Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0186 Transporter Info
Gene Name	SLC25A25
Transporter Name	Calcium-binding mitochondrial carrier protein SCaMC-2
Gene ID	114789
UniProt ID	Q6KCM7

Epigenetic Regulations of This DT (EGR)
Methylation
Atypical teratoid rhabdoid tumor	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC25A25 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg14039237)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.00E+00	Statistic Test	p-value:4.23E-02; Z-score:-6.75E-03
Methylation in Case	1.35E-01 (Median)	Methylation in Control	1.35E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Bladder cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC25A25 in bladder cancer			[ 2 ]
Location	Body (cg14039237)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.61E+00	Statistic Test	p-value:1.54E-08; Z-score:7.00E+00
Methylation in Case	5.21E-01 (Median)	Methylation in Control	1.99E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Breast cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC25A25 in breast cancer			[ 3 ]
Location	Body (cg14039237)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.58E+00	Statistic Test	p-value:7.25E-09; Z-score:-1.96E+00
Methylation in Case	1.77E-01 (Median)	Methylation in Control	2.79E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Colorectal cancer	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC25A25 in colorectal cancer			[ 4 ]
Location	Body (cg14039237)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.13E+00	Statistic Test	p-value:9.72E-03; Z-score:-6.63E-01
Methylation in Case	5.16E-01 (Median)	Methylation in Control	5.84E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC25A25 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg23244463)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.87E+00	Statistic Test	p-value:7.23E-20; Z-score:-6.60E+00
Methylation in Case	4.13E-01 (Median)	Methylation in Control	7.74E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC25A25 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg14039237)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.40E+00	Statistic Test	p-value:2.27E-03; Z-score:-1.39E+00
Methylation in Case	1.80E-01 (Median)	Methylation in Control	2.52E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
HIV infection	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC25A25 in HIV infection			[ 6 ]
Location	Body (cg14039237)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.65E+00	Statistic Test	p-value:2.32E-08; Z-score:3.25E+00
Methylation in Case	2.45E-01 (Median)	Methylation in Control	1.48E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC25A25 in lung adenocarcinoma			[ 7 ]
Location	Body (cg14039237)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.30E+00	Statistic Test	p-value:2.51E-03; Z-score:-2.03E+00
Methylation in Case	3.66E-01 (Median)	Methylation in Control	4.74E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Prostate cancer	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC25A25 in prostate cancer			[ 8 ]
Location	Body (cg20050113)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.50E+00	Statistic Test	p-value:3.85E-02; Z-score:-5.37E+00
Methylation in Case	2.65E-01 (Median)	Methylation in Control	3.97E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Craniopharyngioma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Moderate hypermethylation of SLC25A25 in craniopharyngioma than that in healthy individual
Studied Phenotype	Craniopharyngioma [ICD-11:2F9A]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:0.000636017; Fold-change:0.240133631; Z-score:1.112959154
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Hemangioblastoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Moderate hypermethylation of SLC25A25 in hemangioblastoma than that in healthy individual
Studied Phenotype	Hemangioblastoma [ICD-11:2F7C]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:0.046008131; Fold-change:0.204745563; Z-score:0.919189537
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Lymphoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Moderate hypermethylation of SLC25A25 in lymphoma than that in healthy individual
Studied Phenotype	Lymphoma [ICD-11:2B30]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:9.85E-15; Fold-change:0.298593537; Z-score:1.60342923
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Diffuse midline glioma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Moderate hypomethylation of SLC25A25 in diffuse midline glioma than that in healthy individual
Studied Phenotype	Diffuse midline glioma [ICD-11:2A00.0Z]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:1.29E-16; Fold-change:-0.242426077; Z-score:-1.248312192
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Esthesioneuroblastoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Moderate hypomethylation of SLC25A25 in esthesioneuroblastoma than that in healthy individual
