Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0183 Transporter Info
Gene Name SLC25A22
Transporter Name Mitochondrial glutamate carrier 1
Gene ID
79751
UniProt ID
Q9H936
Epigenetic Regulations of This DT (EGR)

Methylation

  Atypical teratoid rhabdoid tumor

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC25A22 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg22747142)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.24E+00 Statistic Test p-value:6.48E-06; Z-score:7.22E-01

Methylation in Case

 6.70E-01 (Median) Methylation in Control 5.38E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC25A22 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 Body (cg01554951)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.31E+00 Statistic Test p-value:7.42E-05; Z-score:-7.59E-01

Methylation in Case

 3.58E-01 (Median) Methylation in Control 4.68E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC25A22 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 Body (cg08065122)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.11E+00 Statistic Test p-value:5.30E-03; Z-score:-5.38E-01

Methylation in Case

 5.54E-01 (Median) Methylation in Control 6.14E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC25A22 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 Body (cg13352894)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.98E+00 Statistic Test p-value:3.46E-02; Z-score:-7.07E-01

Methylation in Case

 9.53E-02 (Median) Methylation in Control 1.88E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  Breast cancer

          10 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC25A22 in breast cancer [ 2 ]

Location

 5'UTR (cg22747142)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.14E+00 Statistic Test p-value:1.34E-03; Z-score:1.10E+00

Methylation in Case

 4.35E-01 (Median) Methylation in Control 3.83E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC25A22 in breast cancer [ 2 ]

Location

 TSS1500 (cg10665488)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.67E+00 Statistic Test p-value:7.88E-09; Z-score:3.46E+00

Methylation in Case

 1.45E-01 (Median) Methylation in Control 8.71E-02 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC25A22 in breast cancer [ 2 ]

Location

 TSS1500 (cg10970251)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.22E+00 Statistic Test p-value:1.40E-05; Z-score:7.09E-01

Methylation in Case

 7.54E-02 (Median) Methylation in Control 6.18E-02 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC25A22 in breast cancer [ 2 ]

Location

 TSS1500 (cg07080372)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.23E+00 Statistic Test p-value:1.64E-05; Z-score:8.95E-01

Methylation in Case

 1.75E-01 (Median) Methylation in Control 1.42E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC25A22 in breast cancer [ 2 ]

Location

 TSS1500 (cg13749939)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.07E+00 Statistic Test p-value:2.88E-04; Z-score:2.06E-01

Methylation in Case

 9.39E-02 (Median) Methylation in Control 8.81E-02 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC25A22 in breast cancer [ 2 ]

Location

 TSS200 (cg16709110)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.06E+00 Statistic Test p-value:1.23E-03; Z-score:-1.93E-01

Methylation in Case

 5.32E-02 (Median) Methylation in Control 5.62E-02 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon7

 Methylation of SLC25A22 in breast cancer [ 2 ]

Location

 Body (cg19262958)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.04E+00 Statistic Test p-value:3.42E-06; Z-score:-1.08E+00

Methylation in Case

 7.79E-01 (Median) Methylation in Control 8.13E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon8

 Methylation of SLC25A22 in breast cancer [ 2 ]

Location

 Body (cg08065122)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.10E+00 Statistic Test p-value:3.12E-03; Z-score:1.62E+00

Methylation in Case

 7.25E-01 (Median) Methylation in Control 6.61E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon9

 Methylation of SLC25A22 in breast cancer [ 2 ]

Location

 Body (cg25211622)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.01E+00 Statistic Test p-value:5.53E-03; Z-score:-2.49E-01

Methylation in Case

 9.71E-01 (Median) Methylation in Control 9.76E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon10

 Methylation of SLC25A22 in breast cancer [ 2 ]

Location

 Body (cg26030804)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.06E+00 Statistic Test p-value:4.47E-02; Z-score:8.91E-01

Methylation in Case

 9.49E-01 (Median) Methylation in Control 8.97E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Colorectal cancer

          13 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC25A22 in colorectal cancer [ 3 ]

Location

 5'UTR (cg22747142)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.22E+00 Statistic Test p-value:8.54E-06; Z-score:1.25E+00

Methylation in Case

 6.33E-01 (Median) Methylation in Control 5.19E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC25A22 in colorectal cancer [ 3 ]

Location

 TSS1500 (cg10665488)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.20E+00 Statistic Test p-value:4.92E-08; Z-score:1.50E+00

