Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0205 Transporter Info
Gene Name	SLC25A42
Transporter Name	Mitochondrial coenzyme A transporter SLC25A42
Gene ID	284439
UniProt ID	Q86VD7

Epigenetic Regulations of This DT (EGR)
Methylation
Atypical teratoid rhabdoid tumor	10 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC25A42 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg00813603)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.27E+00	Statistic Test	p-value:6.62E-09; Z-score:1.33E+00
Methylation in Case	7.48E-01 (Median)	Methylation in Control	5.90E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC25A42 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg01318291)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.17E+00	Statistic Test	p-value:9.40E-09; Z-score:-1.47E+00
Methylation in Case	7.08E-01 (Median)	Methylation in Control	8.28E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC25A42 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg19547236)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.10E+00	Statistic Test	p-value:3.32E-06; Z-score:-1.19E+00
Methylation in Case	7.08E-01 (Median)	Methylation in Control	7.81E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC25A42 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg23956760)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.17E+00	Statistic Test	p-value:7.49E-06; Z-score:1.42E+00
Methylation in Case	8.73E-01 (Median)	Methylation in Control	7.46E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC25A42 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg02595575)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:1.80E-04; Z-score:-8.45E-01
Methylation in Case	8.84E-01 (Median)	Methylation in Control	9.07E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC25A42 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg04460816)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:7.83E-04; Z-score:-4.54E-01
Methylation in Case	8.66E-01 (Median)	Methylation in Control	8.90E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC25A42 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg04661001)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.09E+00	Statistic Test	p-value:8.96E-04; Z-score:-3.75E-01
Methylation in Case	4.19E-01 (Median)	Methylation in Control	4.55E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC25A42 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg10665321)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.03E+00	Statistic Test	p-value:1.72E-02; Z-score:1.05E-01
Methylation in Case	1.21E-01 (Median)	Methylation in Control	1.18E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC25A42 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg11287443)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.01E+00	Statistic Test	p-value:2.10E-02; Z-score:3.45E-01
Methylation in Case	9.35E-01 (Median)	Methylation in Control	9.26E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC25A42 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	3'UTR (cg02677865)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.47E+00	Statistic Test	p-value:4.02E-15; Z-score:2.40E+00
Methylation in Case	6.97E-01 (Median)	Methylation in Control	4.75E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Bladder cancer	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC25A42 in bladder cancer			[ 2 ]
Location	5'UTR (cg23956760)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.10E+00	Statistic Test	p-value:5.67E-03; Z-score:4.50E+00
Methylation in Case	7.62E-01 (Median)	Methylation in Control	6.91E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC25A42 in bladder cancer			[ 2 ]
Location	TSS200 (cg23474268)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.22E+00	Statistic Test	p-value:2.86E-04; Z-score:-3.32E+00
Methylation in Case	1.03E-01 (Median)	Methylation in Control	1.26E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC25A42 in bladder cancer			[ 2 ]
Location	TSS200 (cg13423282)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.88E+00	Statistic Test	p-value:2.74E-02; Z-score:-1.48E+00
Methylation in Case	9.65E-02 (Median)	Methylation in Control	1.82E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC25A42 in bladder cancer			[ 2 ]
Location	Body (cg04661001)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.41E+00	Statistic Test	p-value:9.95E-09; Z-score:7.07E+00
Methylation in Case	8.06E-01 (Median)	Methylation in Control	5.73E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC25A42 in bladder cancer			[ 2 ]
Location	Body (cg25612391)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.36E+00	Statistic Test	p-value:8.68E-07; Z-score:7.61E+00