Studied Phenotype	Esthesioneuroblastoma [ICD-11:2D50.1]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:6.24E-10; Fold-change:-0.280126047; Z-score:-1.227627506
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Glioblastoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Moderate hypomethylation of SLC25A25 in glioblastoma than that in healthy individual
Studied Phenotype	Glioblastoma [ICD-11:2A00.00]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:1.48E-08; Fold-change:-0.231820603; Z-score:-1.07620511
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Low grade glioma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Moderate hypomethylation of SLC25A25 in low grade glioma than that in healthy individual
Studied Phenotype	Low grade glioma [ICD-11:2A00.0Z]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:5.38E-24; Fold-change:-0.219668313; Z-score:-1.139902203
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Malignant astrocytoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Moderate hypomethylation of SLC25A25 in malignant astrocytoma than that in healthy individual
Studied Phenotype	Malignant astrocytoma [ICD-11:2A00.12]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:5.72E-31; Fold-change:-0.299042398; Z-score:-1.552532589
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Cerebellar liponeurocytoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypomethylation of SLC25A25 in cerebellar liponeurocytoma than that in healthy individual
Studied Phenotype	Cerebellar liponeurocytoma [ICD-11:2A00.0Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:6.96E-10; Fold-change:-0.714044903; Z-score:-35.06883413
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
microRNA
Unclear Phenotype	34 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	miR-1236 directly targets SLC25A25			[ 9 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1236	miRNA Mature ID	miR-1236-3p
miRNA Sequence	CCUCUUCCCCUUGUCUCUCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon2	miR-1271 directly targets SLC25A25			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1271	miRNA Mature ID	miR-1271-5p
miRNA Sequence	CUUGGCACCUAGCAAGCACUCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon3	miR-143 directly targets SLC25A25			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-143	miRNA Mature ID	miR-143-3p
miRNA Sequence	UGAGAUGAAGCACUGUAGCUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon4	miR-181a directly targets SLC25A25			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-181a	miRNA Mature ID	miR-181a-5p
miRNA Sequence	AACAUUCAACGCUGUCGGUGAGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon5	miR-181b directly targets SLC25A25			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-181b	miRNA Mature ID	miR-181b-5p
miRNA Sequence	AACAUUCAUUGCUGUCGGUGGGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon6	miR-181c directly targets SLC25A25			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-181c	miRNA Mature ID	miR-181c-5p
miRNA Sequence	AACAUUCAACCUGUCGGUGAGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon7	miR-181d directly targets SLC25A25			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-181d	miRNA Mature ID	miR-181d-5p
miRNA Sequence	AACAUUCAUUGUUGUCGGUGGGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon8	miR-183 directly targets SLC25A25			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-183	miRNA Mature ID	miR-183-5p
miRNA Sequence	UAUGGCACUGGUAGAAUUCACU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon9	miR-1972 directly targets SLC25A25			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1972	miRNA Mature ID	miR-1972
miRNA Sequence	UCAGGCCAGGCACAGUGGCUCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon10	miR-205 directly targets SLC25A25			[ 9 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-205	miRNA Mature ID	miR-205-5p
miRNA Sequence	UCCUUCAUUCCACCGGAGUCUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon11	miR-27a directly targets SLC25A25			[ 9 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-27a	miRNA Mature ID	miR-27a-3p
miRNA Sequence	UUCACAGUGGCUAAGUUCCGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon12	miR-27b directly targets SLC25A25			[ 9 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-27b	miRNA Mature ID	miR-27b-3p
miRNA Sequence	UUCACAGUGGCUAAGUUCUGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon13	miR-3124 directly targets SLC25A25			[ 9 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3124	miRNA Mature ID	miR-3124-3p
miRNA Sequence	ACUUUCCUCACUCCCGUGAAGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon14	miR-3660 directly targets SLC25A25			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3660	miRNA Mature ID	miR-3660
miRNA Sequence	ACUGACAGGAGAGCAUUUUGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon15	miR-378a directly targets SLC25A25			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-378a	miRNA Mature ID	miR-378a-5p
