General Information of Drug Transporter (DT)
DT ID DTD0185 Transporter Info
Gene Name SLC25A24
Transporter Name Calcium-binding mitochondrial carrier protein SCaMC-1
Gene ID
29957
UniProt ID
Q6NUK1
Epigenetic Regulations of This DT (EGR)

Methylation

  Bladder cancer

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A24 in bladder cancer [ 1 ]

Location

TSS1500 (cg17297328)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-3.83E+00 Statistic Test p-value:1.08E-04; Z-score:-3.86E+00

Methylation in Case

6.85E-02 (Median) Methylation in Control 2.63E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A24 in bladder cancer [ 1 ]

Location

TSS1500 (cg00999623)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.19E+00 Statistic Test p-value:1.79E-03; Z-score:-2.05E+00

Methylation in Case

1.58E-01 (Median) Methylation in Control 1.89E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC25A24 in bladder cancer [ 1 ]

Location

TSS1500 (cg23962285)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.34E+00 Statistic Test p-value:1.15E-02; Z-score:-1.56E+00

Methylation in Case

3.38E-02 (Median) Methylation in Control 4.52E-02 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC25A24 in bladder cancer [ 1 ]

Location

TSS1500 (cg23050784)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.54E+00 Statistic Test p-value:3.60E-02; Z-score:-1.54E+00

Methylation in Case

4.03E-02 (Median) Methylation in Control 6.20E-02 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Breast cancer

           6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A24 in breast cancer [ 2 ]

Location

TSS1500 (cg00999623)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.17E+00 Statistic Test p-value:9.11E-04; Z-score:-4.96E-01

Methylation in Case

1.14E-01 (Median) Methylation in Control 1.34E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A24 in breast cancer [ 2 ]

Location

TSS1500 (cg09214920)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.21E+00 Statistic Test p-value:2.22E-02; Z-score:-3.44E-01

Methylation in Case

5.52E-02 (Median) Methylation in Control 6.66E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC25A24 in breast cancer [ 2 ]

Location

TSS1500 (cg23962285)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.17E+00 Statistic Test p-value:2.30E-02; Z-score:-5.25E-01

Methylation in Case

3.26E-02 (Median) Methylation in Control 3.83E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC25A24 in breast cancer [ 2 ]

Location

TSS200 (cg04220635)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:1.16E-02; Z-score:-3.36E-01

Methylation in Case

6.79E-02 (Median) Methylation in Control 7.21E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC25A24 in breast cancer [ 2 ]

Location

Body (cg24323958)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.73E+00 Statistic Test p-value:1.14E-07; Z-score:1.80E+00

Methylation in Case

1.94E-01 (Median) Methylation in Control 1.12E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC25A24 in breast cancer [ 2 ]

Location

Body (cg00971228)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:2.51E-04; Z-score:-7.60E-01

Methylation in Case

8.82E-01 (Median) Methylation in Control 8.94E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Renal cell carcinoma

           5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A24 in clear cell renal cell carcinoma [ 3 ]

Location

TSS1500 (cg17297328)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.60E+00 Statistic Test p-value:1.68E-14; Z-score:-3.52E+00

Methylation in Case

8.57E-02 (Median) Methylation in Control 2.23E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A24 in clear cell renal cell carcinoma [ 3 ]

Location

TSS1500 (cg23050784)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.21E+00 Statistic Test p-value:5.40E-03; Z-score:-7.07E-01

Methylation in Case

2.31E-02 (Median) Methylation in Control 2.79E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC25A24 in clear cell renal cell carcinoma [ 3 ]

Location

TSS1500 (cg00999623)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.09E+00 Statistic Test p-value:2.49E-02; Z-score:4.14E-01

Methylation in Case

6.76E-02 (Median) Methylation in Control 6.23E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC25A24 in clear cell renal cell carcinoma [ 3 ]

Location

TSS200 (cg04220635)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.14E+00 Statistic Test p-value:8.99E-03; Z-score:5.41E-01

Methylation in Case

2.69E-02 (Median) Methylation in Control 2.35E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC25A24 in clear cell renal cell carcinoma [ 3 ]