Methylation in Case

 1.99E-01 (Median) Methylation in Control 1.66E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC25A22 in colorectal cancer [ 3 ]

Location

 TSS1500 (cg10970251)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.06E+00 Statistic Test p-value:2.00E-03; Z-score:2.39E-01

Methylation in Case

 8.96E-02 (Median) Methylation in Control 8.47E-02 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC25A22 in colorectal cancer [ 3 ]

Location

 TSS1500 (cg13749939)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.08E+00 Statistic Test p-value:1.78E-02; Z-score:5.38E-01

Methylation in Case

 1.41E-01 (Median) Methylation in Control 1.31E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC25A22 in colorectal cancer [ 3 ]

Location

 TSS200 (cg16709110)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.01E+00 Statistic Test p-value:4.71E-02; Z-score:-3.35E-02

Methylation in Case

 8.48E-02 (Median) Methylation in Control 8.53E-02 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC25A22 in colorectal cancer [ 3 ]

Location

 Body (cg27100471)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.19E+00 Statistic Test p-value:2.95E-04; Z-score:1.31E+00

Methylation in Case

 8.83E-01 (Median) Methylation in Control 7.41E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon7

 Methylation of SLC25A22 in colorectal cancer [ 3 ]

Location

 Body (cg13352894)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.00E+00 Statistic Test p-value:2.43E-03; Z-score:-4.61E-01

Methylation in Case

 9.42E-01 (Median) Methylation in Control 9.47E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon8

 Methylation of SLC25A22 in colorectal cancer [ 3 ]

Location

 Body (cg26030804)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.05E+00 Statistic Test p-value:4.34E-03; Z-score:7.26E-01

Methylation in Case

 9.81E-01 (Median) Methylation in Control 9.34E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon9

 Methylation of SLC25A22 in colorectal cancer [ 3 ]

Location

 Body (cg19262958)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.01E+00 Statistic Test p-value:7.27E-03; Z-score:-2.05E-01

Methylation in Case

 8.45E-01 (Median) Methylation in Control 8.50E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon10

 Methylation of SLC25A22 in colorectal cancer [ 3 ]

Location

 Body (cg20119495)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.00E+00 Statistic Test p-value:8.22E-03; Z-score:-4.26E-01

Methylation in Case

 9.78E-01 (Median) Methylation in Control 9.79E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon11

 Methylation of SLC25A22 in colorectal cancer [ 3 ]

Location

 Body (cg08065122)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.01E+00 Statistic Test p-value:2.25E-02; Z-score:-2.82E-01

Methylation in Case

 8.59E-01 (Median) Methylation in Control 8.65E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon12

 Methylation of SLC25A22 in colorectal cancer [ 3 ]

Location

 Body (cg17522727)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.12E+00 Statistic Test p-value:4.13E-02; Z-score:5.14E-01

Methylation in Case

 9.18E-01 (Median) Methylation in Control 8.22E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

          11 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC25A22 in hepatocellular carcinoma [ 4 ]

Location

 5'UTR (cg16832267)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:4.73E+00 Statistic Test p-value:2.30E-11; Z-score:6.74E+00

Methylation in Case

 3.54E-01 (Median) Methylation in Control 7.48E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC25A22 in hepatocellular carcinoma [ 4 ]

Location

 5'UTR (cg22747142)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.16E+00 Statistic Test p-value:1.00E-02; Z-score:-8.51E-01

Methylation in Case

 3.84E-01 (Median) Methylation in Control 4.44E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC25A22 in hepatocellular carcinoma [ 4 ]

Location

 TSS1500 (cg10665488)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.20E+00 Statistic Test p-value:1.26E-04; Z-score:1.03E+00

Methylation in Case

 1.12E-01 (Median) Methylation in Control 9.33E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC25A22 in hepatocellular carcinoma [ 4 ]

Location

 TSS1500 (cg10970251)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.17E+00 Statistic Test p-value:1.55E-03; Z-score:9.85E-01

Methylation in Case

 6.40E-02 (Median) Methylation in Control 5.48E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC25A22 in hepatocellular carcinoma [ 4 ]

Location

 TSS1500 (cg07080372)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.13E+00 Statistic Test p-value:2.39E-03; Z-score:7.32E-01

Methylation in Case

 1.27E-01 (Median) Methylation in Control 1.13E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC25A22 in hepatocellular carcinoma [ 4 ]

