General Information of Drug Transporter (DT)
DT ID DTD0235 Transporter Info
Gene Name SLC26A7
Transporter Name Anion exchange transporter
Gene ID
115111
UniProt ID
Q8TE54
Epigenetic Regulations of This DT (EGR)

Methylation

  Atypical teratoid rhabdoid tumor

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC26A7 in atypical teratoid rhabdoid tumor [ 1 ]

Location

3'UTR (cg25481252)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.54E+00 Statistic Test p-value:2.44E-09; Z-score:-1.14E+00

Methylation in Case

2.41E-01 (Median) Methylation in Control 3.70E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Hepatocellular carcinoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC26A7 in hepatocellular carcinoma [ 2 ]

Location

3'UTR (cg25481252)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:3.61E-07; Z-score:-1.16E+00

Methylation in Case

7.29E-01 (Median) Methylation in Control 7.94E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Panic disorder

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC26A7 in panic disorder [ 3 ]

Location

3'UTR (cg25481252)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-3.13E-01 Statistic Test p-value:3.56E-05; Z-score:-8.98E-01

Methylation in Case

-4.13E-01 (Median) Methylation in Control -1.29E-01 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Liver cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant/significant hypermethylation of SLC26A7 in liver cancer than that in healthy individual/adjacent tissue

Studied Phenotype

Liver cancer [ICD-11:2C12]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:2.51E-14; Fold-change:-0.367197378; Z-score:-4.337043376

The Methylation Level of Disease Section Compare with the Adjacent Tissue

p-value:1.89E-13; Fold-change:-0.354240172; Z-score:-5.653589333
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
DT methylation level in tissue other than the diseased tissue of patients
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Graft-versus-host disease

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of SLC26A7 in graft-versus-host disease than that in healthy individual

Studied Phenotype

Graft-versus-host disease [ICD-11:4B24]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:0.00052456; Fold-change:-0.205351147; Z-score:-9.251206618
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Prostate cancer metastasis

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of SLC26A7 in prostate cancer metastasis than that in healthy individual

Studied Phenotype

Prostate cancer metastasis [ICD-11:2.00E+06]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:0.03728236; Fold-change:-0.219857699; Z-score:-15.80517924
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Lymphoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of SLC26A7 in lymphoma than that in healthy individual

Studied Phenotype

Lymphoma [ICD-11:2B30]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:5.80E-20; Fold-change:-0.653215552; Z-score:-4.819744661
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

microRNA

  Unclear Phenotype

         11 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-1 directly targets SLC26A7 [ 4 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-1 miRNA Mature ID miR-1-3p

miRNA Sequence

UGGAAUGUAAAGAAGUAUGUAU

miRNA Target Type

Direct

Experimental Material

Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon2

miR-130b directly targets SLC26A7 [ 5 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-130b miRNA Mature ID miR-130b-5p

miRNA Sequence

ACUCUUUCCCUGUUGCACUAC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon3

miR-3156 directly targets SLC26A7 [ 5 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3156 miRNA Mature ID miR-3156-5p

miRNA Sequence

AAAGAUCUGGAAGUGGGAGACA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon4

miR-335 directly targets SLC26A7 [ 6 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-335 miRNA Mature ID miR-335-5p

miRNA Sequence

UCAAGAGCAAUAACGAAAAAUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon5

miR-33a directly targets SLC26A7 [ 5 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-33a miRNA Mature ID miR-33a-3p

miRNA Sequence

CAAUGUUUCCACAGUGCAUCAC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon6

miR-409 directly targets SLC26A7 [ 5 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-409 miRNA Mature ID miR-409-3p

miRNA Sequence

GAAUGUUGCUCGGUGAACCCCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon7

miR-4307 directly targets SLC26A7 [ 5 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4307 miRNA Mature ID miR-4307

miRNA Sequence

AAUGUUUUUUCCUGUUUCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon8

miR-4659a directly targets SLC26A7 [ 5 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4659a miRNA Mature ID miR-4659a-3p

miRNA Sequence

UUUCUUCUUAGACAUGGCAACG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon9

miR-4659b directly targets SLC26A7 [ 5 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4659b miRNA Mature ID miR-4659b-3p

miRNA Sequence

UUUCUUCUUAGACAUGGCAGCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon10

miR-4753 directly targets SLC26A7 [ 5 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4753 miRNA Mature ID miR-4753-3p

miRNA Sequence

UUCUCUUUCUUUAGCCUUGUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon11

miR-6875 directly targets SLC26A7 [ 5 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6875 miRNA Mature ID miR-6875-3p

miRNA Sequence

AUUCUUCCUGCCCUGGCUCCAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human
References
1 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
3 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
4 The impact of microRNAs on protein output. Nature. 2008 Sep 4;455(7209):64-71.
5 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
6 Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.