Location

Body (cg14662970)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:5.94E-03; Z-score:4.77E-01

Methylation in Case

1.87E-02 (Median) Methylation in Control 1.77E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Colon cancer

           5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A24 in colon adenocarcinoma [ 4 ]

Location

TSS1500 (cg07337598)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.19E+00 Statistic Test p-value:1.35E-03; Z-score:-1.59E+00

Methylation in Case

4.93E-01 (Median) Methylation in Control 5.89E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A24 in colon adenocarcinoma [ 4 ]

Location

TSS200 (cg24084363)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.32E+00 Statistic Test p-value:9.42E-04; Z-score:1.52E+00

Methylation in Case

8.76E-02 (Median) Methylation in Control 6.62E-02 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC25A24 in colon adenocarcinoma [ 4 ]

Location

Body (cg10791541)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.60E+00 Statistic Test p-value:1.98E-09; Z-score:-2.03E+00

Methylation in Case

3.08E-01 (Median) Methylation in Control 4.94E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC25A24 in colon adenocarcinoma [ 4 ]

Location

Body (cg14285937)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:8.45E-04; Z-score:-2.04E+00

Methylation in Case

9.53E-01 (Median) Methylation in Control 9.63E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC25A24 in colon adenocarcinoma [ 4 ]

Location

Body (cg14655994)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:3.54E-03; Z-score:-1.60E+00

Methylation in Case

6.03E-01 (Median) Methylation in Control 6.57E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Colorectal cancer

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A24 in colorectal cancer [ 5 ]

Location

TSS1500 (cg00999623)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.08E+00 Statistic Test p-value:6.45E-03; Z-score:-3.25E-01

Methylation in Case

1.46E-01 (Median) Methylation in Control 1.57E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A24 in colorectal cancer [ 5 ]

Location

TSS1500 (cg09214920)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.13E+00 Statistic Test p-value:4.73E-02; Z-score:-3.33E-01

Methylation in Case

1.05E-01 (Median) Methylation in Control 1.18E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Hepatocellular carcinoma

         10 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A24 in hepatocellular carcinoma [ 6 ]

Location

TSS1500 (cg09214920)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.08E+00 Statistic Test p-value:3.81E-04; Z-score:3.12E-01

Methylation in Case

8.29E-02 (Median) Methylation in Control 7.70E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A24 in hepatocellular carcinoma [ 6 ]

Location

TSS1500 (cg23962285)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.38E+00 Statistic Test p-value:4.15E-04; Z-score:7.62E-01

Methylation in Case

1.38E-01 (Median) Methylation in Control 9.97E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC25A24 in hepatocellular carcinoma [ 6 ]

Location

TSS1500 (cg21421408)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.09E+00 Statistic Test p-value:3.04E-03; Z-score:3.93E-01

Methylation in Case

5.48E-02 (Median) Methylation in Control 5.04E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC25A24 in hepatocellular carcinoma [ 6 ]

Location

TSS200 (cg16600889)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.12E+00 Statistic Test p-value:3.85E-06; Z-score:3.33E-01

Methylation in Case

4.40E-02 (Median) Methylation in Control 3.93E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC25A24 in hepatocellular carcinoma [ 6 ]

Location

TSS200 (cg04220635)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.32E+00 Statistic Test p-value:8.41E-06; Z-score:1.21E+00

Methylation in Case

1.04E-01 (Median) Methylation in Control 7.87E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC25A24 in hepatocellular carcinoma [ 6 ]

Location

Body (cg07185425)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.56E+00 Statistic Test p-value:2.68E-18; Z-score:-8.38E+00

Methylation in Case

5.07E-01 (Median) Methylation in Control 7.93E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC25A24 in hepatocellular carcinoma [ 6 ]

Location

Body (cg08294044)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.69E+00 Statistic Test p-value:8.86E-17; Z-score:-1.33E+01

Methylation in Case

5.38E-01 (Median) Methylation in Control 9.11E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC25A24 in hepatocellular carcinoma [ 6 ]

Location

Body (cg08149333)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.20E+00 Statistic Test p-value:5.06E-05; Z-score:4.15E-01