Methylation in Case	7.37E-01 (Median)	Methylation in Control	5.42E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC25A42 in bladder cancer			[ 2 ]
Location	Body (cg11287443)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.24E+00	Statistic Test	p-value:3.01E-05; Z-score:-4.86E+00
Methylation in Case	6.71E-01 (Median)	Methylation in Control	8.33E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC25A42 in bladder cancer			[ 2 ]
Location	Body (cg02595575)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:4.63E-03; Z-score:-3.19E-02
Methylation in Case	4.56E-02 (Median)	Methylation in Control	4.62E-02 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Breast cancer	13 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC25A42 in breast cancer			[ 3 ]
Location	5'UTR (cg23956760)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.07E+00	Statistic Test	p-value:3.75E-05; Z-score:4.62E-01
Methylation in Case	6.74E-01 (Median)	Methylation in Control	6.33E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC25A42 in breast cancer			[ 3 ]
Location	5'UTR (cg00813603)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.28E+00	Statistic Test	p-value:2.00E-02; Z-score:6.30E-01
Methylation in Case	3.76E-02 (Median)	Methylation in Control	2.95E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC25A42 in breast cancer			[ 3 ]
Location	TSS1500 (cg22145172)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.21E+00	Statistic Test	p-value:1.18E-03; Z-score:5.20E-01
Methylation in Case	5.08E-02 (Median)	Methylation in Control	4.21E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC25A42 in breast cancer			[ 3 ]
Location	TSS200 (cg23474268)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.17E+00	Statistic Test	p-value:4.28E-03; Z-score:-4.64E-01
Methylation in Case	8.16E-02 (Median)	Methylation in Control	9.56E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC25A42 in breast cancer			[ 3 ]
Location	TSS200 (cg08332492)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.40E+00	Statistic Test	p-value:1.45E-02; Z-score:4.98E-01
Methylation in Case	1.45E-02 (Median)	Methylation in Control	1.03E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC25A42 in breast cancer			[ 3 ]
Location	TSS200 (cg13423282)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.26E+00	Statistic Test	p-value:1.87E-02; Z-score:-3.12E-01
Methylation in Case	3.91E-02 (Median)	Methylation in Control	4.92E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC25A42 in breast cancer			[ 3 ]
Location	Body (cg02595575)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.15E+00	Statistic Test	p-value:3.97E-11; Z-score:1.99E+00
Methylation in Case	2.65E-01 (Median)	Methylation in Control	1.23E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC25A42 in breast cancer			[ 3 ]
Location	Body (cg20141652)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.21E+00	Statistic Test	p-value:1.27E-09; Z-score:1.42E+00
Methylation in Case	4.79E-01 (Median)	Methylation in Control	3.95E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC25A42 in breast cancer			[ 3 ]
Location	Body (cg04661001)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.22E+00	Statistic Test	p-value:4.50E-08; Z-score:2.57E+00
Methylation in Case	7.35E-01 (Median)	Methylation in Control	6.00E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC25A42 in breast cancer			[ 3 ]
Location	Body (cg10665321)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.20E+00	Statistic Test	p-value:2.26E-07; Z-score:1.17E+00
Methylation in Case	5.57E-01 (Median)	Methylation in Control	4.65E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC25A42 in breast cancer			[ 3 ]
Location	Body (cg25612391)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.21E+00	Statistic Test	p-value:8.40E-07; Z-score:2.01E+00
Methylation in Case	6.04E-01 (Median)	Methylation in Control	5.00E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of SLC25A42 in breast cancer			[ 3 ]
Location	Body (cg04460816)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.16E+00	Statistic Test	p-value:1.13E-06; Z-score:1.15E+00
Methylation in Case	5.34E-01 (Median)	Methylation in Control	4.60E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon13	Methylation of SLC25A42 in breast cancer			[ 3 ]
Location	Body (cg11287443)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.08E+00	Statistic Test	p-value:5.31E-06; Z-score:1.26E+00
Methylation in Case	8.29E-01 (Median)	Methylation in Control	7.71E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Renal cell carcinoma	10 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC25A42 in clear cell renal cell carcinoma			[ 4 ]
Location	5'UTR (cg00813603)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.49E+00	Statistic Test	p-value:4.34E-05; Z-score:1.46E+00