Location

 TSS1500 (cg13749939)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.05E+00 Statistic Test p-value:2.16E-02; Z-score:2.36E-01

Methylation in Case

 8.45E-02 (Median) Methylation in Control 8.03E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon7

 Methylation of SLC25A22 in hepatocellular carcinoma [ 4 ]

Location

 1stExon (cg04643655)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.54E+00 Statistic Test p-value:1.64E-11; Z-score:-2.64E+00

Methylation in Case

 2.64E-01 (Median) Methylation in Control 4.07E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon8

 Methylation of SLC25A22 in hepatocellular carcinoma [ 4 ]

Location

 Body (cg19262958)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.01E+00 Statistic Test p-value:2.41E-04; Z-score:-5.92E-01

Methylation in Case

 8.05E-01 (Median) Methylation in Control 8.16E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon9

 Methylation of SLC25A22 in hepatocellular carcinoma [ 4 ]

Location

 Body (cg13352894)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.01E+00 Statistic Test p-value:1.83E-03; Z-score:-1.79E-01

Methylation in Case

 8.24E-01 (Median) Methylation in Control 8.29E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon10

 Methylation of SLC25A22 in hepatocellular carcinoma [ 4 ]

Location

 Body (cg08065122)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.04E+00 Statistic Test p-value:4.96E-03; Z-score:-5.98E-01

Methylation in Case

 7.44E-01 (Median) Methylation in Control 7.71E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon11

 Methylation of SLC25A22 in hepatocellular carcinoma [ 4 ]

Location

 3'UTR (cg15600751)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.53E+00 Statistic Test p-value:1.38E-17; Z-score:-3.64E+00

Methylation in Case

 3.33E-01 (Median) Methylation in Control 5.09E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Bladder cancer

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC25A22 in bladder cancer [ 5 ]

Location

 TSS1500 (cg10970251)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.02E+00 Statistic Test p-value:3.11E-02; Z-score:3.04E-01

Methylation in Case

 5.36E-02 (Median) Methylation in Control 5.24E-02 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC25A22 in bladder cancer [ 5 ]

Location

 TSS1500 (cg07080372)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-2.06E+00 Statistic Test p-value:3.49E-02; Z-score:-2.87E+00

Methylation in Case

 9.63E-02 (Median) Methylation in Control 1.99E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC25A22 in bladder cancer [ 5 ]

Location

 Body (cg08065122)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.41E+00 Statistic Test p-value:5.19E-07; Z-score:-5.94E+00

Methylation in Case

 5.28E-01 (Median) Methylation in Control 7.43E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC25A22 in bladder cancer [ 5 ]

Location

 Body (cg19262958)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.05E+00 Statistic Test p-value:4.33E-05; Z-score:-4.18E+00

Methylation in Case

 7.66E-01 (Median) Methylation in Control 8.06E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC25A22 in bladder cancer [ 5 ]

Location

 Body (cg27100471)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.22E+00 Statistic Test p-value:3.42E-03; Z-score:-2.22E+00

Methylation in Case

 6.82E-01 (Median) Methylation in Control 8.32E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC25A22 in bladder cancer [ 5 ]

Location

 Body (cg25211622)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.03E+00 Statistic Test p-value:3.58E-03; Z-score:-2.57E+00

Methylation in Case

 9.50E-01 (Median) Methylation in Control 9.80E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC25A22 in clear cell renal cell carcinoma [ 6 ]

Location

 TSS1500 (cg07080372)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-2.80E+00 Statistic Test p-value:4.42E-12; Z-score:-3.99E+00

Methylation in Case

 1.29E-01 (Median) Methylation in Control 3.60E-01 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC25A22 in clear cell renal cell carcinoma [ 6 ]

Location

 TSS1500 (cg10970251)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-6.94E+00 Statistic Test p-value:1.93E-05; Z-score:-2.29E+00

Methylation in Case

 1.80E-02 (Median) Methylation in Control 1.25E-01 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC25A22 in clear cell renal cell carcinoma [ 6 ]

Location

 TSS1500 (cg10665488)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-2.82E+00 Statistic Test p-value:6.13E-05; Z-score:-2.32E+00

Methylation in Case

 6.73E-02 (Median) Methylation in Control 1.90E-01 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC25A22 in clear cell renal cell carcinoma [ 6 ]