miRNA Sequence	CUCCUGACUCCAGGUCCUGUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon16	miR-4262 directly targets SLC25A25			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4262	miRNA Mature ID	miR-4262
miRNA Sequence	GACAUUCAGACUACCUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon17	miR-4267 directly targets SLC25A25			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4267	miRNA Mature ID	miR-4267
miRNA Sequence	UCCAGCUCGGUGGCAC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon18	miR-4457 directly targets SLC25A25			[ 9 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4457	miRNA Mature ID	miR-4457
miRNA Sequence	UCACAAGGUAUUGACUGGCGUA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon19	miR-4526 directly targets SLC25A25			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4526	miRNA Mature ID	miR-4526
miRNA Sequence	GCUGACAGCAGGGCUGGCCGCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon20	miR-4770 directly targets SLC25A25			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4770	miRNA Mature ID	miR-4770
miRNA Sequence	UGAGAUGACACUGUAGCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon21	miR-4793 directly targets SLC25A25			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4793	miRNA Mature ID	miR-4793-5p
miRNA Sequence	ACAUCCUGCUCCACAGGGCAGAGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon22	miR-501 directly targets SLC25A25			[ 9 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-501	miRNA Mature ID	miR-501-5p
miRNA Sequence	AAUCCUUUGUCCCUGGGUGAGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon23	miR-513a directly targets SLC25A25			[ 9 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-513a	miRNA Mature ID	miR-513a-5p
miRNA Sequence	UUCACAGGGAGGUGUCAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon24	miR-604 directly targets SLC25A25			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-604	miRNA Mature ID	miR-604
miRNA Sequence	AGGCUGCGGAAUUCAGGAC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon25	miR-6088 directly targets SLC25A25			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6088	miRNA Mature ID	miR-6088
miRNA Sequence	AGAGAUGAAGCGGGGGGGCG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon26	miR-647 directly targets SLC25A25			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-647	miRNA Mature ID	miR-647
miRNA Sequence	GUGGCUGCACUCACUUCCUUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon27	miR-670 directly targets SLC25A25			[ 9 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-670	miRNA Mature ID	miR-670-3p
miRNA Sequence	UUUCCUCAUAUUCAUUCAGGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon28	miR-6780a directly targets SLC25A25			[ 9 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6780a	miRNA Mature ID	miR-6780a-3p
miRNA Sequence	CUCCUCUGUUUUCUUUCCUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon29	miR-6881 directly targets SLC25A25			[ 9 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6881	miRNA Mature ID	miR-6881-3p
miRNA Sequence	AUCCUCUUUCGUCCUUCCCACU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon30	miR-7111 directly targets SLC25A25			[ 9 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-7111	miRNA Mature ID	miR-7111-3p
miRNA Sequence	AUCCUCUCUUCCCUCCUCCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon31	miR-8064 directly targets SLC25A25			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-8064	miRNA Mature ID	miR-8064
miRNA Sequence	AGCACACUGAGCGAGCGGAC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon32	miR-877 directly targets SLC25A25			[ 9 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-877	miRNA Mature ID	miR-877-3p
miRNA Sequence	UCCUCUUCUCCCUCCUCCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon33	miR-889 directly targets SLC25A25			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-889	miRNA Mature ID	miR-889-5p
miRNA Sequence	AAUGGCUGUCCGUAGUAUGGUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon34	miR-96 directly targets SLC25A25			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-96	miRNA Mature ID	miR-96-5p
miRNA Sequence	UUUGGCACUAGCACAUUUUUGCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human

References
1	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2	DNA Methylation Dynamics in Urological Tumors.
3	Genome-wide Scan for Methylation Profiles in Breast Cancer
4	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
5	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
6	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
7	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
8	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
9	Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
10	In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio. 2013 Apr 16;4(2):e000193.
11	The Landscape of microRNA Targeting in Prostate Cancer Defined by AGO-PAR-CLIP. Neoplasia. 2016 Jun;18(6):356-70.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence