Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0238 Transporter Info | ||||
| Gene Name | SLC27A1 | ||||
| Transporter Name | Fatty acid transport protein 1 | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
Methylation |
|||||
|
Colon cancer |
7 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC27A1 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
5'UTR (cg19407886) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.14E+00 | Statistic Test | p-value:3.98E-04; Z-score:-8.48E-01 | ||
|
Methylation in Case |
3.05E-01 (Median) | Methylation in Control | 3.48E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC27A1 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
5'UTR (cg07007420) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:1.10E-03; Z-score:-1.72E+00 | ||
|
Methylation in Case |
8.43E-01 (Median) | Methylation in Control | 8.81E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC27A1 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
5'UTR (cg26452584) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.12E+00 | Statistic Test | p-value:1.14E-03; Z-score:-1.41E+00 | ||
|
Methylation in Case |
6.45E-01 (Median) | Methylation in Control | 7.22E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC27A1 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg13250776) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.70E+00 | Statistic Test | p-value:1.02E-07; Z-score:3.65E+00 | ||
|
Methylation in Case |
5.25E-01 (Median) | Methylation in Control | 3.09E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC27A1 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg06178383) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.49E+00 | Statistic Test | p-value:1.24E-04; Z-score:-3.10E+00 | ||
|
Methylation in Case |
4.05E-01 (Median) | Methylation in Control | 6.04E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC27A1 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg04958882) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.14E+00 | Statistic Test | p-value:3.00E-04; Z-score:-3.81E+00 | ||
|
Methylation in Case |
7.16E-01 (Median) | Methylation in Control | 8.14E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC27A1 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg23626131) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.23E+00 | Statistic Test | p-value:9.28E-04; Z-score:-1.99E+00 | ||
|
Methylation in Case |
6.09E-01 (Median) | Methylation in Control | 7.49E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Pancretic ductal adenocarcinoma |
12 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC27A1 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
5'UTR (cg27507700) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:3.36E+00 | Statistic Test | p-value:2.14E-28; Z-score:1.11E+01 | ||
|
Methylation in Case |
1.96E-01 (Median) | Methylation in Control | 5.83E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC27A1 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg15487620) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.19E+00 | Statistic Test | p-value:1.04E-04; Z-score:-1.19E+00 | ||
|
Methylation in Case |
5.34E-01 (Median) | Methylation in Control | 6.34E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC27A1 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
TSS200 (cg12080391) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:4.19E+00 | Statistic Test | p-value:4.00E-45; Z-score:1.09E+01 | ||
|
Methylation in Case |
2.61E-01 (Median) | Methylation in Control | 6.24E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC27A1 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
TSS200 (cg16843423) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.93E+00 | Statistic Test | p-value:6.75E-31; Z-score:8.01E+00 | ||
|
Methylation in Case |
1.62E-01 (Median) | Methylation in Control | 5.54E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC27A1 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
TSS200 (cg16829998) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.66E+00 | Statistic Test | p-value:2.32E-05; Z-score:-1.59E+00 | ||
|
Methylation in Case |
1.77E-01 (Median) | Methylation in Control | 2.93E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC27A1 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
TSS200 (cg20490199) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.26E+00 | Statistic Test | p-value:4.34E-04; Z-score:-1.21E+00 | ||
|
Methylation in Case |
4.47E-02 (Median) | Methylation in Control | 5.65E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC27A1 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
Body (cg06043886) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:2.97E-06; Z-score:-5.66E-01 | ||
|
Methylation in Case |
8.33E-01 (Median) | Methylation in Control | 8.43E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC27A1 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
Body (cg05062560) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.04E+00 | Statistic Test | p-value:2.13E-03; Z-score:1.28E+00 | ||
|
Methylation in Case |
8.44E-01 (Median) | Methylation in Control | 8.11E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC27A1 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
Body (cg11637059) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:5.42E-03; Z-score:4.28E-01 | ||
|
Methylation in Case |
8.56E-01 (Median) | Methylation in Control | 8.33E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC27A1 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
Body (cg20930201) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:1.33E-02; Z-score:-3.04E-01 | ||
|
Methylation in Case |
2.02E-01 (Median) | Methylation in Control | 2.14E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC27A1 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
Body (cg09892121) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.10E+00 | Statistic Test | p-value:1.53E-02; Z-score:8.03E-01 | ||
|
Methylation in Case |
6.08E-01 (Median) | Methylation in Control | 5.52E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC27A1 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
Body (cg23337754) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.18E+00 | Statistic Test | p-value:3.46E-02; Z-score:-3.91E-01 | ||
|
Methylation in Case |
7.71E-02 (Median) | Methylation in Control | 9.09E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Bladder cancer |
13 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC27A1 in bladder cancer | [ 3 ] | |||
|
Location |
TSS1500 (cg22333846) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.24E+00 | Statistic Test | p-value:1.40E-02; Z-score:-3.29E+00 | ||
|
Methylation in Case |
6.56E-02 (Median) | Methylation in Control | 8.15E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC27A1 in bladder cancer | [ 3 ] | |||
|
Location |
TSS200 (cg21607669) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.43E+00 | Statistic Test | p-value:1.30E-02; Z-score:2.04E+00 | ||
|
Methylation in Case |
2.43E-02 (Median) | Methylation in Control | 1.71E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC27A1 in bladder cancer | [ 3 ] | |||
|
Location |
Body (cg16614288) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.40E+00 | Statistic Test | p-value:3.86E-08; Z-score:1.62E+01 | ||
|
Methylation in Case |
8.05E-01 (Median) | Methylation in Control | 5.73E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC27A1 in bladder cancer | [ 3 ] | |||
|
Location |
Body (cg15507500) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.34E+00 | Statistic Test | p-value:5.33E-07; Z-score:-2.54E+01 | ||
|
Methylation in Case |
6.89E-01 (Median) | Methylation in Control | 9.22E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC27A1 in bladder cancer | [ 3 ] | |||
|
Location |
Body (cg08220872) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.25E+00 | Statistic Test | p-value:8.94E-06; Z-score:5.37E+00 | ||
|
Methylation in Case |
7.90E-01 (Median) | Methylation in Control | 6.31E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC27A1 in bladder cancer | [ 3 ] | |||
|
Location |
Body (cg02707854) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-3.08E+00 | Statistic Test | p-value:3.28E-05; Z-score:-4.45E+00 | ||
|
Methylation in Case |
1.90E-01 (Median) | Methylation in Control | 5.86E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC27A1 in bladder cancer | [ 3 ] | |||
|
Location |
Body (cg25517015) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.13E+00 | Statistic Test | p-value:3.45E-05; Z-score:-4.63E+00 | ||