Location

 Body (cg19262958)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.02E+00 Statistic Test p-value:5.28E-03; Z-score:-6.33E-01

Methylation in Case

 9.26E-01 (Median) Methylation in Control 9.45E-01 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Colon cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC25A22 in colon adenocarcinoma [ 7 ]

Location

 TSS1500 (cg24924779)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:2.70E+00 Statistic Test p-value:1.14E-08; Z-score:4.80E+00

Methylation in Case

 5.52E-01 (Median) Methylation in Control 2.05E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC25A22 in colon adenocarcinoma [ 7 ]

Location

 TSS1500 (cg21168134)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.23E+00 Statistic Test p-value:2.38E-05; Z-score:-3.14E+00

Methylation in Case

 6.14E-01 (Median) Methylation in Control 7.58E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC25A22 in colon adenocarcinoma [ 7 ]

Location

 Body (cg23530596)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.40E+00 Statistic Test p-value:1.19E-05; Z-score:-2.83E+00

Methylation in Case

 3.94E-01 (Median) Methylation in Control 5.52E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC25A22 in colon adenocarcinoma [ 7 ]

Location

 Body (cg07185041)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.23E+00 Statistic Test p-value:8.37E-04; Z-score:-1.57E+00

Methylation in Case

 4.45E-01 (Median) Methylation in Control 5.48E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  HIV infection

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC25A22 in HIV infection [ 8 ]

Location

 TSS1500 (cg10665488)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.11E+00 Statistic Test p-value:4.82E-03; Z-score:4.77E-01

Methylation in Case

 1.23E-01 (Median) Methylation in Control 1.11E-01 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC25A22 in HIV infection [ 8 ]

Location

 TSS1500 (cg07080372)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.27E+00 Statistic Test p-value:3.48E-02; Z-score:-1.05E+00

Methylation in Case

 1.55E-01 (Median) Methylation in Control 1.98E-01 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC25A22 in HIV infection [ 8 ]

Location

 Body (cg01554951)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.01E+00 Statistic Test p-value:2.49E-02; Z-score:2.16E-01

Methylation in Case

 8.82E-01 (Median) Methylation in Control 8.73E-01 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC25A22 in HIV infection [ 8 ]

Location

 Body (cg08065122)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.01E+00 Statistic Test p-value:3.48E-02; Z-score:3.21E-01

Methylation in Case

 8.83E-01 (Median) Methylation in Control 8.72E-01 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            9 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC25A22 in pancretic ductal adenocarcinoma [ 9 ]

Location

 TSS1500 (cg25260865)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.32E+00 Statistic Test p-value:1.02E-08; Z-score:-1.58E+00

Methylation in Case

 2.19E-01 (Median) Methylation in Control 2.90E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC25A22 in pancretic ductal adenocarcinoma [ 9 ]

Location

 TSS1500 (cg21566348)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.24E+00 Statistic Test p-value:8.36E-05; Z-score:-7.36E-01

Methylation in Case

 1.13E-01 (Median) Methylation in Control 1.40E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC25A22 in pancretic ductal adenocarcinoma [ 9 ]

Location

 TSS1500 (cg01053714)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.05E+00 Statistic Test p-value:9.88E-04; Z-score:-6.22E-01

Methylation in Case

 6.58E-01 (Median) Methylation in Control 6.93E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC25A22 in pancretic ductal adenocarcinoma [ 9 ]

Location

 TSS200 (cg24869640)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.34E+00 Statistic Test p-value:4.87E-11; Z-score:1.40E+00

Methylation in Case

 1.07E-01 (Median) Methylation in Control 8.00E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC25A22 in pancretic ductal adenocarcinoma [ 9 ]

Location

 Body (cg05275995)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.11E+00 Statistic Test p-value:5.86E-09; Z-score:-1.53E+00

Methylation in Case

 6.85E-01 (Median) Methylation in Control 7.60E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC25A22 in pancretic ductal adenocarcinoma [ 9 ]

Location

 Body (cg22305346)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.04E+00 Statistic Test p-value:6.70E-06; Z-score:1.04E+00

Methylation in Case

 8.76E-01 (Median) Methylation in Control 8.39E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon7

 Methylation of SLC25A22 in pancretic ductal adenocarcinoma [ 9 ]

Location

 Body (cg07185425)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.03E+00 Statistic Test p-value:9.56E-05; Z-score:-5.82E-01