Methylation in Case	1.21E-02 (Median)	Methylation in Control	8.15E-03 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC25A42 in clear cell renal cell carcinoma			[ 4 ]
Location	5'UTR (cg01318291)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.07E+00	Statistic Test	p-value:2.28E-02; Z-score:2.88E-01
Methylation in Case	2.15E-02 (Median)	Methylation in Control	2.02E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC25A42 in clear cell renal cell carcinoma			[ 4 ]
Location	TSS1500 (cg22145172)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.42E+00	Statistic Test	p-value:1.71E-04; Z-score:1.12E+00
Methylation in Case	2.93E-02 (Median)	Methylation in Control	2.06E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC25A42 in clear cell renal cell carcinoma			[ 4 ]
Location	TSS200 (cg23474268)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.46E+00	Statistic Test	p-value:7.94E-13; Z-score:1.68E+00
Methylation in Case	4.52E-02 (Median)	Methylation in Control	3.09E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC25A42 in clear cell renal cell carcinoma			[ 4 ]
Location	TSS200 (cg13423282)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.27E+00	Statistic Test	p-value:4.19E-05; Z-score:1.03E+00
Methylation in Case	2.22E-02 (Median)	Methylation in Control	1.75E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC25A42 in clear cell renal cell carcinoma			[ 4 ]
Location	TSS200 (cg08332492)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.15E+00	Statistic Test	p-value:1.47E-04; Z-score:-8.96E-01
Methylation in Case	1.62E-02 (Median)	Methylation in Control	1.86E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC25A42 in clear cell renal cell carcinoma			[ 4 ]
Location	TSS200 (cg18420266)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.13E+00	Statistic Test	p-value:2.30E-03; Z-score:-6.13E-01
Methylation in Case	5.39E-02 (Median)	Methylation in Control	6.09E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC25A42 in clear cell renal cell carcinoma			[ 4 ]
Location	TSS200 (cg22516671)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.20E+00	Statistic Test	p-value:2.45E-02; Z-score:-8.32E-01
Methylation in Case	1.26E-02 (Median)	Methylation in Control	1.51E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC25A42 in clear cell renal cell carcinoma			[ 4 ]
Location	Body (cg04460816)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.06E+00	Statistic Test	p-value:1.79E-02; Z-score:-5.25E-01
Methylation in Case	4.34E-01 (Median)	Methylation in Control	4.62E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC25A42 in clear cell renal cell carcinoma			[ 4 ]
Location	3'UTR (cg02677865)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:2.56E-04; Z-score:-1.40E+00
Methylation in Case	9.37E-01 (Median)	Methylation in Control	9.53E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Colon cancer	10 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC25A42 in colon adenocarcinoma			[ 5 ]
Location	5'UTR (cg03307465)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.71E+00	Statistic Test	p-value:5.84E-09; Z-score:2.63E+00
Methylation in Case	5.56E-01 (Median)	Methylation in Control	2.05E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC25A42 in colon adenocarcinoma			[ 5 ]
Location	TSS1500 (cg07973479)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.25E+00	Statistic Test	p-value:4.84E-05; Z-score:-1.86E+00
Methylation in Case	5.39E-01 (Median)	Methylation in Control	6.72E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC25A42 in colon adenocarcinoma			[ 5 ]
Location	TSS1500 (cg16298016)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.17E+00	Statistic Test	p-value:3.97E-04; Z-score:-2.94E+00
Methylation in Case	6.85E-01 (Median)	Methylation in Control	8.00E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC25A42 in colon adenocarcinoma			[ 5 ]
Location	TSS1500 (cg02319142)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.10E+00	Statistic Test	p-value:3.51E-03; Z-score:-6.92E-01
Methylation in Case	9.61E-02 (Median)	Methylation in Control	1.06E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC25A42 in colon adenocarcinoma			[ 5 ]
Location	TSS200 (cg07581732)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.52E+00	Statistic Test	p-value:2.55E-03; Z-score:1.93E+00
Methylation in Case	3.52E-01 (Median)	Methylation in Control	2.31E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC25A42 in colon adenocarcinoma			[ 5 ]
Location	Body (cg17044311)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.11E+00	Statistic Test	p-value:1.89E-05; Z-score:-3.66E+00
Methylation in Case	7.61E-01 (Median)	Methylation in Control	8.46E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC25A42 in colon adenocarcinoma			[ 5 ]