|
Methylation in Case |
7.35E-01 (Median) | Methylation in Control | 8.31E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC27A1 in bladder cancer | [ 3 ] | |||
|
Location |
Body (cg03233444) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.80E+00 | Statistic Test | p-value:3.90E-05; Z-score:4.71E+00 | ||
|
Methylation in Case |
1.55E-01 (Median) | Methylation in Control | 8.65E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC27A1 in bladder cancer | [ 3 ] | |||
|
Location |
Body (cg17132030) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-2.16E+00 | Statistic Test | p-value:1.56E-03; Z-score:-2.91E+00 | ||
|
Methylation in Case |
1.88E-01 (Median) | Methylation in Control | 4.05E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC27A1 in bladder cancer | [ 3 ] | |||
|
Location |
Body (cg02002247) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.22E+00 | Statistic Test | p-value:1.81E-03; Z-score:-6.12E+00 | ||
|
Methylation in Case |
6.16E-01 (Median) | Methylation in Control | 7.53E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC27A1 in bladder cancer | [ 3 ] | |||
|
Location |
Body (cg18499060) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:3.27E-02; Z-score:-1.01E+00 | ||
|
Methylation in Case |
8.63E-01 (Median) | Methylation in Control | 8.75E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC27A1 in bladder cancer | [ 3 ] | |||
|
Location |
Body (cg09325679) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:4.73E-02; Z-score:9.49E-01 | ||
|
Methylation in Case |
9.75E-01 (Median) | Methylation in Control | 9.63E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC27A1 in bladder cancer | [ 3 ] | |||
|
Location |
3'UTR (cg09479512) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.18E+00 | Statistic Test | p-value:3.11E-05; Z-score:-5.66E+00 | ||
|
Methylation in Case |
6.80E-01 (Median) | Methylation in Control | 8.00E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Breast cancer |
14 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC27A1 in breast cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg27554237) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.40E+00 | Statistic Test | p-value:1.97E-04; Z-score:7.55E-01 | ||
|
Methylation in Case |
3.15E-02 (Median) | Methylation in Control | 2.25E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC27A1 in breast cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg22333846) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.32E+00 | Statistic Test | p-value:6.02E-04; Z-score:6.68E-01 | ||
|
Methylation in Case |
8.64E-02 (Median) | Methylation in Control | 6.56E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC27A1 in breast cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg15424054) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.12E+00 | Statistic Test | p-value:3.18E-02; Z-score:4.60E-01 | ||
|
Methylation in Case |
7.83E-02 (Median) | Methylation in Control | 7.01E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC27A1 in breast cancer | [ 4 ] | |||
|
Location |
TSS200 (cg14549755) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.31E+00 | Statistic Test | p-value:1.81E-02; Z-score:3.87E-01 | ||
|
Methylation in Case |
2.35E-02 (Median) | Methylation in Control | 1.79E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC27A1 in breast cancer | [ 4 ] | |||
|
Location |
TSS200 (cg21607669) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.25E+00 | Statistic Test | p-value:3.60E-02; Z-score:2.44E-01 | ||
|
Methylation in Case |
3.01E-02 (Median) | Methylation in Control | 2.40E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC27A1 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg08244301) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.47E+00 | Statistic Test | p-value:4.80E-16; Z-score:3.34E+00 | ||
|
Methylation in Case |
5.75E-01 (Median) | Methylation in Control | 3.91E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC27A1 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg08220872) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.23E+00 | Statistic Test | p-value:3.45E-14; Z-score:1.82E+00 | ||
|
Methylation in Case |
7.56E-01 (Median) | Methylation in Control | 6.16E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC27A1 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg03233444) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.55E+00 | Statistic Test | p-value:1.47E-08; Z-score:1.82E+00 | ||
|
Methylation in Case |
1.25E-01 (Median) | Methylation in Control | 8.05E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC27A1 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg16664617) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.25E+00 | Statistic Test | p-value:6.15E-08; Z-score:2.59E+00 | ||
|
Methylation in Case |
5.83E-01 (Median) | Methylation in Control | 4.68E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC27A1 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg16614288) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.07E+00 | Statistic Test | p-value:1.01E-07; Z-score:1.20E+00 | ||
|
Methylation in Case |
8.04E-01 (Median) | Methylation in Control | 7.54E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC27A1 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg15507500) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:1.43E-03; Z-score:-5.05E-01 | ||
|
Methylation in Case |
8.70E-01 (Median) | Methylation in Control | 8.91E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC27A1 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg02002247) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.12E+00 | Statistic Test | p-value:3.22E-03; Z-score:1.37E+00 | ||
|
Methylation in Case |
7.71E-01 (Median) | Methylation in Control | 6.91E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC27A1 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg10692922) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.07E+00 | Statistic Test | p-value:1.04E-02; Z-score:-1.04E+00 | ||
|
Methylation in Case |
7.95E-01 (Median) | Methylation in Control | 8.48E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of SLC27A1 in breast cancer | [ 4 ] | |||
|
Location |
3'UTR (cg09479512) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.16E+00 | Statistic Test | p-value:8.82E-08; Z-score:9.48E-01 | ||
|
Methylation in Case |
8.25E-01 (Median) | Methylation in Control | 7.11E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Renal cell carcinoma |
8 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC27A1 in clear cell renal cell carcinoma | [ 5 ] | |||
|
Location |
TSS1500 (cg22333846) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.81E+00 | Statistic Test | p-value:5.62E-04; Z-score:1.85E+00 | ||
|
Methylation in Case |
6.68E-02 (Median) | Methylation in Control | 3.69E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC27A1 in clear cell renal cell carcinoma | [ 5 ] | |||
|
Location |
1stExon (cg02576503) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.09E+00 | Statistic Test | p-value:4.38E-02; Z-score:4.75E-01 | ||
|
Methylation in Case |
2.10E-02 (Median) | Methylation in Control | 1.93E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC27A1 in clear cell renal cell carcinoma | [ 5 ] | |||
|
Location |
Body (cg16614288) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.32E+00 | Statistic Test | p-value:3.34E-09; Z-score:3.95E+00 | ||
|
Methylation in Case |
8.73E-01 (Median) | Methylation in Control | 6.63E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC27A1 in clear cell renal cell carcinoma | [ 5 ] | |||
|
Location |
Body (cg08244301) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:1.65E-03; Z-score:-8.66E-01 | ||
|
Methylation in Case |
7.46E-01 (Median) | Methylation in Control | 7.91E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC27A1 in clear cell renal cell carcinoma | [ 5 ] | |||
|
Location |
Body (cg15471825) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:2.30E-03; Z-score:-4.74E-01 | ||
|
Methylation in Case |
9.84E-01 (Median) | Methylation in Control | 9.84E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC27A1 in clear cell renal cell carcinoma | [ 5 ] | |||
|
Location |
Body (cg16664617) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:5.81E-03; Z-score:-7.22E-01 | ||
|
Methylation in Case |
8.53E-01 (Median) | Methylation in Control | 8.68E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC27A1 in clear cell renal cell carcinoma | [ 5 ] | |||
|
Location |