Methylation in Case

 8.32E-01 (Median) Methylation in Control 8.55E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon8

 Methylation of SLC25A22 in pancretic ductal adenocarcinoma [ 9 ]

Location

 Body (cg05658173)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.11E+00 Statistic Test p-value:4.12E-04; Z-score:1.58E+00

Methylation in Case

 7.73E-01 (Median) Methylation in Control 6.99E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon9

 Methylation of SLC25A22 in pancretic ductal adenocarcinoma [ 9 ]

Location

 Body (cg07010687)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.10E+00 Statistic Test p-value:2.14E-02; Z-score:6.04E-01

Methylation in Case

 7.29E-01 (Median) Methylation in Control 6.61E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC25A22 in papillary thyroid cancer [ 10 ]

Location

 TSS1500 (cg07080372)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.72E+00 Statistic Test p-value:7.03E-18; Z-score:-2.57E+00

Methylation in Case

 2.63E-01 (Median) Methylation in Control 4.52E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC25A22 in papillary thyroid cancer [ 10 ]

Location

 TSS1500 (cg10970251)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-2.22E+00 Statistic Test p-value:3.84E-14; Z-score:-1.90E+00

Methylation in Case

 4.76E-02 (Median) Methylation in Control 1.06E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC25A22 in papillary thyroid cancer [ 10 ]

Location

 TSS1500 (cg10665488)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.53E+00 Statistic Test p-value:1.49E-10; Z-score:-2.18E+00

Methylation in Case

 2.03E-01 (Median) Methylation in Control 3.11E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC25A22 in papillary thyroid cancer [ 10 ]

Location

 TSS1500 (cg13749939)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.50E+00 Statistic Test p-value:2.81E-08; Z-score:-1.34E+00

Methylation in Case

 5.24E-02 (Median) Methylation in Control 7.83E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC25A22 in papillary thyroid cancer [ 10 ]

Location

 Body (cg19262958)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.03E+00 Statistic Test p-value:9.47E-09; Z-score:-1.36E+00

Methylation in Case

 8.63E-01 (Median) Methylation in Control 8.88E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC25A22 in papillary thyroid cancer [ 10 ]

Location

 Body (cg17522727)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.01E+00 Statistic Test p-value:3.93E-04; Z-score:7.19E-01

Methylation in Case

 9.30E-01 (Median) Methylation in Control 9.19E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon7

 Methylation of SLC25A22 in papillary thyroid cancer [ 10 ]

Location

 Body (cg13352894)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.02E+00 Statistic Test p-value:5.36E-03; Z-score:-6.33E-01

Methylation in Case

 8.95E-01 (Median) Methylation in Control 9.10E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon8

 Methylation of SLC25A22 in papillary thyroid cancer [ 10 ]

Location

 Body (cg27100471)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.06E+00 Statistic Test p-value:6.04E-03; Z-score:1.84E+00

Methylation in Case

 8.94E-01 (Median) Methylation in Control 8.47E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC25A22 in systemic lupus erythematosus [ 11 ]

Location

 TSS1500 (cg13749939)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.03E+00 Statistic Test p-value:1.60E-03; Z-score:-1.78E-01

Methylation in Case

 1.07E-01 (Median) Methylation in Control 1.11E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC25A22 in systemic lupus erythematosus [ 11 ]

Location

 Body (cg25211622)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.00E+00 Statistic Test p-value:3.97E-02; Z-score:-7.16E-03

Methylation in Case

 9.83E-01 (Median) Methylation in Control 9.84E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC25A22 in systemic lupus erythematosus [ 11 ]

Location

 Body (cg08065122)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.01E+00 Statistic Test p-value:4.31E-02; Z-score:-2.68E-01

Methylation in Case

 8.79E-01 (Median) Methylation in Control 8.88E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC25A22 in lung adenocarcinoma [ 12 ]

Location

 Body (cg26030804)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.05E+00 Statistic Test p-value:4.99E-03; Z-score:1.14E+00

Methylation in Case

 9.58E-01 (Median) Methylation in Control 9.12E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC25A22 in lung adenocarcinoma [ 12 ]

Location

 Body (cg27100471)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.12E+00 Statistic Test p-value:3.03E-02; Z-score:1.47E+00

Methylation in Case

 8.51E-01 (Median) Methylation in Control 7.60E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC25A22 in lung adenocarcinoma [ 12 ]