Location	Body (cg01551177)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.19E+00	Statistic Test	p-value:1.93E-05; Z-score:-3.99E+00
Methylation in Case	6.38E-01 (Median)	Methylation in Control	7.57E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC25A42 in colon adenocarcinoma			[ 5 ]
Location	Body (cg21307155)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.17E+00	Statistic Test	p-value:4.19E-05; Z-score:-1.29E+00
Methylation in Case	3.96E-01 (Median)	Methylation in Control	4.64E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC25A42 in colon adenocarcinoma			[ 5 ]
Location	Body (cg04337188)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.15E+00	Statistic Test	p-value:6.68E-05; Z-score:-3.06E+00
Methylation in Case	6.72E-01 (Median)	Methylation in Control	7.71E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC25A42 in colon adenocarcinoma			[ 5 ]
Location	Body (cg09945896)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.08E+00	Statistic Test	p-value:3.39E-03; Z-score:-2.03E+00
Methylation in Case	7.68E-01 (Median)	Methylation in Control	8.31E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Colorectal cancer	12 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC25A42 in colorectal cancer			[ 6 ]
Location	5'UTR (cg23956760)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:1.20E-06; Z-score:-1.24E+00
Methylation in Case	8.20E-01 (Median)	Methylation in Control	8.63E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC25A42 in colorectal cancer			[ 6 ]
Location	5'UTR (cg00813603)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.10E+00	Statistic Test	p-value:1.10E-03; Z-score:5.26E-01
Methylation in Case	7.08E-02 (Median)	Methylation in Control	6.42E-02 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC25A42 in colorectal cancer			[ 6 ]
Location	5'UTR (cg01318291)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.09E+00	Statistic Test	p-value:3.96E-02; Z-score:6.99E-01
Methylation in Case	9.44E-02 (Median)	Methylation in Control	8.64E-02 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC25A42 in colorectal cancer			[ 6 ]
Location	TSS200 (cg23474268)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.14E+00	Statistic Test	p-value:8.40E-03; Z-score:8.45E-01
Methylation in Case	1.25E-01 (Median)	Methylation in Control	1.10E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC25A42 in colorectal cancer			[ 6 ]
Location	TSS200 (cg08332492)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.19E+00	Statistic Test	p-value:3.91E-02; Z-score:-5.83E-01
Methylation in Case	1.48E-02 (Median)	Methylation in Control	1.75E-02 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC25A42 in colorectal cancer			[ 6 ]
Location	Body (cg04661001)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.27E+00	Statistic Test	p-value:8.67E-10; Z-score:2.25E+00
Methylation in Case	7.42E-01 (Median)	Methylation in Control	5.84E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC25A42 in colorectal cancer			[ 6 ]
Location	Body (cg10665321)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.32E+00	Statistic Test	p-value:5.60E-05; Z-score:7.71E-01
Methylation in Case	1.19E-01 (Median)	Methylation in Control	9.01E-02 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC25A42 in colorectal cancer			[ 6 ]
Location	Body (cg11287443)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:1.59E-04; Z-score:-1.06E+00
Methylation in Case	8.63E-01 (Median)	Methylation in Control	8.93E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC25A42 in colorectal cancer			[ 6 ]
Location	Body (cg02595575)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.16E+00	Statistic Test	p-value:3.99E-03; Z-score:4.38E-01
Methylation in Case	3.10E-02 (Median)	Methylation in Control	2.67E-02 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC25A42 in colorectal cancer			[ 6 ]
Location	Body (cg25612391)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.17E+00	Statistic Test	p-value:8.67E-03; Z-score:1.07E+00
Methylation in Case	4.70E-01 (Median)	Methylation in Control	4.00E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC25A42 in colorectal cancer			[ 6 ]
Location	3'UTR (cg02677865)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:2.15E-02; Z-score:-4.42E-01
Methylation in Case	9.23E-01 (Median)	Methylation in Control	9.29E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC25A42 in hepatocellular carcinoma			[ 7 ]
Location	5'UTR (cg23956760)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.10E+00	Statistic Test	p-value:1.09E-02; Z-score:5.11E-01
Methylation in Case	7.23E-01 (Median)	Methylation in Control	6.55E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC25A42 in hepatocellular carcinoma			[ 7 ]
