Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0189 Transporter Info
Gene Name SLC25A28
Transporter Name Mitochondrial iron transporter 2
Gene ID
81894
UniProt ID
Q96A46
Epigenetic Regulations of This DT (EGR)

Methylation

  Bladder cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC25A28 in bladder cancer [ 1 ]

Location

 TSS1500 (cg07281414)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.27E+00 Statistic Test p-value:3.58E-05; Z-score:4.37E+00

Methylation in Case

 7.50E-02 (Median) Methylation in Control 5.92E-02 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC25A28 in bladder cancer [ 1 ]

Location

 TSS1500 (cg05149213)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.58E+00 Statistic Test p-value:1.25E-03; Z-score:-4.13E+00

Methylation in Case

 1.70E-01 (Median) Methylation in Control 2.67E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC25A28 in bladder cancer [ 1 ]

Location

 TSS200 (cg08973675)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.09E+00 Statistic Test p-value:6.04E-03; Z-score:1.47E+00

Methylation in Case

 1.73E-01 (Median) Methylation in Control 1.59E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC25A28 in bladder cancer [ 1 ]

Location

 Body (cg22615255)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.06E+00 Statistic Test p-value:2.12E-03; Z-score:-3.69E+00

Methylation in Case

 8.35E-01 (Median) Methylation in Control 8.81E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC25A28 in bladder cancer [ 1 ]

Location

 3'UTR (cg17652998)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.11E+00 Statistic Test p-value:1.42E-08; Z-score:7.51E+00

Methylation in Case

 8.93E-01 (Median) Methylation in Control 8.02E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC25A28 in breast cancer [ 2 ]

Location

 TSS1500 (cg05149213)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.60E+00 Statistic Test p-value:1.06E-09; Z-score:2.43E+00

Methylation in Case

 3.00E-01 (Median) Methylation in Control 1.88E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC25A28 in breast cancer [ 2 ]

Location

 TSS200 (cg08973675)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.07E+00 Statistic Test p-value:1.58E-02; Z-score:1.73E-01

Methylation in Case

 1.75E-01 (Median) Methylation in Control 1.64E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC25A28 in breast cancer [ 2 ]

Location

 TSS200 (cg26215887)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.26E+00 Statistic Test p-value:1.86E-02; Z-score:6.49E-01

Methylation in Case

 4.61E-02 (Median) Methylation in Control 3.65E-02 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC25A28 in breast cancer [ 2 ]

Location

 TSS200 (cg08733453)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.03E+00 Statistic Test p-value:2.37E-02; Z-score:5.63E-02

Methylation in Case

 2.36E-02 (Median) Methylation in Control 2.29E-02 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC25A28 in breast cancer [ 2 ]

Location

 1stExon (cg16411204)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.15E+00 Statistic Test p-value:1.32E-02; Z-score:-5.01E-01

Methylation in Case

 5.96E-02 (Median) Methylation in Control 6.85E-02 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC25A28 in breast cancer [ 2 ]

Location

 3'UTR (cg17652998)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.02E+00 Statistic Test p-value:9.26E-03; Z-score:3.36E-01

Methylation in Case

 8.49E-01 (Median) Methylation in Control 8.34E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC25A28 in colorectal cancer [ 3 ]

Location

 TSS1500 (cg07281414)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.24E+00 Statistic Test p-value:6.20E-06; Z-score:1.68E+00

Methylation in Case

 1.14E-01 (Median) Methylation in Control 9.16E-02 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC25A28 in colorectal cancer [ 3 ]

Location

 TSS1500 (cg05149213)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.21E+00 Statistic Test p-value:6.09E-04; Z-score:1.10E+00

Methylation in Case

 4.92E-01 (Median) Methylation in Control 4.05E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC25A28 in colorectal cancer [ 3 ]

Location

 TSS1500 (cg26536957)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.21E+00 Statistic Test p-value:2.33E-03; Z-score:9.40E-01

Methylation in Case

 2.51E-01 (Median) Methylation in Control 2.08E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC25A28 in colorectal cancer [ 3 ]

Location

 TSS200 (cg08733453)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.20E+00 Statistic Test p-value:7.43E-03; Z-score:-7.06E-01