Location

 Body (cg17522727)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.06E+00 Statistic Test p-value:3.08E-02; Z-score:8.91E-01

Methylation in Case

 9.30E-01 (Median) Methylation in Control 8.78E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

 Patient tissue samples

  Panic disorder

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC25A22 in panic disorder [ 13 ]

Location

 Body (cg19262958)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.16E+00 Statistic Test p-value:2.09E-03; Z-score:6.99E-01

Methylation in Case

 2.29E+00 (Median) Methylation in Control 1.98E+00 (Median)

Studied Phenotype

 Panic disorder[ ICD-11:6B01]

Experimental Material

 Patient tissue samples

  Prostate cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC25A22 in prostate cancer [ 14 ]

Location

 Body (cg17550582)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.17E+00 Statistic Test p-value:3.89E-02; Z-score:-1.52E+00

Methylation in Case

 4.55E-02 (Median) Methylation in Control 5.32E-02 (Median)

Studied Phenotype

 Prostate cancer[ ICD-11:2C82]

Experimental Material

 Patient tissue samples

  Cerebral hemispheric glioma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Moderate hypomethylation of SLC25A22 in cerebral hemispheric glioma than that in healthy individual

Studied Phenotype

 Cerebral hemispheric glioma [ICD-11:2A00.5]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value:0.005458332; Fold-change:-0.243761747; Z-score:-0.761061802
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

microRNA

  Unclear Phenotype

          44 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 miR-1-3p directly targets SLC25A22 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1-3p miRNA Mature ID miR-1-3p

miRNA Sequence

 UGGAAUGUAAAGAAGUAUGUAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon2

 miR-1207 directly targets SLC25A22 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1207 miRNA Mature ID miR-1207-5p

miRNA Sequence

 UGGCAGGGAGGCUGGGAGGGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon3

 miR-1224 directly targets SLC25A22 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1224 miRNA Mature ID miR-1224-5p

miRNA Sequence

 GUGAGGACUCGGGAGGUGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon4

 miR-1227 directly targets SLC25A22 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1227 miRNA Mature ID miR-1227-5p

miRNA Sequence

 GUGGGGCCAGGCGGUGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon5

 miR-124 directly targets SLC25A22 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-124 miRNA Mature ID miR-124-5p

miRNA Sequence

 CGUGUUCACAGCGGACCUUGAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon6

 miR-15a directly targets SLC25A22 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-15a miRNA Mature ID miR-15a-5p

miRNA Sequence

 UAGCAGCACAUAAUGGUUUGUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon7

 miR-15b directly targets SLC25A22 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-15b miRNA Mature ID miR-15b-5p

miRNA Sequence

 UAGCAGCACAUCAUGGUUUACA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon8

 miR-16 directly targets SLC25A22 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-16 miRNA Mature ID miR-16-5p

miRNA Sequence

 UAGCAGCACGUAAAUAUUGGCG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon9

 miR-1909 directly targets SLC25A22 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1909 miRNA Mature ID miR-1909-3p

miRNA Sequence

 CGCAGGGGCCGGGUGCUCACCG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon10

 miR-1915 directly targets SLC25A22 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1915 miRNA Mature ID miR-1915-3p

miRNA Sequence

 CCCCAGGGCGACGCGGCGGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon11

 miR-195 directly targets SLC25A22 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-195 miRNA Mature ID miR-195-5p

miRNA Sequence

 UAGCAGCACAGAAAUAUUGGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon12

 miR-1972 directly targets SLC25A22 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1972 miRNA Mature ID miR-1972

miRNA Sequence

 UCAGGCCAGGCACAGUGGCUCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon13

 miR-203b directly targets SLC25A22 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-203b miRNA Mature ID miR-203b-3p

miRNA Sequence

 UUGAACUGUUAAGAACCACUGGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon14

 miR-206 directly targets SLC25A22 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-206 miRNA Mature ID miR-206

miRNA Sequence

 UGGAAUGUAAGGAAGUGUGUGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon15

 miR-3915 directly targets SLC25A22 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3915 miRNA Mature ID miR-3915

miRNA Sequence

 UUGAGGAAAAGAUGGUCUUAUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon16

 miR-3928 directly targets SLC25A22 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3928 miRNA Mature ID miR-3928-3p