Location	TSS1500 (cg18426142)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.75E+00	Statistic Test	p-value:3.49E-20; Z-score:-2.23E+00
Methylation in Case	1.92E-01 (Median)	Methylation in Control	3.38E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC25A42 in hepatocellular carcinoma			[ 7 ]
Location	TSS1500 (cg07164211)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.30E+00	Statistic Test	p-value:2.74E-14; Z-score:-8.65E+00
Methylation in Case	6.84E-01 (Median)	Methylation in Control	8.91E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC25A42 in hepatocellular carcinoma			[ 7 ]
Location	TSS1500 (cg22145172)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.44E+00	Statistic Test	p-value:1.08E-06; Z-score:-1.15E+00
Methylation in Case	5.01E-02 (Median)	Methylation in Control	7.23E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC25A42 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg26111881)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.56E+00	Statistic Test	p-value:5.12E-18; Z-score:-4.07E+00
Methylation in Case	4.03E-01 (Median)	Methylation in Control	6.29E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC25A42 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg24358785)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.15E+00	Statistic Test	p-value:2.79E-12; Z-score:1.60E+00
Methylation in Case	7.33E-01 (Median)	Methylation in Control	6.39E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC25A42 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg19478343)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.27E+00	Statistic Test	p-value:4.97E-12; Z-score:-1.41E+01
Methylation in Case	7.60E-01 (Median)	Methylation in Control	9.66E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
HIV infection	11 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC25A42 in HIV infection			[ 8 ]
Location	5'UTR (cg23956760)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.37E+00	Statistic Test	p-value:4.51E-08; Z-score:2.25E+00
Methylation in Case	6.51E-01 (Median)	Methylation in Control	4.76E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC25A42 in HIV infection			[ 8 ]
Location	TSS1500 (cg22145172)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.35E+00	Statistic Test	p-value:2.37E-05; Z-score:1.38E+00
Methylation in Case	8.53E-02 (Median)	Methylation in Control	6.31E-02 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC25A42 in HIV infection			[ 8 ]
Location	TSS1500 (cg07855993)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.12E+00	Statistic Test	p-value:5.80E-03; Z-score:-8.27E-01
Methylation in Case	7.08E-02 (Median)	Methylation in Control	7.91E-02 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC25A42 in HIV infection			[ 8 ]
Location	TSS200 (cg23474268)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.09E+00	Statistic Test	p-value:3.64E-03; Z-score:-6.38E-01
Methylation in Case	9.04E-02 (Median)	Methylation in Control	9.87E-02 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC25A42 in HIV infection			[ 8 ]
Location	TSS200 (cg18420266)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.08E+00	Statistic Test	p-value:5.24E-03; Z-score:5.82E-01
Methylation in Case	7.66E-02 (Median)	Methylation in Control	7.07E-02 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC25A42 in HIV infection			[ 8 ]
Location	Body (cg04661001)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.06E+00	Statistic Test	p-value:1.13E-02; Z-score:1.09E+00
Methylation in Case	9.45E-01 (Median)	Methylation in Control	8.90E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC25A42 in HIV infection			[ 8 ]
Location	Body (cg10665321)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.27E+00	Statistic Test	p-value:2.95E-02; Z-score:8.72E-01
Methylation in Case	3.42E-01 (Median)	Methylation in Control	2.69E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC25A42 in HIV infection			[ 8 ]
Location	Body (cg02595575)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.64E+00	Statistic Test	p-value:3.07E-02; Z-score:8.73E-01
Methylation in Case	7.41E-02 (Median)	Methylation in Control	4.51E-02 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC25A42 in HIV infection			[ 8 ]
Location	Body (cg25612391)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.05E+00	Statistic Test	p-value:3.07E-02; Z-score:8.99E-01
Methylation in Case	9.32E-01 (Median)	Methylation in Control	8.83E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC25A42 in HIV infection			[ 8 ]
Location	Body (cg20141652)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.09E+00	Statistic Test	p-value:4.38E-02; Z-score:6.23E-01