Methylation in Case

 2.61E-02 (Median) Methylation in Control 3.14E-02 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC25A28 in colorectal cancer [ 3 ]

Location

 Body (cg04179706)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.41E+00 Statistic Test p-value:8.58E-05; Z-score:-5.60E-01

Methylation in Case

 8.40E-02 (Median) Methylation in Control 1.19E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC25A28 in colorectal cancer [ 3 ]

Location

 Body (cg22615255)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.02E+00 Statistic Test p-value:1.63E-02; Z-score:-4.14E-01

Methylation in Case

 9.19E-01 (Median) Methylation in Control 9.37E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC25A28 in hepatocellular carcinoma [ 4 ]

Location

 TSS1500 (cg05149213)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.45E+00 Statistic Test p-value:9.04E-06; Z-score:-1.61E+00

Methylation in Case

 2.37E-01 (Median) Methylation in Control 3.42E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC25A28 in hepatocellular carcinoma [ 4 ]

Location

 TSS1500 (cg07281414)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.08E+00 Statistic Test p-value:4.04E-04; Z-score:4.15E-01

Methylation in Case

 7.34E-02 (Median) Methylation in Control 6.79E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC25A28 in hepatocellular carcinoma [ 4 ]

Location

 Body (cg22615255)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.01E+00 Statistic Test p-value:9.14E-04; Z-score:-4.29E-01

Methylation in Case

 8.68E-01 (Median) Methylation in Control 8.79E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC25A28 in hepatocellular carcinoma [ 4 ]

Location

 Body (cg04179706)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.09E+00 Statistic Test p-value:4.42E-02; Z-score:-5.23E-01

Methylation in Case

 4.52E-02 (Median) Methylation in Control 4.95E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC25A28 in hepatocellular carcinoma [ 4 ]

Location

 3'UTR (cg17652998)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.03E+00 Statistic Test p-value:1.22E-03; Z-score:8.54E-01

Methylation in Case

 8.60E-01 (Median) Methylation in Control 8.39E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC25A28 in papillary thyroid cancer [ 5 ]

Location

 TSS1500 (cg06608599)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.17E+00 Statistic Test p-value:3.81E-03; Z-score:-6.57E-01

Methylation in Case

 5.19E-02 (Median) Methylation in Control 6.08E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC25A28 in papillary thyroid cancer [ 5 ]

Location

 TSS200 (cg26215887)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.05E+00 Statistic Test p-value:4.85E-04; Z-score:-4.28E-01

Methylation in Case

 7.76E-02 (Median) Methylation in Control 8.16E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC25A28 in papillary thyroid cancer [ 5 ]

Location

 TSS200 (cg08973675)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.07E+00 Statistic Test p-value:1.12E-02; Z-score:-6.17E-01

Methylation in Case

 1.84E-01 (Median) Methylation in Control 1.97E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC25A28 in papillary thyroid cancer [ 5 ]

Location

 Body (cg05778706)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.14E+00 Statistic Test p-value:9.59E-06; Z-score:-8.26E-01

Methylation in Case

 4.52E-02 (Median) Methylation in Control 5.16E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC25A28 in papillary thyroid cancer [ 5 ]

Location

 Body (cg04179706)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.12E+00 Statistic Test p-value:8.44E-04; Z-score:-5.39E-01

Methylation in Case

 4.88E-02 (Median) Methylation in Control 5.48E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC25A28 in clear cell renal cell carcinoma [ 6 ]

Location

 TSS200 (cg18038666)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.08E+00 Statistic Test p-value:1.07E-02; Z-score:3.34E-01

Methylation in Case

 2.93E-02 (Median) Methylation in Control 2.72E-02 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC25A28 in clear cell renal cell carcinoma [ 6 ]

Location

 TSS200 (cg08973675)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.26E+00 Statistic Test p-value:3.38E-02; Z-score:-5.71E-01

Methylation in Case

 9.40E-02 (Median) Methylation in Control 1.18E-01 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC25A28 in clear cell renal cell carcinoma [ 6 ]

Location

 Body (cg04179706)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.07E+00 Statistic Test p-value:1.21E-02; Z-score:3.41E-01