Methylation in Case

7.49E-02 (Median) Methylation in Control 6.24E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC25A24 in hepatocellular carcinoma [ 6 ]

Location

Body (cg14662970)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.28E+00 Statistic Test p-value:1.40E-04; Z-score:4.49E-01

Methylation in Case

3.55E-02 (Median) Methylation in Control 2.76E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC25A24 in hepatocellular carcinoma [ 6 ]

Location

Body (cg24323958)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.30E+00 Statistic Test p-value:3.58E-04; Z-score:-1.41E+00

Methylation in Case

3.05E-01 (Median) Methylation in Control 3.97E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  HIV infection

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A24 in HIV infection [ 7 ]

Location

TSS1500 (cg17297328)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.62E+00 Statistic Test p-value:1.01E-06; Z-score:1.88E+00

Methylation in Case

1.22E-01 (Median) Methylation in Control 7.57E-02 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A24 in HIV infection [ 7 ]

Location

Body (cg24323958)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.54E+00 Statistic Test p-value:6.83E-06; Z-score:2.46E+00

Methylation in Case

4.94E-01 (Median) Methylation in Control 3.21E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Lung adenocarcinoma

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A24 in lung adenocarcinoma [ 8 ]

Location

TSS1500 (cg17297328)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.67E+00 Statistic Test p-value:4.00E-03; Z-score:-2.19E+00

Methylation in Case

2.05E-01 (Median) Methylation in Control 3.43E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A24 in lung adenocarcinoma [ 8 ]

Location

Body (cg24323958)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.66E+00 Statistic Test p-value:6.43E-03; Z-score:3.29E+00

Methylation in Case

3.26E-01 (Median) Methylation in Control 1.97E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Pancretic ductal adenocarcinoma

           6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A24 in pancretic ductal adenocarcinoma [ 9 ]

Location

TSS1500 (cg03434847)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:5.14E-05; Z-score:1.41E-01

Methylation in Case

6.86E-02 (Median) Methylation in Control 6.62E-02 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A24 in pancretic ductal adenocarcinoma [ 9 ]

Location

TSS1500 (cg06631310)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:8.05E-03; Z-score:-1.78E-01

Methylation in Case

4.55E-01 (Median) Methylation in Control 4.63E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC25A24 in pancretic ductal adenocarcinoma [ 9 ]

Location

TSS200 (cg07011163)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.89E+00 Statistic Test p-value:5.35E-06; Z-score:-1.15E+00

Methylation in Case

1.63E-01 (Median) Methylation in Control 3.07E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC25A24 in pancretic ductal adenocarcinoma [ 9 ]

Location

TSS200 (cg10336600)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.12E+00 Statistic Test p-value:7.59E-03; Z-score:-3.23E-01

Methylation in Case

9.01E-02 (Median) Methylation in Control 1.01E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC25A24 in pancretic ductal adenocarcinoma [ 9 ]

Location

Body (cg00304388)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:3.57E+00 Statistic Test p-value:4.74E-26; Z-score:4.10E+00

Methylation in Case

2.49E-01 (Median) Methylation in Control 6.98E-02 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC25A24 in pancretic ductal adenocarcinoma [ 9 ]

Location

Body (cg26758427)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:2.60E-03; Z-score:-2.92E-01

Methylation in Case

8.68E-01 (Median) Methylation in Control 8.73E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

           5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A24 in papillary thyroid cancer [ 10 ]

Location

TSS1500 (cg17297328)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.41E+00 Statistic Test p-value:7.40E-11; Z-score:-1.45E+00

Methylation in Case

1.47E-01 (Median) Methylation in Control 2.06E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A24 in papillary thyroid cancer [ 10 ]

Location

TSS1500 (cg23962285)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.19E+00 Statistic Test p-value:2.43E-07; Z-score:-1.06E+00

Methylation in Case

5.78E-02 (Median) Methylation in Control 6.86E-02 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC25A24 in papillary thyroid cancer [ 10 ]

Location

TSS1500 (cg09214920)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:5.00E-04; Z-score:-5.63E-01

Methylation in Case

5.95E-02 (Median) Methylation in Control 6.47E-02 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC25A24 in papillary thyroid cancer [ 10 ]