Body (cg03233444) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.14E+00 | Statistic Test | p-value:7.06E-03; Z-score:2.13E-01 | ||
|
Methylation in Case |
5.67E-02 (Median) | Methylation in Control | 4.97E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC27A1 in clear cell renal cell carcinoma | [ 5 ] | |||
|
Location |
Body (cg21160774) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:7.47E-03; Z-score:8.31E-01 | ||
|
Methylation in Case |
9.64E-01 (Median) | Methylation in Control | 9.56E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colorectal cancer |
14 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC27A1 in colorectal cancer | [ 6 ] | |||
|
Location |
TSS1500 (cg22333846) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.07E+00 | Statistic Test | p-value:2.01E-02; Z-score:-4.90E-01 | ||
|
Methylation in Case |
1.30E-01 (Median) | Methylation in Control | 1.40E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC27A1 in colorectal cancer | [ 6 ] | |||
|
Location |
TSS200 (cg26281559) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.27E+00 | Statistic Test | p-value:9.05E-07; Z-score:1.45E+00 | ||
|
Methylation in Case |
9.43E-02 (Median) | Methylation in Control | 7.42E-02 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC27A1 in colorectal cancer | [ 6 ] | |||
|
Location |
Body (cg02002247) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.07E+00 | Statistic Test | p-value:7.04E-09; Z-score:-2.09E+00 | ||
|
Methylation in Case |
8.37E-01 (Median) | Methylation in Control | 8.93E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC27A1 in colorectal cancer | [ 6 ] | |||
|
Location |
Body (cg16614288) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.17E+00 | Statistic Test | p-value:2.88E-06; Z-score:1.92E+00 | ||
|
Methylation in Case |
8.78E-01 (Median) | Methylation in Control | 7.54E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC27A1 in colorectal cancer | [ 6 ] | |||
|
Location |
Body (cg25517015) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.13E+00 | Statistic Test | p-value:3.03E-05; Z-score:-1.18E+00 | ||
|
Methylation in Case |
8.15E-01 (Median) | Methylation in Control | 9.18E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC27A1 in colorectal cancer | [ 6 ] | |||
|
Location |
Body (cg03233444) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.07E+00 | Statistic Test | p-value:3.11E-05; Z-score:4.24E-01 | ||
|
Methylation in Case |
2.41E-01 (Median) | Methylation in Control | 2.26E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC27A1 in colorectal cancer | [ 6 ] | |||
|
Location |
Body (cg06012269) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.19E+00 | Statistic Test | p-value:1.51E-04; Z-score:1.45E+00 | ||
|
Methylation in Case |
8.96E-01 (Median) | Methylation in Control | 7.55E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC27A1 in colorectal cancer | [ 6 ] | |||
|
Location |
Body (cg03042281) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.14E+00 | Statistic Test | p-value:1.82E-04; Z-score:1.45E+00 | ||
|
Methylation in Case |
9.11E-01 (Median) | Methylation in Control | 8.02E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC27A1 in colorectal cancer | [ 6 ] | |||
|
Location |
Body (cg16664617) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:1.55E-03; Z-score:-4.80E-01 | ||
|
Methylation in Case |
7.20E-01 (Median) | Methylation in Control | 7.36E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC27A1 in colorectal cancer | [ 6 ] | |||
|
Location |
Body (cg08244301) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:2.43E-03; Z-score:-6.22E-01 | ||
|
Methylation in Case |
8.11E-01 (Median) | Methylation in Control | 8.39E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC27A1 in colorectal cancer | [ 6 ] | |||
|
Location |
Body (cg18499060) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.00E+00 | Statistic Test | p-value:2.20E-02; Z-score:2.13E-01 | ||
|
Methylation in Case |
9.59E-01 (Median) | Methylation in Control | 9.57E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC27A1 in colorectal cancer | [ 6 ] | |||
|
Location |
Body (cg09325679) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:2.64E-02; Z-score:5.89E-01 | ||
|
Methylation in Case |
9.61E-01 (Median) | Methylation in Control | 9.53E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC27A1 in colorectal cancer | [ 6 ] | |||
|
Location |
Body (cg08220872) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:4.06E-02; Z-score:3.99E-01 | ||
|
Methylation in Case |
8.81E-01 (Median) | Methylation in Control | 8.58E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Hepatocellular carcinoma |
15 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC27A1 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg16417876) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.34E+00 | Statistic Test | p-value:7.01E-11; Z-score:-5.17E+00 | ||
|
Methylation in Case |
6.27E-01 (Median) | Methylation in Control | 8.42E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC27A1 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg15424054) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.38E+00 | Statistic Test | p-value:5.29E-08; Z-score:1.58E+00 | ||
|
Methylation in Case |
9.76E-02 (Median) | Methylation in Control | 7.06E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC27A1 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg21762534) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.09E+00 | Statistic Test | p-value:1.74E-02; Z-score:2.54E-01 | ||
|
Methylation in Case |
7.34E-02 (Median) | Methylation in Control | 6.76E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC27A1 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
TSS200 (cg04442576) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:3.23E+00 | Statistic Test | p-value:1.76E-12; Z-score:6.30E+00 | ||
|
Methylation in Case |
3.34E-01 (Median) | Methylation in Control | 1.03E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC27A1 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
Body (cg06369407) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.51E+00 | Statistic Test | p-value:8.10E-18; Z-score:-2.70E+00 | ||
|
Methylation in Case |
2.65E-01 (Median) | Methylation in Control | 3.99E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC27A1 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
Body (cg21192979) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.54E+00 | Statistic Test | p-value:3.67E-17; Z-score:-7.53E+00 | ||
|
Methylation in Case |
5.12E-01 (Median) | Methylation in Control | 7.86E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC27A1 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
Body (cg13038422) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.63E+00 | Statistic Test | p-value:6.37E-11; Z-score:-2.02E+00 | ||
|
Methylation in Case |
4.86E-01 (Median) | Methylation in Control | 7.91E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC27A1 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
Body (cg10503473) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.22E+00 | Statistic Test | p-value:1.61E-10; Z-score:-2.58E+00 | ||
|
Methylation in Case |
7.87E-01 (Median) | Methylation in Control | 9.60E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC27A1 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
Body (cg16664617) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.11E+00 | Statistic Test | p-value:2.99E-07; Z-score:-1.35E+00 | ||
|
Methylation in Case |
6.54E-01 (Median) | Methylation in Control | 7.23E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC27A1 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
Body (cg03233444) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.41E+00 | Statistic Test | p-value:3.12E-07; Z-score:1.76E+00 | ||
|
Methylation in Case |
2.34E-01 (Median) | Methylation in Control | 1.66E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC27A1 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
Body (cg08244301) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.10E+00 | Statistic Test | p-value:7.32E-04; Z-score:1.30E+00 | ||
|
Methylation in Case |
6.64E-01 (Median) | Methylation in Control | 6.02E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC27A1 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
Body (cg16614288) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.06E+00 | Statistic Test | p-value:7.29E-03; Z-score:4.60E-01 | ||
|
Methylation in Case |
8.43E-01 (Median) | Methylation in Control | 8.00E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC27A1 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
