General Information of Drug Transporter (DT)
DT ID DTD0184 Transporter Info
Gene Name SLC25A23
Transporter Name Calcium-binding mitochondrial carrier protein SCaMC-3
Gene ID
79085
UniProt ID
Q9BV35
Epigenetic Regulations of This DT (EGR)

Methylation

  Colon cancer

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A23 in colon adenocarcinoma [ 1 ]

Location

5'UTR (cg22615730)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.22E+00 Statistic Test p-value:1.69E-03; Z-score:-1.71E+00

Methylation in Case

4.69E-01 (Median) Methylation in Control 5.71E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A23 in colon adenocarcinoma [ 1 ]

Location

TSS1500 (cg15099037)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.27E+00 Statistic Test p-value:2.46E-06; Z-score:-2.84E+00

Methylation in Case

5.15E-01 (Median) Methylation in Control 6.55E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC25A23 in colon adenocarcinoma [ 1 ]

Location

TSS1500 (cg25846723)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.21E+00 Statistic Test p-value:2.17E-03; Z-score:1.17E+00

Methylation in Case

5.42E-01 (Median) Methylation in Control 4.50E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC25A23 in colon adenocarcinoma [ 1 ]

Location

3'UTR (cg23722790)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.16E+00 Statistic Test p-value:1.26E-06; Z-score:2.07E+00

Methylation in Case

7.32E-01 (Median) Methylation in Control 6.32E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Breast cancer

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A23 in breast cancer [ 2 ]

Location

TSS1500 (cg11088931)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:4.11E-02; Z-score:-4.94E-01

Methylation in Case

1.22E-01 (Median) Methylation in Control 1.33E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A23 in breast cancer [ 2 ]

Location

Body (cg17100943)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.10E+00 Statistic Test p-value:2.64E-11; Z-score:3.31E+00

Methylation in Case

1.72E-01 (Median) Methylation in Control 8.17E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC25A23 in breast cancer [ 2 ]

Location

Body (cg02861527)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.30E+00 Statistic Test p-value:2.53E-08; Z-score:1.53E+00

Methylation in Case

1.84E-01 (Median) Methylation in Control 1.41E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC25A23 in breast cancer [ 2 ]

Location

Body (cg14007706)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.42E+00 Statistic Test p-value:3.53E-07; Z-score:2.03E+00

Methylation in Case

3.50E-01 (Median) Methylation in Control 2.47E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Renal cell carcinoma

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A23 in clear cell renal cell carcinoma [ 3 ]

Location

TSS1500 (cg25468529)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:1.44E-02; Z-score:1.22E-01

Methylation in Case

2.72E-02 (Median) Methylation in Control 2.68E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A23 in clear cell renal cell carcinoma [ 3 ]

Location

1stExon (cg15187882)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:1.13E-02; Z-score:3.86E-01

Methylation in Case

1.68E-02 (Median) Methylation in Control 1.61E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC25A23 in clear cell renal cell carcinoma [ 3 ]

Location

Body (cg17100943)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.97E+00 Statistic Test p-value:9.49E-07; Z-score:1.94E+00

Methylation in Case

1.46E-01 (Median) Methylation in Control 4.93E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC25A23 in clear cell renal cell carcinoma [ 3 ]

Location

Body (cg14007706)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.77E+00 Statistic Test p-value:2.25E-06; Z-score:1.87E+00

Methylation in Case

3.48E-01 (Median) Methylation in Control 1.96E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Colorectal cancer

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A23 in colorectal cancer [ 4 ]

Location

TSS1500 (cg10131887)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.21E+00 Statistic Test p-value:2.34E-04; Z-score:-9.61E-01

Methylation in Case

9.98E-02 (Median) Methylation in Control 1.20E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A23 in colorectal cancer [ 4 ]

Location

TSS1500 (cg21457031)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.18E+00 Statistic Test p-value:3.55E-02; Z-score:4.54E-01

Methylation in Case

1.62E-02 (Median) Methylation in Control 1.38E-02 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC25A23 in colorectal cancer [ 4 ]

Location

3'UTR (cg19720937)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.00E+00 Statistic Test p-value:1.99E-02; Z-score:-1.61E-01

Methylation in Case

9.40E-01 (Median) Methylation in Control 9.41E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Hepatocellular carcinoma

           6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A23 in hepatocellular carcinoma [ 5 ]

Location

TSS1500 (cg07041488)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.83E+00 Statistic Test p-value:5.60E-20; Z-score:-4.13E+00

Methylation in Case

4.13E-01 (Median) Methylation in Control 7.56E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A23 in hepatocellular carcinoma [ 5 ]

Location

TSS1500 (cg25468529)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.08E+00 Statistic Test p-value:1.04E-02; Z-score:-6.99E-01

