAUUGUUGGAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon9

 miR-3150b directly targets SLC29A2 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3150b miRNA Mature ID miR-3150b-3p

miRNA Sequence

 UGAGGAGAUCGUCGAGGUUGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon10

 miR-3688 directly targets SLC29A2 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3688 miRNA Mature ID miR-3688-3p

miRNA Sequence

 UAUGGAAAGACUUUGCCACUCU

miRNA Target Type

 Direct

Experimental Material

 Human breast adenocarcinoma cell line (MCF-7)

  Epigenetic Phenomenon11

 miR-4270 directly targets SLC29A2 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4270 miRNA Mature ID miR-4270

miRNA Sequence

 UCAGGGAGUCAGGGGAGGGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon12

 miR-4281 directly targets SLC29A2 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4281 miRNA Mature ID miR-4281

miRNA Sequence

 GGGUCCCGGGGAGGGGGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon13

 miR-4306 directly targets SLC29A2 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4306 miRNA Mature ID miR-4306

miRNA Sequence

 UGGAGAGAAAGGCAGUA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon14

 miR-4441 directly targets SLC29A2 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4441 miRNA Mature ID miR-4441

miRNA Sequence

 ACAGGGAGGAGAUUGUA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon15

 miR-4449 directly targets SLC29A2 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4449 miRNA Mature ID miR-4449

miRNA Sequence

 CGUCCCGGGGCUGCGCGAGGCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon16

 miR-4450 directly targets SLC29A2 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4450 miRNA Mature ID miR-4450

miRNA Sequence

 UGGGGAUUUGGAGAAGUGGUGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon17

 miR-4481 directly targets SLC29A2 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4481 miRNA Mature ID miR-4481

miRNA Sequence

 GGAGUGGGCUGGUGGUU

miRNA Target Type

 Direct

Experimental Material

 Human breast adenocarcinoma cell line (MCF-7)

  Epigenetic Phenomenon18

 miR-4644 directly targets SLC29A2 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4644 miRNA Mature ID miR-4644

miRNA Sequence

 UGGAGAGAGAAAAGAGACAGAAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon19

 miR-4693 directly targets SLC29A2 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4693 miRNA Mature ID miR-4693-3p

miRNA Sequence

 UGAGAGUGGAAUUCACAGUAUUU

miRNA Target Type

 Direct

Experimental Material

 Human breast adenocarcinoma cell line (MCF-7)

  Epigenetic Phenomenon20

 miR-4739 directly targets SLC29A2 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4739 miRNA Mature ID miR-4739

miRNA Sequence

 AAGGGAGGAGGAGCGGAGGGGCCCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon21

 miR-4745 directly targets SLC29A2 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4745 miRNA Mature ID miR-4745-5p

miRNA Sequence

 UGAGUGGGGCUCCCGGGACGGCG

miRNA Target Type

 Direct

Experimental Material

 Human breast adenocarcinoma cell line (MCF-7)

  Epigenetic Phenomenon22

 miR-4756 directly targets SLC29A2 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4756 miRNA Mature ID miR-4756-5p

miRNA Sequence

 CAGGGAGGCGCUCACUCUCUGCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon23

 miR-4773 directly targets SLC29A2 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4773 miRNA Mature ID miR-4773

miRNA Sequence

 CAGAACAGGAGCAUAGAAAGGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon24

 miR-4784 directly targets SLC29A2 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4784 miRNA Mature ID miR-4784

miRNA Sequence

 UGAGGAGAUGCUGGGACUGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon25

 miR-503 directly targets SLC29A2 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-503 miRNA Mature ID miR-503-3p

miRNA Sequence

 GGGGUAUUGUUUCCGCUGCCAGG

miRNA Target Type

 Direct

Experimental Material

 Human breast adenocarcinoma cell line (MCF-7)

  Epigenetic Phenomenon26

 miR-6077 directly targets SLC29A2 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6077 miRNA Mature ID miR-6077

miRNA Sequence

 GGGAAGAGCUGUACGGCCUUC

miRNA Target Type

 Direct

Experimental Material

 Human breast adenocarcinoma cell line (MCF-7)

  Epigenetic Phenomenon27

 miR-6754 directly targets SLC29A2 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6754 miRNA Mature ID miR-6754-5p

miRNA Sequence

 CCAGGGAGGCUGGUUUGGAGGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon28

 miR-6758 directly targets SLC29A2 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6758 miRNA Mature ID miR-6758-5p

miRNA Sequence

 UAGAGAGGGGAAGGAUGUGAUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon29

 miR-6856 directly targets SLC29A2 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6856 miRNA Mature ID miR-6856-5p

miRNA Sequence

 AAGAGAGGAGCAGUGGUGCUGUGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon30

 miR-6857 directly targets SLC29A2 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6857 miRNA Mature ID miR-6857-5p

miRNA Sequence

 UUGGGGAUUGGGUCAGGCCAGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon31

 miR-7 directly targets SLC29A2 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-7 miRNA Mature ID miR-7-5p

miRNA Sequence

 UGGAAGACUAGUGAUUUUGUUGUU

miRNA Target Type

 Direct

Experimental Material

 Human breast adenocarcinoma cell line (MCF-7)

  Epigenetic Phenomenon32

 miR-7106 directly targets SLC29A2 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-7106 miRNA Mature ID miR-7106-5p

miRNA Sequence

 UGGGAGGAGGGGAUCUUGGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon33

 miR-765 directly targets SLC29A2 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-765 miRNA Mature ID miR-765

miRNA Sequence

 UGGAGGAGAAGGAAGGUGAUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon34

 miR-93 directly targets SLC29A2 [ 18 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-93 miRNA Mature ID miR-93-5p

miRNA Sequence

 CAAAGUGCUGUUCGUGCAGGUAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)
References
1 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
2 DNA Methylation Dynamics in Urological Tumors.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
5 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
6 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
7 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
8 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
9 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
10 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
11 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
12 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
13 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
14 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
15 Identification of distinct miRNA target regulation between breast cancer molecular subtypes using AGO2-PAR-CLIP and patient datasets. Genome Biol. 2014 Jan 7;15(1):R9.
16 In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio. 2013 Apr 16;4(2):e000193.
17 The viral and cellular microRNA targetome in lymphoblastoid cell lines. PLoS Pathog. 2012 Jan;8(1):e1002484.
18 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.