General Information of Drug Transporter (DT)
DT ID DTD0243 Transporter Info
Gene Name SLC27A6
Transporter Name Long-chain fatty acid transport protein 6
Gene ID
28965
UniProt ID
Q9Y2P4
Epigenetic Regulations of This DT (EGR)

microRNA

  Unclear Phenotype

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-26b directly targets SLC27A6 [ 1 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-26b miRNA Mature ID miR-26b-5p

miRNA Sequence

UUCAAGUAAUUCAGGAUAGGU

miRNA Target Type

Direct

Experimental Material

Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon2

miR-335 directly targets SLC27A6 [ 2 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-335 miRNA Mature ID miR-335-5p

miRNA Sequence

UCAAGAGCAAUAACGAAAAAUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

Methylation

  Liver cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant/significant hypermethylation of SLC27A6 in liver cancer than that in healthy individual/adjacent tissue

Studied Phenotype

Liver cancer [ICD-11:2C12]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:2.26E-13; Fold-change:-0.394707107; Z-score:-2.536377568

The Methylation Level of Disease Section Compare with the Adjacent Tissue

p-value:1.01E-24; Fold-change:-0.436488744; Z-score:-14.20182148
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
DT methylation level in tissue other than the diseased tissue of patients
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Mixed neuronal-glial tumour

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypermethylation of SLC27A6 in mixed neuronal-glial tumour than that in healthy individual

Studied Phenotype

Mixed neuronal-glial tumour [ICD-11:2A00.21]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:3.24E-09; Fold-change:0.29603911; Z-score:1.226066688
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Brain neuroepithelial tumour

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of SLC27A6 in brain neuroepithelial tumour than that in healthy individual

Studied Phenotype

Brain neuroepithelial tumour [ICD-11:2A00.2Y]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:5.65E-05; Fold-change:-0.244506055; Z-score:-0.997770271
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Atypical teratoid rhabdoid tumour

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypermethylation of SLC27A6 in atypical teratoid rhabdoid tumour than that in healthy individual

Studied Phenotype

Atypical teratoid rhabdoid tumour [ICD-11:2A00.1Y]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:2.21E-10; Fold-change:0.36054853; Z-score:1.414919953
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Peripheral neuroectodermal tumour

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypermethylation of SLC27A6 in peripheral neuroectodermal tumour than that in healthy individual

Studied Phenotype

Peripheral neuroectodermal tumour [ICD-11:2B52]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:9.18E-08; Fold-change:0.343369271; Z-score:1.336622912
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Pituitary adenoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypermethylation of SLC27A6 in pituitary adenoma than that in healthy individual

Studied Phenotype

Pituitary adenoma [ICD-11:2F37]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:1.26E-07; Fold-change:0.436475524; Z-score:4.888269634
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  RELA YAP fusion ependymoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypermethylation of SLC27A6 in rela yap fusion ependymoma than that in healthy individual

Studied Phenotype

RELA YAP fusion ependymoma [ICD-11:2A00.0Y]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:1.39E-17; Fold-change:0.346172442; Z-score:1.454370666
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Craniopharyngioma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of SLC27A6 in craniopharyngioma than that in healthy individual

Studied Phenotype

Craniopharyngioma [ICD-11:2F9A]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:3.90E-23; Fold-change:-0.474010084; Z-score:-6.812711467
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Myxopapillary ependymoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of SLC27A6 in myxopapillary ependymoma than that in healthy individual

Studied Phenotype

Myxopapillary ependymoma [ICD-11:2A00.5]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:4.06E-11; Fold-change:-0.353454152; Z-score:-1.434977636
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Vestibular melanotic schwannoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of SLC27A6 in vestibular melanotic schwannoma than that in healthy individual

Studied Phenotype

Vestibular melanotic schwannoma [ICD-11:2A02.3]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:0.012067933; Fold-change:-0.326230165; Z-score:-2.458048585
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
References
1 MicroRNA target prediction by expression analysis of host genes. Genome Res. 2009 Mar;19(3):481-90.
2 Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.