Methylation in Case

5.68E-02 (Median) Methylation in Control 6.12E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC25A23 in hepatocellular carcinoma [ 5 ]

Location

TSS200 (cg00694520)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.53E+00 Statistic Test p-value:1.92E-17; Z-score:-3.32E+00

Methylation in Case

4.06E-01 (Median) Methylation in Control 6.20E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC25A23 in hepatocellular carcinoma [ 5 ]

Location

Body (cg16172619)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.95E+00 Statistic Test p-value:3.56E-23; Z-score:-3.97E+00

Methylation in Case

3.14E-01 (Median) Methylation in Control 6.12E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC25A23 in hepatocellular carcinoma [ 5 ]

Location

Body (cg14007706)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.22E+00 Statistic Test p-value:6.23E-05; Z-score:-8.33E-01

Methylation in Case

2.88E-01 (Median) Methylation in Control 3.51E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC25A23 in hepatocellular carcinoma [ 5 ]

Location

3'UTR (cg19720937)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:3.00E-02; Z-score:-3.98E-01

Methylation in Case

8.68E-01 (Median) Methylation in Control 8.74E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  HIV infection

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A23 in HIV infection [ 6 ]

Location

TSS1500 (cg11088931)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:1.41E-02; Z-score:-4.24E-01

Methylation in Case

1.15E-01 (Median) Methylation in Control 1.21E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A23 in HIV infection [ 6 ]

Location

Body (cg17100943)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.43E+00 Statistic Test p-value:1.12E-09; Z-score:2.47E+00

Methylation in Case

5.66E-01 (Median) Methylation in Control 3.98E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC25A23 in HIV infection [ 6 ]

Location

Body (cg02861527)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.18E+00 Statistic Test p-value:9.80E-07; Z-score:1.37E+00

Methylation in Case

2.78E-01 (Median) Methylation in Control 2.36E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

           6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A23 in papillary thyroid cancer [ 7 ]

Location

TSS1500 (cg21457031)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.12E+00 Statistic Test p-value:5.03E-04; Z-score:-8.56E-01

Methylation in Case

5.25E-02 (Median) Methylation in Control 5.87E-02 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A23 in papillary thyroid cancer [ 7 ]

Location

TSS1500 (cg03214277)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:1.11E-02; Z-score:-5.97E-01

Methylation in Case

4.70E-02 (Median) Methylation in Control 5.14E-02 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC25A23 in papillary thyroid cancer [ 7 ]

Location

Body (cg14007706)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.22E+00 Statistic Test p-value:1.40E-02; Z-score:5.52E-01

Methylation in Case

1.86E-01 (Median) Methylation in Control 1.52E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC25A23 in papillary thyroid cancer [ 7 ]

Location

Body (cg02861527)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.17E+00 Statistic Test p-value:1.62E-02; Z-score:4.76E-01

Methylation in Case

1.04E-01 (Median) Methylation in Control 8.94E-02 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC25A23 in papillary thyroid cancer [ 7 ]

Location

Body (cg17100943)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.25E+00 Statistic Test p-value:3.81E-02; Z-score:4.69E-01

Methylation in Case

1.20E-01 (Median) Methylation in Control 9.55E-02 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC25A23 in papillary thyroid cancer [ 7 ]

Location

Body (cg08588635)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:4.00E-02; Z-score:-5.89E-01

Methylation in Case

9.35E-01 (Median) Methylation in Control 9.43E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Systemic lupus erythematosus

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A23 in systemic lupus erythematosus [ 8 ]

Location

TSS1500 (cg11088931)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:3.14E-03; Z-score:-1.36E-01

Methylation in Case

1.65E-01 (Median) Methylation in Control 1.70E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A23 in systemic lupus erythematosus [ 8 ]

Location

TSS1500 (cg10131887)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:1.48E-02; Z-score:-5.45E-02

Methylation in Case

7.18E-02 (Median) Methylation in Control 7.29E-02 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC25A23 in systemic lupus erythematosus [ 8 ]

Location

TSS1500 (cg25468529)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:2.04E-02; Z-score:-1.65E-01

Methylation in Case

8.64E-02 (Median) Methylation in Control 8.93E-02 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC25A23 in systemic lupus erythematosus [ 8 ]

Location

TSS200 (cg26192857)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:1.16E-03; Z-score:-2.35E-01

Methylation in Case

6.80E-02 (Median) Methylation in Control 7.14E-02 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Lung adenocarcinoma

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A23 in lung adenocarcinoma [ 9 ]

Location

TSS200 (cg26192857)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.18E+00 Statistic Test p-value:1.47E-03; Z-score:2.11E+00