Methylation in Case

 1.38E-02 (Median) Methylation in Control 1.30E-02 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Colon cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC25A28 in colon adenocarcinoma [ 7 ]

Location

 TSS200 (cg17714025)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.12E+00 Statistic Test p-value:1.63E-03; Z-score:5.27E-01

Methylation in Case

 4.54E-01 (Median) Methylation in Control 4.04E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC25A28 in colon adenocarcinoma [ 7 ]

Location

 Body (cg12477050)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.12E+00 Statistic Test p-value:4.91E-03; Z-score:2.30E+00

Methylation in Case

 7.04E-01 (Median) Methylation in Control 6.28E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC25A28 in colon adenocarcinoma [ 7 ]

Location

 3'UTR (cg15600751)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.13E+00 Statistic Test p-value:1.86E-03; Z-score:-1.59E+00

Methylation in Case

 4.69E-01 (Median) Methylation in Control 5.32E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Panic disorder

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC25A28 in panic disorder [ 8 ]

Location

 TSS200 (cg08973675)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-8.99E-01 Statistic Test p-value:8.81E-03; Z-score:-5.71E-01

Methylation in Case

 -2.47E+00 (Median) Methylation in Control -2.22E+00 (Median)

Studied Phenotype

 Panic disorder[ ICD-11:6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC25A28 in panic disorder [ 8 ]

Location

 1stExon (cg16411204)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:9.65E-01 Statistic Test p-value:8.43E-03; Z-score:5.77E-01

Methylation in Case

 -4.64E+00 (Median) Methylation in Control -4.81E+00 (Median)

Studied Phenotype

 Panic disorder[ ICD-11:6B01]

Experimental Material

 Patient tissue samples

  Prostate cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC25A28 in prostate cancer [ 9 ]

Location

 TSS200 (cg19914607)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:2.91E+00 Statistic Test p-value:2.98E-02; Z-score:9.14E+00

Methylation in Case

 2.27E-01 (Median) Methylation in Control 7.77E-02 (Median)

Studied Phenotype

 Prostate cancer[ ICD-11:2C82]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC25A28 in pancretic ductal adenocarcinoma [ 10 ]

Location

 Body (cg00123181)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.07E+00 Statistic Test p-value:1.91E-03; Z-score:8.76E-01

Methylation in Case

 8.08E-01 (Median) Methylation in Control 7.56E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC25A28 in pancretic ductal adenocarcinoma [ 10 ]

Location

 Body (cg13373897)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.01E+00 Statistic Test p-value:3.07E-03; Z-score:5.84E-01

Methylation in Case

 9.67E-01 (Median) Methylation in Control 9.61E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC25A28 in pancretic ductal adenocarcinoma [ 10 ]

Location

 Body (cg07703976)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.05E+00 Statistic Test p-value:4.51E-03; Z-score:5.97E-01

Methylation in Case

 8.64E-01 (Median) Methylation in Control 8.21E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC25A28 in pancretic ductal adenocarcinoma [ 10 ]

Location

 Body (cg08490220)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.08E+00 Statistic Test p-value:5.58E-03; Z-score:-8.37E-01

Methylation in Case

 6.72E-01 (Median) Methylation in Control 7.28E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC25A28 in pancretic ductal adenocarcinoma [ 10 ]

Location

 Body (cg07546508)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.14E+00 Statistic Test p-value:8.33E-03; Z-score:-9.08E-01

Methylation in Case

 6.36E-01 (Median) Methylation in Control 7.23E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

          23 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 miR-154 directly targets SLC25A28 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-154 miRNA Mature ID miR-154-5p

miRNA Sequence

 UAGGUUAUCCGUGUUGCCUUCG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon2

 miR-17 directly targets SLC25A28 [ 12 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-17 miRNA Mature ID miR-17-5p

miRNA Sequence

 CAAAGUGCUUACAGUGCAGGUAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon3

 miR-185 directly targets SLC25A28 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-185 miRNA Mature ID miR-185-5p

miRNA Sequence

 UGGAGAGAAAGGCAGUUCCUGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon4

 miR-18a directly targets SLC25A28 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-18a miRNA Mature ID miR-18a-5p