Body (cg03535829) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:3.26E-02; Z-score:-1.77E-01 | ||
|
Methylation in Case |
9.03E-01 (Median) | Methylation in Control | 9.05E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of SLC27A1 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
Body (cg15507500) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:3.57E-02; Z-score:-2.77E-01 | ||
|
Methylation in Case |
9.04E-01 (Median) | Methylation in Control | 9.09E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of SLC27A1 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
3'UTR (cg09479512) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.48E-03; Z-score:-5.41E-01 | ||
|
Methylation in Case |
8.30E-01 (Median) | Methylation in Control | 8.41E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
HIV infection |
13 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC27A1 in HIV infection | [ 8 ] | |||
|
Location |
TSS1500 (cg22333846) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.45E+00 | Statistic Test | p-value:4.02E-05; Z-score:1.78E+00 | ||
|
Methylation in Case |
1.59E-01 (Median) | Methylation in Control | 1.10E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC27A1 in HIV infection | [ 8 ] | |||
|
Location |
TSS200 (cg01611665) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.20E+00 | Statistic Test | p-value:4.90E-02; Z-score:6.85E-01 | ||
|
Methylation in Case |
6.42E-02 (Median) | Methylation in Control | 5.33E-02 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC27A1 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg08244301) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.75E+00 | Statistic Test | p-value:6.30E-11; Z-score:3.48E+00 | ||
|
Methylation in Case |
5.33E-01 (Median) | Methylation in Control | 3.04E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC27A1 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg16664617) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.06E+00 | Statistic Test | p-value:2.94E-07; Z-score:1.09E+00 | ||
|
Methylation in Case |
7.92E-01 (Median) | Methylation in Control | 7.45E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC27A1 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg02707854) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.38E+00 | Statistic Test | p-value:1.35E-05; Z-score:1.72E+00 | ||
|
Methylation in Case |
6.18E-01 (Median) | Methylation in Control | 2.60E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC27A1 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg03233444) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.22E+00 | Statistic Test | p-value:2.43E-04; Z-score:1.28E+00 | ||
|
Methylation in Case |
1.66E-01 (Median) | Methylation in Control | 1.36E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC27A1 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg21160774) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:5.20E-04; Z-score:7.91E-01 | ||
|
Methylation in Case |
8.91E-01 (Median) | Methylation in Control | 8.74E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC27A1 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg10692922) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:1.63E-03; Z-score:-9.48E-01 | ||
|
Methylation in Case |
8.32E-01 (Median) | Methylation in Control | 8.55E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC27A1 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg17132030) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.84E+00 | Statistic Test | p-value:1.75E-03; Z-score:1.43E+00 | ||
|
Methylation in Case |
5.14E-01 (Median) | Methylation in Control | 2.79E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC27A1 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg02002247) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:3.39E-03; Z-score:3.43E-01 | ||
|
Methylation in Case |
8.88E-01 (Median) | Methylation in Control | 8.77E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC27A1 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg25517015) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:1.39E-02; Z-score:-9.37E-01 | ||
|
Methylation in Case |
7.36E-01 (Median) | Methylation in Control | 7.79E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC27A1 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg15471825) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.00E+00 | Statistic Test | p-value:1.91E-02; Z-score:6.26E-01 | ||
|
Methylation in Case |
9.96E-01 (Median) | Methylation in Control | 9.95E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC27A1 in HIV infection | [ 8 ] | |||
|
Location |
3'UTR (cg09479512) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:1.48E-02; Z-score:4.42E-01 | ||
|
Methylation in Case |
9.36E-01 (Median) | Methylation in Control | 9.27E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Lung adenocarcinoma |
7 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC27A1 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
TSS1500 (cg22333846) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.26E+00 | Statistic Test | p-value:3.54E-02; Z-score:1.51E+00 | ||
|
Methylation in Case |
1.58E-01 (Median) | Methylation in Control | 1.26E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC27A1 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
TSS200 (cg13418196) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.27E+00 | Statistic Test | p-value:5.83E-03; Z-score:1.34E+00 | ||
|
Methylation in Case |
1.19E-01 (Median) | Methylation in Control | 9.44E-02 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC27A1 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg08244301) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.35E+00 | Statistic Test | p-value:2.91E-04; Z-score:2.10E+00 | ||
|
Methylation in Case |
5.25E-01 (Median) | Methylation in Control | 3.89E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC27A1 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg10692922) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:4.66E-03; Z-score:-1.53E+00 | ||
|
Methylation in Case |
8.38E-01 (Median) | Methylation in Control | 8.69E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC27A1 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg02002247) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.09E+00 | Statistic Test | p-value:2.33E-02; Z-score:1.56E+00 | ||
|
Methylation in Case |
8.07E-01 (Median) | Methylation in Control | 7.41E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC27A1 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg03535829) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:3.58E-02; Z-score:-3.77E-01 | ||
|
Methylation in Case |
8.92E-01 (Median) | Methylation in Control | 8.96E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC27A1 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg16664617) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.12E+00 | Statistic Test | p-value:3.86E-02; Z-score:-2.38E+00 | ||
|
Methylation in Case |
6.80E-01 (Median) | Methylation in Control | 7.58E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Panic disorder |
6 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC27A1 in panic disorder | [ 10 ] | |||
|
Location |
TSS1500 (cg27554237) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-9.78E-01 | Statistic Test | p-value:4.13E-02; Z-score:-3.28E-01 | ||
|
Methylation in Case |
-4.58E+00 (Median) | Methylation in Control | -4.49E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC27A1 in panic disorder | [ 10 ] | |||
|
Location |
TSS200 (cg21607669) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-9.79E-01 | Statistic Test | p-value:6.51E-03; Z-score:-5.38E-01 | ||
|
Methylation in Case |
-5.54E+00 (Median) | Methylation in Control | -5.42E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC27A1 in panic disorder | [ 10 ] | |||
|
Location |
TSS200 (cg08447322) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:9.83E-01 | Statistic Test | p-value:1.59E-02; Z-score:3.40E-01 | ||
|
Methylation in Case |
-5.12E+00 (Median) | Methylation in Control | -5.21E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC27A1 in panic disorder | [ 10 ] | |||
|
Location |
TSS200 (cg14549755) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-9.90E-01 | Statistic Test | p-value:4.23E-02; Z-score:-2.62E-01 | ||
|
Methylation in Case |
-5.46E+00 (Median) | Methylation in Control | -5.40E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC27A1 in panic disorder | [ 10 ] | |||