Methylation in Case

8.65E-02 (Median) Methylation in Control 7.30E-02 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A23 in lung adenocarcinoma [ 9 ]

Location

Body (cg17100943)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.60E+00 Statistic Test p-value:2.43E-03; Z-score:3.11E+00

Methylation in Case

3.51E-01 (Median) Methylation in Control 2.19E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC25A23 in lung adenocarcinoma [ 9 ]

Location

Body (cg14007706)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.29E+00 Statistic Test p-value:5.31E-03; Z-score:2.55E+00

Methylation in Case

5.07E-01 (Median) Methylation in Control 3.93E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Atypical teratoid rhabdoid tumor

           5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A23 in atypical teratoid rhabdoid tumor [ 10 ]

Location

1stExon (cg15187882)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.56E+00 Statistic Test p-value:1.73E-18; Z-score:-2.44E+00

Methylation in Case

4.60E-01 (Median) Methylation in Control 7.20E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A23 in atypical teratoid rhabdoid tumor [ 10 ]

Location

Body (cg02861527)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:2.29E-04; Z-score:-8.81E-01

Methylation in Case

8.61E-01 (Median) Methylation in Control 9.03E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC25A23 in atypical teratoid rhabdoid tumor [ 10 ]

Location

Body (cg08588635)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:7.56E-03; Z-score:5.94E-01

Methylation in Case

9.02E-01 (Median) Methylation in Control 8.57E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC25A23 in atypical teratoid rhabdoid tumor [ 10 ]

Location

Body (cg14007706)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.12E+00 Statistic Test p-value:4.14E-02; Z-score:4.03E-01

Methylation in Case

1.01E-01 (Median) Methylation in Control 9.00E-02 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC25A23 in atypical teratoid rhabdoid tumor [ 10 ]

Location

3'UTR (cg19720937)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.28E+00 Statistic Test p-value:3.28E-10; Z-score:1.35E+00

Methylation in Case

7.25E-01 (Median) Methylation in Control 5.69E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Pancretic ductal adenocarcinoma

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A23 in pancretic ductal adenocarcinoma [ 11 ]

Location

1stExon (cg26013553)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:5.24E+00 Statistic Test p-value:4.01E-17; Z-score:3.53E+00

Methylation in Case

4.76E-01 (Median) Methylation in Control 9.09E-02 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A23 in pancretic ductal adenocarcinoma [ 11 ]

Location

Body (cg02009040)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.00E+00 Statistic Test p-value:1.91E-02; Z-score:-2.30E-01

Methylation in Case

8.65E-01 (Median) Methylation in Control 8.67E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Prostate cancer

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A23 in prostate cancer [ 12 ]

Location

1stExon (cg21615171)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:4.47E-02; Z-score:1.47E+00

Methylation in Case

9.47E-01 (Median) Methylation in Control 9.26E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A23 in prostate cancer [ 12 ]

Location

Body (cg22772691)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.18E+00 Statistic Test p-value:1.96E-02; Z-score:3.32E+00

Methylation in Case

6.95E-01 (Median) Methylation in Control 5.89E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Bladder cancer

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A23 in bladder cancer [ 13 ]

Location

Body (cg14007706)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.00E+00 Statistic Test p-value:2.91E-04; Z-score:-4.24E+00

Methylation in Case

1.41E-01 (Median) Methylation in Control 2.82E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A23 in bladder cancer [ 13 ]

Location

3'UTR (cg19720937)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:1.97E-03; Z-score:-1.68E+00

Methylation in Case

8.35E-01 (Median) Methylation in Control 8.61E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

Histone trimethylation

  Astrocytic tumors

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Lower level of histone trimethylation of SLC25A23 in astrocytic tumors (compare with normal counterpart cells) [ 14 ]

Epigenetic Type

Histone trimethylation Experiment Method Chromatin immunoprecipitation

Related Molecular Changes

Down regulation ofSLC25A23 Experiment Method Western Blot

Studied Phenotype

Astrocytic tumors[ ICD-11:2A00.0Y]

Experimental Material

Patients samples of human

Additional Notes

There is a direct role of H3K27me3 modification in epigenetically silencing the SLC25A23 gene expression.

microRNA

  Unclear Phenotype

         24 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-1909 directly targets SLC25A23 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1909 miRNA Mature ID miR-1909-3p

miRNA Sequence

CGCAGGGGCCGGGUGCUCACCG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon2

miR-26b directly targets SLC25A23 [ 16 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-26b miRNA Mature ID miR-26b-5p

miRNA Sequence

UUCAAGUAAUUCAGGAUAGGU

miRNA Target Type

Direct

Experimental Material

Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon3

miR-3151 directly targets SLC25A23 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3151 miRNA Mature ID miR-3151-5p

miRNA Sequence

GGUGGGGCAAUGGGAUCAGGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon4

miR-335 directly targets SLC25A23 [ 17 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-335 miRNA Mature ID miR-335-5p

miRNA Sequence

UCAAGAGCAAUAACGAAAAAUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon5

miR-3611 directly targets SLC25A23 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3611 miRNA Mature ID miR-3611

miRNA Sequence

UUGUGAAGAAAGAAAUUCUUA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon6

miR-3616 directly targets SLC25A23 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3616 miRNA Mature ID miR-3616-5p

miRNA Sequence

AUGAAGUGCACUCAUGAUAUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon7

miR-373 directly targets SLC25A23 [ 18 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-373 miRNA Mature ID miR-373-3p

miRNA Sequence

GAAGUGCUUCGAUUUUGGGGUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon8

miR-4270 directly targets SLC25A23 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4270 miRNA Mature ID miR-4270

miRNA Sequence

UCAGGGAGUCAGGGGAGGGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon9

miR-4441 directly targets SLC25A23 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4441 miRNA Mature ID miR-4441

miRNA Sequence

ACAGGGAGGAGAUUGUA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon10

miR-4447 directly targets SLC25A23 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4447 miRNA Mature ID miR-4447

miRNA Sequence

GGUGGGGGCUGUUGUUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon11

miR-4450 directly targets SLC25A23 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4450 miRNA Mature ID miR-4450

miRNA Sequence

UGGGGAUUUGGAGAAGUGGUGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon12

miR-4472 directly targets SLC25A23 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4472 miRNA Mature ID miR-4472

miRNA Sequence

GGUGGGGGGUGUUGUUUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon13

miR-4795 directly targets SLC25A23 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4795 miRNA Mature ID miR-4795-5p

miRNA Sequence

AGAAGUGGCUAAUAAUAUUGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon14

miR-491 directly targets SLC25A23 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-491 miRNA Mature ID miR-491-5p

miRNA Sequence

AGUGGGGAACCCUUCCAUGAGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon15

miR-573 directly targets SLC25A23 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-573 miRNA Mature ID miR-573

miRNA Sequence

CUGAAGUGAUGUGUAACUGAUCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon16

miR-595 directly targets SLC25A23 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-595 miRNA Mature ID miR-595

miRNA Sequence

GAAGUGUGCCGUGGUGUGUCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon17

miR-6077 directly targets SLC25A23 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6077 miRNA Mature ID miR-6077

miRNA Sequence

GGGAAGAGCUGUACGGCCUUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon18

miR-6722 directly targets SLC25A23 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6722 miRNA Mature ID miR-6722-3p

miRNA Sequence

UGCAGGGGUCGGGUGGGCCAGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon19

miR-6742 directly targets SLC25A23 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6742 miRNA Mature ID miR-6742-5p

miRNA Sequence

AGUGGGGUGGGACCCAGCUGUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon20

miR-6754 directly targets SLC25A23 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6754 miRNA Mature ID miR-6754-5p

miRNA Sequence

CCAGGGAGGCUGGUUUGGAGGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon21

miR-6796 directly targets SLC25A23 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6796 miRNA Mature ID miR-6796-5p

miRNA Sequence

UUGUGGGGUUGGAGAGCUGGCUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon22

miR-6857 directly targets SLC25A23 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6857 miRNA Mature ID miR-6857-5p

miRNA Sequence

UUGGGGAUUGGGUCAGGCCAGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon23

miR-7 directly targets SLC25A23 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-7 miRNA Mature ID miR-7-5p

miRNA Sequence

UGGAAGACUAGUGAUUUUGUUGUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon24

miR-93 directly targets SLC25A23 [ 19 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-93 miRNA Mature ID miR-93-3p

miRNA Sequence

ACUGCUGAGCUAGCACUUCCCG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)
References
1 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
2 Genome-wide Scan for Methylation Profiles in Breast Cancer
3 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
4 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
5 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
6 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
7 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
8 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
9 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
10 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
11 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
12 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
13 DNA Methylation Dynamics in Urological Tumors.
14 Genome-wide ChIP-seq analysis of EZH2-mediated H3K27me3 target gene profile highlights differences between low- and high-grade astrocytic tumors. Carcinogenesis. 2017 Feb 1;38(2):152-161.
15 TP53 regulates miRNA association with AGO2 to remodel the miRNA-mRNA interaction network. Genome Res. 2016 Mar;26(3):331-41.
16 MicroRNA target prediction by expression analysis of host genes. Genome Res. 2009 Mar;19(3):481-90.
17 Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.
18 Microarray analysis shows that some microRNAs downregulate large numbers of target mRNAs. Nature. 2005 Feb 17;433(7027):769-73.
19 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.