Methylation in Case	3.53E-01 (Median)	Methylation in Control	3.23E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC25A42 in HIV infection			[ 8 ]
Location	Body (cg04460816)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.07E+00	Statistic Test	p-value:4.60E-02; Z-score:6.45E-01
Methylation in Case	4.44E-01 (Median)	Methylation in Control	4.14E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	11 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC25A42 in pancretic ductal adenocarcinoma			[ 9 ]
Location	5'UTR (cg25788793)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.80E+00	Statistic Test	p-value:2.60E-20; Z-score:-3.41E+00
Methylation in Case	1.94E-01 (Median)	Methylation in Control	3.49E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC25A42 in pancretic ductal adenocarcinoma			[ 9 ]
Location	TSS1500 (cg20536716)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.34E+00	Statistic Test	p-value:3.46E-10; Z-score:1.12E+00
Methylation in Case	4.96E-02 (Median)	Methylation in Control	3.71E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC25A42 in pancretic ductal adenocarcinoma			[ 9 ]
Location	TSS1500 (cg20092728)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.12E+00	Statistic Test	p-value:7.84E-05; Z-score:1.48E+00
Methylation in Case	7.78E-01 (Median)	Methylation in Control	6.94E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC25A42 in pancretic ductal adenocarcinoma			[ 9 ]
Location	TSS200 (cg17580331)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.08E+00	Statistic Test	p-value:7.79E-04; Z-score:4.38E-01
Methylation in Case	3.90E-01 (Median)	Methylation in Control	3.63E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC25A42 in pancretic ductal adenocarcinoma			[ 9 ]
Location	Body (cg21380183)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-3.87E+00	Statistic Test	p-value:4.10E-14; Z-score:-2.83E+00
Methylation in Case	1.33E-01 (Median)	Methylation in Control	5.13E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC25A42 in pancretic ductal adenocarcinoma			[ 9 ]
Location	Body (cg18685243)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.16E+00	Statistic Test	p-value:1.47E-13; Z-score:1.59E+00
Methylation in Case	1.53E-01 (Median)	Methylation in Control	7.07E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC25A42 in pancretic ductal adenocarcinoma			[ 9 ]
Location	Body (cg19326876)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.35E+00	Statistic Test	p-value:8.26E-08; Z-score:2.11E+00
Methylation in Case	3.92E-01 (Median)	Methylation in Control	1.66E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC25A42 in pancretic ductal adenocarcinoma			[ 9 ]
Location	Body (cg02042585)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.03E+00	Statistic Test	p-value:5.70E-03; Z-score:3.57E-01
Methylation in Case	8.21E-01 (Median)	Methylation in Control	7.99E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC25A42 in pancretic ductal adenocarcinoma			[ 9 ]
Location	Body (cg06665333)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.02E+00	Statistic Test	p-value:6.23E-03; Z-score:2.96E-01
Methylation in Case	8.59E-01 (Median)	Methylation in Control	8.40E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC25A42 in pancretic ductal adenocarcinoma			[ 9 ]
Location	Body (cg03281154)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:4.92E-02; Z-score:-5.12E-01
Methylation in Case	7.60E-01 (Median)	Methylation in Control	7.83E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC25A42 in pancretic ductal adenocarcinoma			[ 9 ]
Location	3'UTR (cg26826434)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.02E+00	Statistic Test	p-value:3.70E-03; Z-score:8.96E-01
Methylation in Case	8.55E-01 (Median)	Methylation in Control	8.38E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Panic disorder	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC25A42 in panic disorder			[ 10 ]
Location	5'UTR (cg23956760)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-8.10E-01	Statistic Test	p-value:3.07E-02; Z-score:-2.38E-01
Methylation in Case	-6.23E-01 (Median)	Methylation in Control	-5.05E-01 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC25A42 in papillary thyroid cancer			[ 11 ]
Location	5'UTR (cg23956760)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.47E+00	Statistic Test	p-value:5.98E-19; Z-score:2.95E+00
Methylation in Case	6.44E-01 (Median)	Methylation in Control	4.37E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC25A42 in papillary thyroid cancer			[ 11 ]
Location	5'UTR (cg00813603)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.07E+00	Statistic Test	p-value:2.13E-02; Z-score:3.70E-01
Methylation in Case	3.30E-02 (Median)	Methylation in Control	3.10E-02 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC25A42 in papillary thyroid cancer			[ 11 ]