miRNA Sequence

 UAAGGUGCAUCUAGUGCAGAUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon5

 miR-18b directly targets SLC25A28 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-18b miRNA Mature ID miR-18b-5p

miRNA Sequence

 UAAGGUGCAUCUAGUGCAGUUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon6

 miR-1972 directly targets SLC25A28 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1972 miRNA Mature ID miR-1972

miRNA Sequence

 UCAGGCCAGGCACAGUGGCUCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon7

 miR-20a directly targets SLC25A28 [ 12 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-20a miRNA Mature ID miR-20a-5p

miRNA Sequence

 UAAAGUGCUUAUAGUGCAGGUAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon8

 miR-2392 directly targets SLC25A28 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-2392 miRNA Mature ID miR-2392

miRNA Sequence

 UAGGAUGGGGGUGAGAGGUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon9

 miR-26b directly targets SLC25A28 [ 13 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-26b miRNA Mature ID miR-26b-5p

miRNA Sequence

 UUCAAGUAAUUCAGGAUAGGU

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon10

 miR-377 directly targets SLC25A28 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-377 miRNA Mature ID miR-377-5p

miRNA Sequence

 AGAGGUUGCCCUUGGUGAAUUC

miRNA Target Type

 Direct

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon11

 miR-4306 directly targets SLC25A28 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4306 miRNA Mature ID miR-4306

miRNA Sequence

 UGGAGAGAAAGGCAGUA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon12

 miR-4534 directly targets SLC25A28 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4534 miRNA Mature ID miR-4534

miRNA Sequence

 GGAUGGAGGAGGGGUCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon13

 miR-4644 directly targets SLC25A28 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4644 miRNA Mature ID miR-4644

miRNA Sequence

 UGGAGAGAGAAAAGAGACAGAAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon14

 miR-4650 directly targets SLC25A28 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4650 miRNA Mature ID miR-4650-5p

miRNA Sequence

 UCAGGCCUCUUUCUACCUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon15

 miR-4735 directly targets SLC25A28 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4735 miRNA Mature ID miR-4735-3p

miRNA Sequence

 AAAGGUGCUCAAAUUAGACAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon16

 miR-4769 directly targets SLC25A28 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4769 miRNA Mature ID miR-4769-5p

miRNA Sequence

 GGUGGGAUGGAGAGAAGGUAUGAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon17

 miR-5192 directly targets SLC25A28 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5192 miRNA Mature ID miR-5192

miRNA Sequence

 AGGAGAGUGGAUUCCAGGUGGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon18

 miR-655 directly targets SLC25A28 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-655 miRNA Mature ID miR-655-5p

miRNA Sequence

 AGAGGUUAUCCGUGUUAUGUUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon19

 miR-6758 directly targets SLC25A28 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6758 miRNA Mature ID miR-6758-5p

miRNA Sequence

 UAGAGAGGGGAAGGAUGUGAUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon20

 miR-6840 directly targets SLC25A28 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6840 miRNA Mature ID miR-6840-3p

miRNA Sequence

 GCCCAGGACUUUGUGCGGGGUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon21

 miR-6856 directly targets SLC25A28 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6856 miRNA Mature ID miR-6856-5p

miRNA Sequence

 AAGAGAGGAGCAGUGGUGCUGUGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon22

 miR-6894 directly targets SLC25A28 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6894 miRNA Mature ID miR-6894-5p

miRNA Sequence

 AGGAGGAUGGAGAGCUGGGCCAGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon23

 miR-8082 directly targets SLC25A28 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-8082 miRNA Mature ID miR-8082

miRNA Sequence

 UGAUGGAGCUGGGAAUACUCUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 DNA Methylation Dynamics in Urological Tumors.
2 Genome-wide Scan for Methylation Profiles in Breast Cancer
3 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
4 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
5 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
6 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
7 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
8 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
9 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
10 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
11 In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio. 2013 Apr 16;4(2):e000193.
12 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
13 MicroRNA target prediction by expression analysis of host genes. Genome Res. 2009 Mar;19(3):481-90.
14 Epigenetic regulation of the DLK1-MEG3 microRNA cluster in human type 2 diabetic islets. Cell Metab. 2014 Jan 7;19(1):135-45.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.