|
Location |
Body (cg08244301) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-8.69E-01 | Statistic Test | p-value:4.10E-03; Z-score:-4.48E-01 | ||
|
Methylation in Case |
-2.25E+00 (Median) | Methylation in Control | -1.96E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC27A1 in panic disorder | [ 10 ] | |||
|
Location |
Body (cg03042281) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:2.25E-02; Z-score:-2.57E-01 | ||
|
Methylation in Case |
3.63E+00 (Median) | Methylation in Control | 3.75E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Papillary thyroid cancer |
19 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC27A1 in papillary thyroid cancer | [ 11 ] | |||
|
Location |
TSS1500 (cg15424054) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:2.33E-02; Z-score:-2.56E-01 | ||
|
Methylation in Case |
8.79E-02 (Median) | Methylation in Control | 9.14E-02 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC27A1 in papillary thyroid cancer | [ 11 ] | |||
|
Location |
TSS1500 (cg21762534) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:3.55E-02; Z-score:-4.02E-01 | ||
|
Methylation in Case |
1.24E-01 (Median) | Methylation in Control | 1.28E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC27A1 in papillary thyroid cancer | [ 11 ] | |||
|
Location |
TSS200 (cg21607669) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.18E+00 | Statistic Test | p-value:6.25E-06; Z-score:-1.11E+00 | ||
|
Methylation in Case |
6.73E-02 (Median) | Methylation in Control | 7.96E-02 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC27A1 in papillary thyroid cancer | [ 11 ] | |||
|
Location |
TSS200 (cg08447322) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.15E+00 | Statistic Test | p-value:1.22E-03; Z-score:-7.01E-01 | ||
|
Methylation in Case |
5.00E-02 (Median) | Methylation in Control | 5.73E-02 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC27A1 in papillary thyroid cancer | [ 11 ] | |||
|
Location |
TSS200 (cg13418196) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.13E+00 | Statistic Test | p-value:1.55E-03; Z-score:-7.12E-01 | ||
|
Methylation in Case |
5.54E-02 (Median) | Methylation in Control | 6.26E-02 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC27A1 in papillary thyroid cancer | [ 11 ] | |||
|
Location |
TSS200 (cg14549755) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:4.22E-03; Z-score:-7.04E-01 | ||
|
Methylation in Case |
7.10E-02 (Median) | Methylation in Control | 7.77E-02 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC27A1 in papillary thyroid cancer | [ 11 ] | |||
|
Location |
TSS200 (cg01611665) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:3.18E-02; Z-score:-4.56E-01 | ||
|
Methylation in Case |
4.59E-02 (Median) | Methylation in Control | 5.06E-02 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC27A1 in papillary thyroid cancer | [ 11 ] | |||
|
Location |
Body (cg02002247) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:5.82E-08; Z-score:-2.44E+00 | ||
|
Methylation in Case |
7.08E-01 (Median) | Methylation in Control | 7.81E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC27A1 in papillary thyroid cancer | [ 11 ] | |||
|
Location |
Body (cg08244301) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.22E+00 | Statistic Test | p-value:8.17E-05; Z-score:-1.16E+00 | ||
|
Methylation in Case |
4.67E-01 (Median) | Methylation in Control | 5.71E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC27A1 in papillary thyroid cancer | [ 11 ] | |||
|
Location |
Body (cg16614288) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.09E+00 | Statistic Test | p-value:1.22E-04; Z-score:6.94E-01 | ||
|
Methylation in Case |
5.75E-01 (Median) | Methylation in Control | 5.29E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC27A1 in papillary thyroid cancer | [ 11 ] | |||
|
Location |
Body (cg08220872) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.04E+00 | Statistic Test | p-value:7.77E-04; Z-score:8.19E-01 | ||
|
Methylation in Case |
8.54E-01 (Median) | Methylation in Control | 8.25E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC27A1 in papillary thyroid cancer | [ 11 ] | |||
|
Location |
Body (cg03535829) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:8.64E-04; Z-score:-7.02E-01 | ||
|
Methylation in Case |
8.40E-01 (Median) | Methylation in Control | 8.49E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC27A1 in papillary thyroid cancer | [ 11 ] | |||
|
Location |
Body (cg03042281) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.07E+00 | Statistic Test | p-value:9.15E-04; Z-score:1.10E+00 | ||
|
Methylation in Case |
8.77E-01 (Median) | Methylation in Control | 8.20E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of SLC27A1 in papillary thyroid cancer | [ 11 ] | |||
|
Location |
Body (cg21756027) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:1.85E-03; Z-score:-4.55E-01 | ||
|
Methylation in Case |
7.10E-02 (Median) | Methylation in Control | 7.69E-02 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of SLC27A1 in papillary thyroid cancer | [ 11 ] | |||
|
Location |
Body (cg03197505) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:2.55E-03; Z-score:-7.85E-01 | ||
|
Methylation in Case |
9.31E-01 (Median) | Methylation in Control | 9.41E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of SLC27A1 in papillary thyroid cancer | [ 11 ] | |||
|
Location |
Body (cg09325679) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.00E+00 | Statistic Test | p-value:3.38E-03; Z-score:5.73E-01 | ||
|
Methylation in Case |
9.46E-01 (Median) | Methylation in Control | 9.41E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Methylation of SLC27A1 in papillary thyroid cancer | [ 11 ] | |||
|
Location |
Body (cg25517015) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:3.77E-03; Z-score:-5.25E-01 | ||
|
Methylation in Case |
9.03E-01 (Median) | Methylation in Control | 9.15E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon18 |
Methylation of SLC27A1 in papillary thyroid cancer | [ 11 ] | |||
|
Location |
Body (cg03233444) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:2.19E-02; Z-score:-4.13E-01 | ||
|
Methylation in Case |
9.08E-02 (Median) | Methylation in Control | 9.84E-02 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon19 |
Methylation of SLC27A1 in papillary thyroid cancer | [ 11 ] | |||
|
Location |
3'UTR (cg09479512) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:3.48E-03; Z-score:-4.46E-01 | ||
|
Methylation in Case |
9.19E-01 (Median) | Methylation in Control | 9.27E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Prostate cancer |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC27A1 in prostate cancer | [ 12 ] | |||
|
Location |
TSS1500 (cg02075570) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.26E+00 | Statistic Test | p-value:7.45E-03; Z-score:4.55E+00 | ||
|
Methylation in Case |
6.83E-02 (Median) | Methylation in Control | 5.44E-02 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC27A1 in prostate cancer | [ 12 ] | |||
|
Location |
TSS200 (cg16857852) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.59E+00 | Statistic Test | p-value:1.05E-03; Z-score:-4.03E+00 | ||
|
Methylation in Case |
3.78E-01 (Median) | Methylation in Control | 6.02E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC27A1 in prostate cancer | [ 12 ] | |||
|
Location |
Body (cg12970757) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.25E+00 | Statistic Test | p-value:9.90E-03; Z-score:2.42E+00 | ||
|
Methylation in Case |
8.79E-01 (Median) | Methylation in Control | 7.02E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC27A1 in prostate cancer | [ 12 ] | |||
|
Location |
Body (cg15190451) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.18E+00 | Statistic Test | p-value:4.17E-02; Z-score:1.67E+00 | ||
|
Methylation in Case |
9.16E-01 (Median) | Methylation in Control | 7.74E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Systemic lupus erythematosus |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC27A1 in systemic lupus erythematosus | [ 13 ] | |||
|
Location |
TSS1500 (cg22803827) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:3.35E-02; Z-score:-2.44E-02 | ||
|
Methylation in Case |
9.50E-02 (Median) | Methylation in Control | 9.54E-02 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC27A1 in systemic lupus erythematosus | [ 13 ] | |||
|
Location |
TSS200 (cg13418196) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:4.54E-02; Z-score:-8.26E-02 | ||
|
Methylation in Case |