Location	TSS1500 (cg22145172)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.41E+00	Statistic Test	p-value:2.35E-05; Z-score:-1.33E+00
Methylation in Case	1.03E-01 (Median)	Methylation in Control	1.46E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC25A42 in papillary thyroid cancer			[ 11 ]
Location	TSS200 (cg13423282)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:8.15E-03; Z-score:-2.80E-01
Methylation in Case	6.17E-02 (Median)	Methylation in Control	6.50E-02 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC25A42 in papillary thyroid cancer			[ 11 ]
Location	Body (cg11287443)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.07E+00	Statistic Test	p-value:1.12E-08; Z-score:-2.05E+00
Methylation in Case	8.30E-01 (Median)	Methylation in Control	8.85E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC25A42 in papillary thyroid cancer			[ 11 ]
Location	Body (cg10665321)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.03E+00	Statistic Test	p-value:2.36E-02; Z-score:3.89E-01
Methylation in Case	5.97E-01 (Median)	Methylation in Control	5.78E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC25A42 in systemic lupus erythematosus			[ 12 ]
Location	5'UTR (cg01318291)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:9.22E-03; Z-score:-1.54E-01
Methylation in Case	6.79E-02 (Median)	Methylation in Control	6.98E-02 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC25A42 in systemic lupus erythematosus			[ 12 ]
Location	TSS200 (cg23474268)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:7.19E-03; Z-score:-3.57E-02
Methylation in Case	1.23E-01 (Median)	Methylation in Control	1.24E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC25A42 in systemic lupus erythematosus			[ 12 ]
Location	TSS200 (cg18420266)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.01E+00	Statistic Test	p-value:1.48E-02; Z-score:7.92E-02
Methylation in Case	8.16E-02 (Median)	Methylation in Control	8.06E-02 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC25A42 in systemic lupus erythematosus			[ 12 ]
Location	TSS200 (cg22516671)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:3.79E-02; Z-score:-8.82E-02
Methylation in Case	5.59E-02 (Median)	Methylation in Control	5.68E-02 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC25A42 in systemic lupus erythematosus			[ 12 ]
Location	Body (cg10665321)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.06E+00	Statistic Test	p-value:5.91E-03; Z-score:1.49E-01
Methylation in Case	2.34E-01 (Median)	Methylation in Control	2.20E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC25A42 in systemic lupus erythematosus			[ 12 ]
Location	3'UTR (cg02677865)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.00E+00	Statistic Test	p-value:3.11E-02; Z-score:-1.05E-01
Methylation in Case	8.69E-01 (Median)	Methylation in Control	8.72E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC25A42 in lung adenocarcinoma			[ 13 ]
Location	TSS1500 (cg22145172)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.20E+00	Statistic Test	p-value:2.48E-02; Z-score:1.19E+00
Methylation in Case	8.08E-02 (Median)	Methylation in Control	6.73E-02 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC25A42 in lung adenocarcinoma			[ 13 ]
Location	TSS200 (cg13423282)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.11E+00	Statistic Test	p-value:2.66E-02; Z-score:-9.19E-01
Methylation in Case	5.25E-02 (Median)	Methylation in Control	5.86E-02 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC25A42 in lung adenocarcinoma			[ 13 ]
Location	Body (cg10665321)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.24E+00	Statistic Test	p-value:1.04E-03; Z-score:1.69E+00
Methylation in Case	5.13E-01 (Median)	Methylation in Control	4.15E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC25A42 in lung adenocarcinoma			[ 13 ]
Location	Body (cg20141652)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.22E+00	Statistic Test	p-value:2.37E-03; Z-score:2.23E+00
Methylation in Case	4.99E-01 (Median)	Methylation in Control	4.08E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC25A42 in lung adenocarcinoma			[ 13 ]
Location	Body (cg04460816)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.09E+00	Statistic Test	p-value:4.38E-03; Z-score:1.31E+00
Methylation in Case	5.68E-01 (Median)	Methylation in Control	5.20E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC25A42 in lung adenocarcinoma			[ 13 ]
Location	Body (cg02595575)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.02E+00	Statistic Test	p-value:1.34E-02; Z-score:3.83E+00
Methylation in Case	2.11E-01 (Median)	Methylation in Control	1.04E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Prostate cancer	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC25A42 in prostate cancer			[ 14 ]