Location

TSS1500 (cg00999623)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:8.56E-03; Z-score:-2.88E-01

Methylation in Case

9.62E-02 (Median) Methylation in Control 1.01E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC25A24 in papillary thyroid cancer [ 10 ]

Location

Body (cg24323958)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.65E+00 Statistic Test p-value:1.47E-06; Z-score:-1.43E+00

Methylation in Case

1.86E-01 (Median) Methylation in Control 3.08E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Systemic lupus erythematosus

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A24 in systemic lupus erythematosus [ 11 ]

Location

TSS1500 (cg21421408)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:2.65E-02; Z-score:-1.71E-01

Methylation in Case

5.54E-02 (Median) Methylation in Control 5.77E-02 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A24 in systemic lupus erythematosus [ 11 ]

Location

TSS1500 (cg00999623)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:3.39E-02; Z-score:-7.69E-02

Methylation in Case

1.25E-01 (Median) Methylation in Control 1.27E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC25A24 in systemic lupus erythematosus [ 11 ]

Location

Body (cg08149333)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:2.14E-03; Z-score:-2.28E-01

Methylation in Case

6.09E-02 (Median) Methylation in Control 6.42E-02 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Depression

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A24 in depression [ 12 ]

Location

TSS200 (cg04220635)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:1.26E-02; Z-score:4.76E-01

Methylation in Case

6.42E-02 (Median) Methylation in Control 6.17E-02 (Median)

Studied Phenotype

Depression[ ICD-11:6A8Z]

Experimental Material

Patient tissue samples

  Atypical teratoid rhabdoid tumor

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A24 in atypical teratoid rhabdoid tumor [ 13 ]

Location

Body (cg00971228)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.08E+00 Statistic Test p-value:4.47E-05; Z-score:7.58E-01

Methylation in Case

8.87E-01 (Median) Methylation in Control 8.17E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A24 in atypical teratoid rhabdoid tumor [ 13 ]

Location

Body (cg08149333)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.13E+00 Statistic Test p-value:5.41E-03; Z-score:6.57E-01

Methylation in Case

8.68E-01 (Median) Methylation in Control 7.69E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC25A24 in atypical teratoid rhabdoid tumor [ 13 ]

Location

Body (cg14662970)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.49E+00 Statistic Test p-value:4.91E-02; Z-score:-5.03E-01

Methylation in Case

2.36E-02 (Median) Methylation in Control 3.51E-02 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

microRNA

  Unclear Phenotype

           6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

let-7b directly targets SLC25A24 [ 14 ]

Epigenetic Type

microRNA Experiment Method pSILAC//Proteomics;Other

miRNA Stemloop ID

let-7b miRNA Mature ID let-7b-5p

miRNA Sequence

UGAGGUAGUAGGUUGUGUGGUU

miRNA Target Type

Direct

Experimental Material

Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon2

miR-1305 directly targets SLC25A24 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1305 miRNA Mature ID miR-1305

miRNA Sequence

UUUUCAACUCUAAUGGGAGAGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon3

miR-335 directly targets SLC25A24 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-335 miRNA Mature ID miR-335-3p

miRNA Sequence

UUUUUCAUUAUUGCUCCUGACC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon4

miR-374a directly targets SLC25A24 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-374a miRNA Mature ID miR-374a-5p

miRNA Sequence

UUAUAAUACAACCUGAUAAGUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon5

miR-374b directly targets SLC25A24 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-374b miRNA Mature ID miR-374b-5p

miRNA Sequence

AUAUAAUACAACCUGCUAAGUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon6

miR-4275 directly targets SLC25A24 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4275 miRNA Mature ID miR-4275

miRNA Sequence

CCAAUUACCACUUCUUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human
References
1 DNA Methylation Dynamics in Urological Tumors.
2 Genome-wide Scan for Methylation Profiles in Breast Cancer
3 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
4 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
5 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
7 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
8 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
9 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
10 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
11 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
12 DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
13 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
14 Widespread changes in protein synthesis induced by microRNAs. Nature. 2008 Sep 4;455(7209):58-63.
15 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.