5.56E-02 (Median) | Methylation in Control | 5.72E-02 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC27A1 in systemic lupus erythematosus | [ 13 ] | |||
|
Location |
1stExon (cg02576503) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:7.39E-03; Z-score:-2.02E-01 | ||
|
Methylation in Case |
6.92E-02 (Median) | Methylation in Control | 7.34E-02 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC27A1 in systemic lupus erythematosus | [ 13 ] | |||
|
Location |
Body (cg03042281) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:4.75E-02; Z-score:-4.10E-02 | ||
|
Methylation in Case |
9.11E-01 (Median) | Methylation in Control | 9.12E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Atypical teratoid rhabdoid tumor |
13 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC27A1 in atypical teratoid rhabdoid tumor | [ 14 ] | |||
|
Location |
1stExon (cg02576503) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.68E+00 | Statistic Test | p-value:1.28E-26; Z-score:-4.45E+00 | ||
|
Methylation in Case |
5.49E-01 (Median) | Methylation in Control | 9.20E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC27A1 in atypical teratoid rhabdoid tumor | [ 14 ] | |||
|
Location |
Body (cg02002247) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.52E+00 | Statistic Test | p-value:1.08E-04; Z-score:-1.02E+00 | ||
|
Methylation in Case |
2.29E-01 (Median) | Methylation in Control | 3.49E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC27A1 in atypical teratoid rhabdoid tumor | [ 14 ] | |||
|
Location |
Body (cg02707854) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:2.22E-04; Z-score:-9.02E-01 | ||
|
Methylation in Case |
7.81E-01 (Median) | Methylation in Control | 8.55E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC27A1 in atypical teratoid rhabdoid tumor | [ 14 ] | |||
|
Location |
Body (cg03042281) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.29E+00 | Statistic Test | p-value:2.50E-04; Z-score:-1.08E+00 | ||
|
Methylation in Case |
4.05E-01 (Median) | Methylation in Control | 5.21E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC27A1 in atypical teratoid rhabdoid tumor | [ 14 ] | |||
|
Location |
Body (cg03197505) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:2.62E-04; Z-score:-8.64E-01 | ||
|
Methylation in Case |
7.42E-01 (Median) | Methylation in Control | 8.18E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC27A1 in atypical teratoid rhabdoid tumor | [ 14 ] | |||
|
Location |
Body (cg03233444) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.24E+00 | Statistic Test | p-value:2.69E-04; Z-score:9.52E-01 | ||
|
Methylation in Case |
5.78E-01 (Median) | Methylation in Control | 4.66E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC27A1 in atypical teratoid rhabdoid tumor | [ 14 ] | |||
|
Location |
Body (cg03535829) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.29E+00 | Statistic Test | p-value:3.66E-04; Z-score:1.16E+00 | ||
|
Methylation in Case |
4.38E-01 (Median) | Methylation in Control | 3.38E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC27A1 in atypical teratoid rhabdoid tumor | [ 14 ] | |||
|
Location |
Body (cg06012269) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:2.02E-03; Z-score:-2.72E-01 | ||
|
Methylation in Case |
8.90E-01 (Median) | Methylation in Control | 9.06E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC27A1 in atypical teratoid rhabdoid tumor | [ 14 ] | |||
|
Location |
Body (cg08220872) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:5.62E-03; Z-score:-5.42E-01 | ||
|
Methylation in Case |
2.27E-01 (Median) | Methylation in Control | 2.50E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC27A1 in atypical teratoid rhabdoid tumor | [ 14 ] | |||
|
Location |
Body (cg08244301) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:5.64E-03; Z-score:-4.98E-01 | ||
|
Methylation in Case |
8.19E-01 (Median) | Methylation in Control | 8.70E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC27A1 in atypical teratoid rhabdoid tumor | [ 14 ] | |||
|
Location |
Body (cg09325679) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.41E+00 | Statistic Test | p-value:9.87E-03; Z-score:-5.29E-01 | ||
|
Methylation in Case |
2.06E-01 (Median) | Methylation in Control | 2.90E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC27A1 in atypical teratoid rhabdoid tumor | [ 14 ] | |||
|
Location |
Body (cg10692922) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:1.72E-02; Z-score:6.33E-01 | ||
|
Methylation in Case |
9.35E-01 (Median) | Methylation in Control | 9.15E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC27A1 in atypical teratoid rhabdoid tumor | [ 14 ] | |||
|
Location |
3'UTR (cg09479512) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.85E+00 | Statistic Test | p-value:1.34E-12; Z-score:2.03E+00 | ||
|
Methylation in Case |
3.91E-01 (Median) | Methylation in Control | 2.11E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
microRNA |
|||||
|
Unclear Phenotype |
91 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
miR-1224 directly targets SLC27A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-1224 | miRNA Mature ID | miR-1224-3p | ||
|
miRNA Sequence |
CCCCACCUCCUCUCUCCUCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon2 |
miR-1233 directly targets SLC27A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-1233 | miRNA Mature ID | miR-1233-5p | ||
|
miRNA Sequence |
AGUGGGAGGCCAGGGCACGGCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon3 |
miR-1234 directly targets SLC27A1 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1234 | miRNA Mature ID | miR-1234-3p | ||
|
miRNA Sequence |
UCGGCCUGACCACCCACCCCAC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon4 |
miR-1249 directly targets SLC27A1 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1249 | miRNA Mature ID | miR-1249-5p | ||
|
miRNA Sequence |
AGGAGGGAGGAGAUGGGCCAAGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon5 |
miR-1260a directly targets SLC27A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-1260a | miRNA Mature ID | miR-1260a | ||
|
miRNA Sequence |
AUCCCACCUCUGCCACCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon6 |
miR-1260b directly targets SLC27A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-1260b | miRNA Mature ID | miR-1260b | ||
|
miRNA Sequence |
AUCCCACCACUGCCACCAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon7 |
miR-1321 directly targets SLC27A1 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1321 | miRNA Mature ID | miR-1321 | ||
|
miRNA Sequence |
CAGGGAGGUGAAUGUGAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon8 |
miR-149 directly targets SLC27A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-149 | miRNA Mature ID | miR-149-3p | ||
|
miRNA Sequence |
AGGGAGGGACGGGGGCUGUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon9 |
miR-1827 directly targets SLC27A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-1827 | miRNA Mature ID | miR-1827 | ||
|
miRNA Sequence |
UGAGGCAGUAGAUUGAAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon10 |
miR-185 directly targets SLC27A1 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-185 | miRNA Mature ID | miR-185-3p | ||
|
miRNA Sequence |
AGGGGCUGGCUUUCCUCUGGUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon11 |
miR-1910 directly targets SLC27A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-1910 | miRNA Mature ID | miR-1910-3p | ||
|
miRNA Sequence |
GAGGCAGAAGCAGGAUGACA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon12 |
miR-19a directly targets SLC27A1 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-19a | miRNA Mature ID | miR-19a-3p | ||
|
miRNA Sequence |
UGUGCAAAUCUAUGCAAAACUGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon13 |
miR-19b directly targets SLC27A1 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-19b | miRNA Mature ID | miR-19b-3p | ||
|
miRNA Sequence |
UGUGCAAAUCCAUGCAAAACUGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon14 |
miR-2467 directly targets SLC27A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-2467 | miRNA Mature ID | miR-2467-3p | ||
|
miRNA Sequence |
AGCAGAGGCAGAGAGGCUCAGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon15 |
miR-30b directly targets SLC27A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-30b | miRNA Mature ID | miR-30b-3p | ||
|
miRNA Sequence |
CUGGGAGGUGGAUGUUUACUUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon16 |
miR-30d directly targets SLC27A1 | [ 19 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
|
miRNA Stemloop ID |