Location	TSS1500 (cg18783781)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.05E+00	Statistic Test	p-value:4.91E-02; Z-score:1.28E+00
Methylation in Case	9.19E-01 (Median)	Methylation in Control	8.76E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC25A42 in prostate cancer			[ 14 ]
Location	Body (cg05972316)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.96E+00	Statistic Test	p-value:2.07E-02; Z-score:6.07E+00
Methylation in Case	3.55E-01 (Median)	Methylation in Control	1.82E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC25A42 in prostate cancer			[ 14 ]
Location	Body (cg12651599)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.03E+00	Statistic Test	p-value:3.05E-02; Z-score:1.59E+00
Methylation in Case	9.26E-01 (Median)	Methylation in Control	8.98E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Depression	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC25A42 in depression			[ 15 ]
Location	TSS200 (cg08332492)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.06E+00	Statistic Test	p-value:7.66E-03; Z-score:3.83E-01
Methylation in Case	3.15E-02 (Median)	Methylation in Control	2.96E-02 (Median)
Studied Phenotype	Depression[ ICD-11:6A8Z]
Experimental Material	Patient tissue samples
microRNA
Unclear Phenotype	10 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	miR-1224 directly targets SLC25A42			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1224	miRNA Mature ID	miR-1224-3p
miRNA Sequence	CCCCACCUCCUCUCUCCUCAG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon2	miR-1260a directly targets SLC25A42			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1260a	miRNA Mature ID	miR-1260a
miRNA Sequence	AUCCCACCUCUGCCACCA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon3	miR-1260b directly targets SLC25A42			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1260b	miRNA Mature ID	miR-1260b
miRNA Sequence	AUCCCACCACUGCCACCAU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon4	miR-2681 directly targets SLC25A42			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-2681	miRNA Mature ID	miR-2681-3p
miRNA Sequence	UAUCAUGGAGUUGGUAAAGCAC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon5	miR-4433b directly targets SLC25A42			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4433b	miRNA Mature ID	miR-4433b-5p
miRNA Sequence	AUGUCCCACCCCCACUCCUGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon6	miR-532 directly targets SLC25A42			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-532	miRNA Mature ID	miR-532-3p
miRNA Sequence	CCUCCCACACCCAAGGCUUGCA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon7	miR-551b directly targets SLC25A42			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-551b	miRNA Mature ID	miR-551b-5p
miRNA Sequence	GAAAUCAAGCGUGGGUGAGACC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon8	miR-5684 directly targets SLC25A42			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-5684	miRNA Mature ID	miR-5684
miRNA Sequence	AACUCUAGCCUGAGCAACAG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon9	miR-6750 directly targets SLC25A42			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6750	miRNA Mature ID	miR-6750-3p
miRNA Sequence	GAACUCACCCUCUGCUCCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon10	miR-96 directly targets SLC25A42			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-96	miRNA Mature ID	miR-96-3p
miRNA Sequence	AAUCAUGUGCAGUGCCAAUAUG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)

References
1	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2	DNA Methylation Dynamics in Urological Tumors.
3	Genome-wide Scan for Methylation Profiles in Breast Cancer
4	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
5	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
6	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
7	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
8	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
9	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
10	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
11	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
12	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
13	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
14	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
15	DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
16	Genome-wide identification of microRNA targets in human ES cells reveals a role for miR-302 in modulating BMP response. Genes Dev. 2011 Oct 15;25(20):2173-86.
17	Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature. 2009 Jul 23;460(7254):479-86.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence