Detail Information of Epigenetic Regulations
General Information of Drug Transporter (DT) | |||||
---|---|---|---|---|---|
DT ID | DTD0202 Transporter Info | ||||
Gene Name | SLC25A4 | ||||
Transporter Name | Adenine nucleotide translocator 1 | ||||
Gene ID | |||||
UniProt ID | |||||
Epigenetic Regulations of This DT (EGR) | |||||
---|---|---|---|---|---|
Methylation |
|||||
Bladder cancer |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC25A4 in bladder cancer | [ 1 ] | |||
Location |
TSS1500 (cg05996789) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.52E+00 | Statistic Test | p-value:8.12E-10; Z-score:-2.15E+01 | ||
Methylation in Case |
5.69E-01 (Median) | Methylation in Control | 8.64E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC25A4 in bladder cancer | [ 1 ] | |||
Location |
TSS200 (cg13191172) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.15E+00 | Statistic Test | p-value:3.76E-02; Z-score:-1.35E+00 | ||
Methylation in Case |
1.04E-01 (Median) | Methylation in Control | 1.20E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Breast cancer |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC25A4 in breast cancer | [ 2 ] | |||
Location |
TSS1500 (cg05996789) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:3.03E-05; Z-score:-1.05E+00 | ||
Methylation in Case |
8.04E-01 (Median) | Methylation in Control | 8.51E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC25A4 in breast cancer | [ 2 ] | |||
Location |
TSS1500 (cg16667710) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:3.72E-05; Z-score:7.36E-01 | ||
Methylation in Case |
8.91E-01 (Median) | Methylation in Control | 8.73E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC25A4 in breast cancer | [ 2 ] | |||
Location |
Body (cg09109534) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.04E+00 | Statistic Test | p-value:4.54E-03; Z-score:1.15E+00 | ||
Methylation in Case |
8.54E-01 (Median) | Methylation in Control | 8.24E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon4 |
Methylation of SLC25A4 in breast cancer | [ 2 ] | |||
Location |
3'UTR (cg03376062) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:6.74E-05; Z-score:-1.02E+00 | ||
Methylation in Case |
8.98E-01 (Median) | Methylation in Control | 9.44E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Renal cell carcinoma |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC25A4 in clear cell renal cell carcinoma | [ 3 ] | |||
Location |
TSS1500 (cg05996789) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.24E+00 | Statistic Test | p-value:1.16E-02; Z-score:2.84E+00 | ||
Methylation in Case |
9.35E-01 (Median) | Methylation in Control | 7.53E-01 (Median) | ||
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC25A4 in clear cell renal cell carcinoma | [ 3 ] | |||
Location |
Body (cg26817300) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.08E+00 | Statistic Test | p-value:2.38E-04; Z-score:6.59E-01 | ||
Methylation in Case |
1.40E-02 (Median) | Methylation in Control | 1.30E-02 (Median) | ||
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
Experimental Material |
Patient tissue samples | ||||
Colorectal cancer |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC25A4 in colorectal cancer | [ 4 ] | |||
Location |
TSS1500 (cg05996789) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:9.51E-03; Z-score:-5.87E-01 | ||
Methylation in Case |
8.39E-01 (Median) | Methylation in Control | 8.59E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC25A4 in colorectal cancer | [ 4 ] | |||
Location |
1stExon (cg11501976) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.06E+00 | Statistic Test | p-value:1.98E-02; Z-score:5.46E-01 | ||
Methylation in Case |
9.20E-02 (Median) | Methylation in Control | 8.67E-02 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC25A4 in colorectal cancer | [ 4 ] | |||
Location |
Body (cg09109534) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:5.26E-03; Z-score:-6.68E-01 | ||
Methylation in Case |
9.24E-01 (Median) | Methylation in Control | 9.33E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Hepatocellular carcinoma |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC25A4 in hepatocellular carcinoma | [ 5 ] | |||
Location |
TSS1500 (cg16667710) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:9.37E-05; Z-score:-7.43E-01 | ||
Methylation in Case |
7.98E-01 (Median) | Methylation in Control | 8.36E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC25A4 in hepatocellular carcinoma | [ 5 ] | |||
Location |
TSS1500 (cg05996789) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.24E+00 | Statistic Test | p-value:9.97E-03; Z-score:-7.08E-01 | ||
Methylation in Case |
3.98E-01 (Median) | Methylation in Control | 4.93E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC25A4 in hepatocellular carcinoma | [ 5 ] | |||
Location |
Body (cg09109534) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.21E-02; Z-score:-2.89E-01 | ||
Methylation in Case |
8.45E-01 (Median) | Methylation in Control | 8.53E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Papillary thyroid cancer |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC25A4 in papillary thyroid cancer | [ 6 ] | |||
Location |
TSS1500 (cg05996789) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:1.40E-02; Z-score:-1.15E-02 | ||
Methylation in Case |
9.15E-01 (Median) | Methylation in Control | 9.16E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC25A4 in papillary thyroid cancer | [ 6 ] | |||
Location |
TSS200 (cg13191172) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:1.44E-02; Z-score:-4.66E-01 | ||
Methylation in Case |
7.96E-02 (Median) | Methylation in Control | 8.34E-02 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Pancretic ductal adenocarcinoma |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC25A4 in pancretic ductal adenocarcinoma | [ 7 ] | |||
Location |
TSS200 (cg18314695) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:5.26E-08; Z-score:-1.22E+00 | ||
Methylation in Case |
6.99E-01 (Median) | Methylation in Control | 7.70E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC25A4 in pancretic ductal adenocarcinoma | [ 7 ] | |||
Location |
TSS200 (cg22240472) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.40E+00 | Statistic Test | p-value:3.07E-07; Z-score:1.13E+00 | ||
Methylation in Case |
1.87E-01 (Median) | Methylation in Control | 1.34E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC25A4 in pancretic ductal adenocarcinoma | [ 7 ] | |||
Location |
Body (cg06295784) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.33E+00 | Statistic Test | p-value:7.85E-08; Z-score:-1.76E+00 | ||
Methylation in Case |
5.88E-01 (Median) | Methylation in Control | 7.85E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon4 |
Methylation of SLC25A4 in pancretic ductal adenocarcinoma | [ 7 ] | |||
Location |
Body (cg23905542) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.08E+00 | Statistic Test | p-value:8.15E-04; Z-score:3.41E-01 | ||
Methylation in Case |
4.41E-02 (Median) | Methylation in Control | 4.10E-02 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Colon cancer |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC25A4 in colon adenocarcinoma | [ 8 ] | |||
Location |
Body (cg14341131) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.34E+00 | Statistic Test | p-value:6.36E-05; Z-score:-2.24E+00 | ||
Methylation in Case |
3.47E-01 (Median) | Methylation in Control | 4.64E-01 (Median) | ||
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC25A4 in colon adenocarcinoma | [ 8 ] | |||
Location |
Body (cg07705820) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:1.74E-03; Z-score:-1.23E+00 | ||
Methylation in Case |
8.06E-01 (Median) | Methylation in Control | 8.26E-01 (Median) | ||
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
Experimental Material |
Patient tissue samples | ||||
microRNA |
|||||
Unclear Phenotype |
11 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
let-7b directly targets SLC25A4 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
miRNA Stemloop ID |
let-7b | miRNA Mature ID | let-7b-5p | ||
miRNA Sequence |
UGAGGUAGUAGGUUGUGUGGUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon2 |
miR-331 directly targets SLC25A4 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
miRNA Stemloop ID |
miR-331 | miRNA Mature ID | miR-331-3p | ||
miRNA Sequence |
GCCCCUGGGCCUAUCCUAGAA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon3 |
miR-4691 directly targets SLC25A4 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4691 | miRNA Mature ID | miR-4691-5p | ||
miRNA Sequence |
GUCCUCCAGGCCAUGAGCUGCGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon4 |
miR-4711 directly targets SLC25A4 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4711 | miRNA Mature ID | miR-4711-5p | ||
miRNA Sequence |
UGCAUCAGGCCAGAAGACAUGAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon5 |
miR-4775 directly targets SLC25A4 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4775 | miRNA Mature ID | miR-4775 | ||
miRNA Sequence |
UUAAUUUUUUGUUUCGGUCACU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon6 |
miR-4793 directly targets SLC25A4 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4793 | miRNA Mature ID | miR-4793-5p | ||
miRNA Sequence |
ACAUCCUGCUCCACAGGGCAGAGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon7 |
miR-5196 directly targets SLC25A4 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-5196 | miRNA Mature ID | miR-5196-3p | ||
miRNA Sequence |
UCAUCCUCGUCUCCCUCCCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon8 |
miR-590 directly targets SLC25A4 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-590 | miRNA Mature ID | miR-590-3p | ||
miRNA Sequence |
UAAUUUUAUGUAUAAGCUAGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon9 |
miR-6792 directly targets SLC25A4 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6792 | miRNA Mature ID | miR-6792-3p | ||
miRNA Sequence |
CUCCUCCACAGCCCCUGCUCAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon10 |
miR-7112 directly targets SLC25A4 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-7112 | miRNA Mature ID | miR-7112-3p | ||
miRNA Sequence |
UGCAUCACAGCCUUUGGCCCUAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon11 |
miR-92b directly targets SLC25A4 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
miRNA Stemloop ID |
miR-92b | miRNA Mature ID | miR-92b-3p | ||
miRNA Sequence |
UAUUGCACUCGUCCCGGCCUCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.