miR-30d | miRNA Mature ID | miR-30d-5p | ||
|
miRNA Sequence |
UGUAAACAUCCCCGACUGGAAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon17 |
miR-3151 directly targets SLC27A1 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3151 | miRNA Mature ID | miR-3151-5p | ||
|
miRNA Sequence |
GGUGGGGCAAUGGGAUCAGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon18 |
miR-335 directly targets SLC27A1 | [ 20 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
|
miRNA Stemloop ID |
miR-335 | miRNA Mature ID | miR-335-5p | ||
|
miRNA Sequence |
UCAAGAGCAAUAACGAAAAAUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon19 |
miR-340 directly targets SLC27A1 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-340 | miRNA Mature ID | miR-340-3p | ||
|
miRNA Sequence |
UCCGUCUCAGUUACUUUAUAGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon20 |
miR-3612 directly targets SLC27A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3612 | miRNA Mature ID | miR-3612 | ||
|
miRNA Sequence |
AGGAGGCAUCUUGAGAAAUGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon21 |
miR-3614 directly targets SLC27A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3614 | miRNA Mature ID | miR-3614-5p | ||
|
miRNA Sequence |
CCACUUGGAUCUGAAGGCUGCCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon22 |
miR-3664 directly targets SLC27A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3664 | miRNA Mature ID | miR-3664-3p | ||
|
miRNA Sequence |
UCUCAGGAGUAAAGACAGAGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon23 |
miR-3689c directly targets SLC27A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3689c | miRNA Mature ID | miR-3689c | ||
|
miRNA Sequence |
CUGGGAGGUGUGAUAUUGUGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon24 |
miR-377 directly targets SLC27A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-377 | miRNA Mature ID | miR-377-5p | ||
|
miRNA Sequence |
AGAGGUUGCCCUUGGUGAAUUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon25 |
miR-3929 directly targets SLC27A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3929 | miRNA Mature ID | miR-3929 | ||
|
miRNA Sequence |
GAGGCUGAUGUGAGUAGACCACU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon26 |
miR-3937 directly targets SLC27A1 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3937 | miRNA Mature ID | miR-3937 | ||
|
miRNA Sequence |
ACAGGCGGCUGUAGCAAUGGGGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon27 |
miR-4257 directly targets SLC27A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4257 | miRNA Mature ID | miR-4257 | ||
|
miRNA Sequence |
CCAGAGGUGGGGACUGAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon28 |
miR-4271 directly targets SLC27A1 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4271 | miRNA Mature ID | miR-4271 | ||
|
miRNA Sequence |
GGGGGAAGAAAAGGUGGGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon29 |
miR-4283 directly targets SLC27A1 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4283 | miRNA Mature ID | miR-4283 | ||
|
miRNA Sequence |
UGGGGCUCAGCGAGUUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon30 |
miR-4433a directly targets SLC27A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4433a | miRNA Mature ID | miR-4433a-3p | ||
|
miRNA Sequence |
ACAGGAGUGGGGGUGGGACAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon31 |
miR-4478 directly targets SLC27A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4478 | miRNA Mature ID | miR-4478 | ||
|
miRNA Sequence |
GAGGCUGAGCUGAGGAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon32 |
miR-4489 directly targets SLC27A1 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4489 | miRNA Mature ID | miR-4489 | ||
|
miRNA Sequence |
UGGGGCUAGUGAUGCAGGACG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon33 |
miR-4492 directly targets SLC27A1 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4492 | miRNA Mature ID | miR-4492 | ||
|
miRNA Sequence |
GGGGCUGGGCGCGCGCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon34 |
miR-4498 directly targets SLC27A1 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4498 | miRNA Mature ID | miR-4498 | ||
|
miRNA Sequence |
UGGGCUGGCAGGGCAAGUGCUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon35 |
miR-4505 directly targets SLC27A1 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4505 | miRNA Mature ID | miR-4505 | ||
|
miRNA Sequence |
AGGCUGGGCUGGGACGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon36 |
miR-4510 directly targets SLC27A1 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4510 | miRNA Mature ID | miR-4510 | ||
|
miRNA Sequence |
UGAGGGAGUAGGAUGUAUGGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon37 |
miR-4537 directly targets SLC27A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4537 | miRNA Mature ID | miR-4537 | ||
|
miRNA Sequence |
UGAGCCGAGCUGAGCUUAGCUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon38 |
miR-455 directly targets SLC27A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-455 | miRNA Mature ID | miR-455-3p | ||
|
miRNA Sequence |
GCAGUCCAUGGGCAUAUACAC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon39 |
miR-4684 directly targets SLC27A1 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4684 | miRNA Mature ID | miR-4684-5p | ||
|
miRNA Sequence |
CUCUCUACUGACUUGCAACAUA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon40 |
miR-4695 directly targets SLC27A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4695 | miRNA Mature ID | miR-4695-5p | ||
|
miRNA Sequence |
CAGGAGGCAGUGGGCGAGCAGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon41 |
miR-4711 directly targets SLC27A1 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4711 | miRNA Mature ID | miR-4711-5p | ||
|
miRNA Sequence |
UGCAUCAGGCCAGAAGACAUGAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon42 |
miR-4725 directly targets SLC27A1 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4725 | miRNA Mature ID | miR-4725-3p | ||
|
miRNA Sequence |
UGGGGAAGGCGUCAGUGUCGGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon43 |
miR-4728 directly targets SLC27A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4728 | miRNA Mature ID | miR-4728-5p | ||
|
miRNA Sequence |
UGGGAGGGGAGAGGCAGCAAGCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon44 |
miR-4739 directly targets SLC27A1 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4739 | miRNA Mature ID | miR-4739 | ||
|
miRNA Sequence |
AAGGGAGGAGGAGCGGAGGGGCCCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon45 |
miR-4747 directly targets SLC27A1 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4747 | miRNA Mature ID | miR-4747-5p | ||
|
miRNA Sequence |
AGGGAAGGAGGCUUGGUCUUAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon46 |
miR-4756 directly targets SLC27A1 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4756 | miRNA Mature ID | miR-4756-5p | ||
|
miRNA Sequence |
CAGGGAGGCGCUCACUCUCUGCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon47 |
miR-4768 directly targets SLC27A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4768 | miRNA Mature ID | miR-4768-3p | ||
|
miRNA Sequence |
CCAGGAGAUCCAGAGAGAAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon48 |
miR-4779 directly targets SLC27A1 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4779 | miRNA Mature ID | miR-4779 | ||
|
miRNA Sequence |
UAGGAGGGAAUAGUAAAAGCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon49 |
miR-485 directly targets SLC27A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-485 | miRNA Mature ID | miR-485-5p | ||
|
miRNA Sequence |
AGAGGCUGGCCGUGAUGAAUUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon50 |
miR-5001 directly targets SLC27A1 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-5001 | miRNA Mature ID | miR-5001-5p | ||
|
miRNA Sequence |
AGGGCUGGACUCAGCGGCGGAGCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon51 |
miR-5004 directly targets SLC27A1 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-5004 | miRNA Mature ID | miR-5004-5p | ||
|
miRNA Sequence |
UGAGGACAGGGCAAAUUCACGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon52 |
miR-510 directly targets SLC27A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-510 | miRNA Mature ID | miR-510-5p | ||
|
miRNA Sequence |
UACUCAGGAGAGUGGCAAUCAC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon53 |
miR-512 directly targets SLC27A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-512 | miRNA Mature ID | miR-512-5p | ||
|
miRNA Sequence |
CACUCAGCCUUGAGGGCACUUUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon54 |
miR-5196 directly targets SLC27A1 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-5196 | miRNA Mature ID | miR-5196-5p | ||
|
miRNA Sequence |
AGGGAAGGGGACGAGGGUUGGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon55 |
miR-5690 directly targets SLC27A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-5690 | miRNA Mature ID | miR-5690 | ||
|
miRNA Sequence |
UCAGCUACUACCUCUAUUAGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon56 |
miR-5787 directly targets SLC27A1 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-5787 | miRNA Mature ID | miR-5787 | ||
|
miRNA Sequence |
GGGCUGGGGCGCGGGGAGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon57 |
miR-6086 directly targets SLC27A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6086 | miRNA Mature ID | miR-6086 | ||
|
miRNA Sequence |
GGAGGUUGGGAAGGGCAGAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon58 |
miR-6127 directly targets SLC27A1 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6127 | miRNA Mature ID | miR-6127 | ||
|
miRNA Sequence |
UGAGGGAGUGGGUGGGAGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon59 |
miR-6129 directly targets SLC27A1 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6129 | miRNA Mature ID | miR-6129 | ||
|
miRNA Sequence |
UGAGGGAGUUGGGUGUAUA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon60 |
miR-6130 directly targets SLC27A1 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6130 | miRNA Mature ID | miR-6130 | ||
|
miRNA Sequence |
UGAGGGAGUGGAUUGUAUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon61 |
miR-6133 directly targets SLC27A1 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6133 | miRNA Mature ID | miR-6133 | ||
|
miRNA Sequence |
UGAGGGAGGAGGUUGGGUA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon62 |
miR-6134 directly targets SLC27A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6134 | miRNA Mature ID | miR-6134 | ||
|
miRNA Sequence |
UGAGGUGGUAGGAUGUAGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon63 |
miR-6499 directly targets SLC27A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6499 | miRNA Mature ID | miR-6499-3p | ||
|
miRNA Sequence |
AGCAGUGUUUGUUUUGCCCACA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon64 |
miR-650 directly targets SLC27A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-650 | miRNA Mature ID | miR-650 | ||
|
miRNA Sequence |
AGGAGGCAGCGCUCUCAGGAC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon65 |
miR-6500 directly targets SLC27A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6500 | miRNA Mature ID | miR-6500-3p | ||
|
miRNA Sequence |
ACACUUGUUGGGAUGACCUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon66 |
miR-6515 directly targets SLC27A1 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6515 | miRNA Mature ID | miR-6515-5p | ||
|
miRNA Sequence |
UUGGAGGGUGUGGAAGACAUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon67 |
miR-6516 directly targets SLC27A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6516 | miRNA Mature ID | miR-6516-5p | ||
|
miRNA Sequence |
UUUGCAGUAACAGGUGUGAGCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon68 |
miR-665 directly targets SLC27A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-665 | miRNA Mature ID | miR-665 | ||
|
miRNA Sequence |
ACCAGGAGGCUGAGGCCCCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon69 |
miR-6771 directly targets SLC27A1 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6771 | miRNA Mature ID | miR-6771-3p | ||
|
miRNA Sequence |
CAAACCCCUGUCUACCCGCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon70 |
miR-6778 directly targets SLC27A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6778 | miRNA Mature ID | miR-6778-5p | ||
|
miRNA Sequence |
AGUGGGAGGACAGGAGGCAGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon71 |
miR-6779 directly targets SLC27A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6779 | miRNA Mature ID | miR-6779-5p | ||
|
miRNA Sequence |
CUGGGAGGGGCUGGGUUUGGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon72 |
miR-6780b directly targets SLC27A1 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6780b | miRNA Mature ID | miR-6780b-5p | ||
|
miRNA Sequence |
UGGGGAAGGCUUGGCAGGGAAGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon73 |
miR-6783 directly targets SLC27A1 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6783 | miRNA Mature ID | miR-6783-5p | ||
|
miRNA Sequence |
UAGGGGAAAAGUCCUGAUCCGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon74 |
miR-6785 directly targets SLC27A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6785 | miRNA Mature ID | miR-6785-5p | ||
|
miRNA Sequence |
UGGGAGGGCGUGGAUGAUGGUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon75 |
miR-6797 directly targets SLC27A1 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6797 | miRNA Mature ID | miR-6797-5p | ||
|
miRNA Sequence |
AGGAGGGAAGGGGCUGAGAACAGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon76 |
miR-6799 directly targets SLC27A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6799 | miRNA Mature ID | miR-6799-5p | ||
|
miRNA Sequence |
GGGGAGGUGUGCAGGGCUGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon77 |
miR-6827 directly targets SLC27A1 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6827 | miRNA Mature ID | miR-6827-3p | ||
|
miRNA Sequence |
ACCGUCUCUUCUGUUCCCCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon78 |
miR-6840 directly targets SLC27A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6840 | miRNA Mature ID | miR-6840-3p | ||
|
miRNA Sequence |
GCCCAGGACUUUGUGCGGGGUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon79 |
miR-6872 directly targets SLC27A1 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6872 | miRNA Mature ID | miR-6872-5p | ||
|
miRNA Sequence |
UCUCGCAUCAGGAGGCAAGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon80 |
miR-6883 directly targets SLC27A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6883 | miRNA Mature ID | miR-6883-5p | ||
|
miRNA Sequence |
AGGGAGGGUGUGGUAUGGAUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon81 |
miR-6884 directly targets SLC27A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6884 | miRNA Mature ID | miR-6884-5p | ||
|
miRNA Sequence |
AGAGGCUGAGAAGGUGAUGUUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon82 |
miR-6894 directly targets SLC27A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6894 | miRNA Mature ID | miR-6894-5p | ||
|
miRNA Sequence |
AGGAGGAUGGAGAGCUGGGCCAGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon83 |
miR-7106 directly targets SLC27A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-7106 | miRNA Mature ID | miR-7106-5p | ||
|
miRNA Sequence |
UGGGAGGAGGGGAUCUUGGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon84 |
miR-7107 directly targets SLC27A1 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-7107 | miRNA Mature ID | miR-7107-5p | ||
|
miRNA Sequence |
UCGGCCUGGGGAGGAGGAAGGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon85 |
miR-7154 directly targets SLC27A1 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-7154 | miRNA Mature ID | miR-7154-3p | ||
|
miRNA Sequence |
AGGAGGACAAGUUGUGGGAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon86 |
miR-7160 directly targets SLC27A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-7160 | miRNA Mature ID | miR-7160-5p | ||
|
miRNA Sequence |
UGCUGAGGUCCGGGCUGUGCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon87 |
miR-7162 directly targets SLC27A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-7162 | miRNA Mature ID | miR-7162-3p | ||
|
miRNA Sequence |
UCUGAGGUGGAACAGCAGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon88 |
miR-762 directly targets SLC27A1 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-762 | miRNA Mature ID | miR-762 | ||
|
miRNA Sequence |
GGGGCUGGGGCCGGGGCCGAGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon89 |
miR-7854 directly targets SLC27A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-7854 | miRNA Mature ID | miR-7854-3p | ||
|
miRNA Sequence |
UGAGGUGACCGCAGAUGGGAA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon90 |
miR-7977 directly targets SLC27A1 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-7977 | miRNA Mature ID | miR-7977 | ||
|
miRNA Sequence |
UUCCCAGCCAACGCACCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon91 |
miR-92a-2 directly targets SLC27A1 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-92a-2 | miRNA Mature ID | miR-92a-2-5p | ||
|
miRNA Sequence |
GGGUGGGGAUUUGUUGCAUUAC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.