miRNA Sequence

 GGAGGAACCUUGGAGCUUCGGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon17

 miR-4260 directly targets SLC25A22 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4260 miRNA Mature ID miR-4260

miRNA Sequence

 CUUGGGGCAUGGAGUCCCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon18

 miR-4453 directly targets SLC25A22 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4453 miRNA Mature ID miR-4453

miRNA Sequence

 GAGCUUGGUCUGUAGCGGUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon19

 miR-4489 directly targets SLC25A22 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4489 miRNA Mature ID miR-4489

miRNA Sequence

 UGGGGCUAGUGAUGCAGGACG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon20

 miR-4514 directly targets SLC25A22 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4514 miRNA Mature ID miR-4514

miRNA Sequence

 ACAGGCAGGAUUGGGGAA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon21

 miR-4538 directly targets SLC25A22 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4538 miRNA Mature ID miR-4538

miRNA Sequence

 GAGCUUGGAUGAGCUGGGCUGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon22

 miR-4632 directly targets SLC25A22 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4632 miRNA Mature ID miR-4632-5p

miRNA Sequence

 GAGGGCAGCGUGGGUGUGGCGGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon23

 miR-4650 directly targets SLC25A22 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4650 miRNA Mature ID miR-4650-5p

miRNA Sequence

 UCAGGCCUCUUUCUACCUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon24

 miR-4660 directly targets SLC25A22 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4660 miRNA Mature ID miR-4660

miRNA Sequence

 UGCAGCUCUGGUGGAAAAUGGAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon25

 miR-4685 directly targets SLC25A22 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4685 miRNA Mature ID miR-4685-5p

miRNA Sequence

 CCCAGGGCUUGGAGUGGGGCAAGGUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon26

 miR-4689 directly targets SLC25A22 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4689 miRNA Mature ID miR-4689

miRNA Sequence

 UUGAGGAGACAUGGUGGGGGCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon27

 miR-4726 directly targets SLC25A22 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4726 miRNA Mature ID miR-4726-3p

miRNA Sequence

 ACCCAGGUUCCCUCUGGCCGCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon28

 miR-4763 directly targets SLC25A22 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4763 miRNA Mature ID miR-4763-3p

miRNA Sequence

 AGGCAGGGGCUGGUGCUGGGCGGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon29

 miR-486 directly targets SLC25A22 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-486 miRNA Mature ID miR-486-3p

miRNA Sequence

 CGGGGCAGCUCAGUACAGGAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon30

 miR-5006 directly targets SLC25A22 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5006 miRNA Mature ID miR-5006-5p

miRNA Sequence

 UUGCCAGGGCAGGAGGUGGAA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon31

 miR-6085 directly targets SLC25A22 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6085 miRNA Mature ID miR-6085

miRNA Sequence

 AAGGGGCUGGGGGAGCACA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon32

 miR-613 directly targets SLC25A22 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-613 miRNA Mature ID miR-613

miRNA Sequence

 AGGAAUGUUCCUUCUUUGCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon33

 miR-665 directly targets SLC25A22 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-665 miRNA Mature ID miR-665

miRNA Sequence

 ACCAGGAGGCUGAGGCCCCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon34

 miR-6721 directly targets SLC25A22 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6721 miRNA Mature ID miR-6721-5p

miRNA Sequence

 UGGGCAGGGGCUUAUUGUAGGAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon35

 miR-6722 directly targets SLC25A22 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6722 miRNA Mature ID miR-6722-3p

miRNA Sequence

 UGCAGGGGUCGGGUGGGCCAGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon36

 miR-6735 directly targets SLC25A22 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6735 miRNA Mature ID miR-6735-5p

miRNA Sequence

 CAGGGCAGAGGGCACAGGAAUCUGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon37

 miR-6736 directly targets SLC25A22 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6736 miRNA Mature ID miR-6736-3p

miRNA Sequence

 UCAGCUCCUCUCUACCCACAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon38

 miR-6764 directly targets SLC25A22 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6764 miRNA Mature ID miR-6764-5p

miRNA Sequence

 UCCCAGGGUCUGGUCAGAGUUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon39

 miR-6813 directly targets SLC25A22 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6813 miRNA Mature ID miR-6813-5p

miRNA Sequence

 CAGGGGCUGGGGUUUCAGGUUCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon40

 miR-6837 directly targets SLC25A22 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6837 miRNA Mature ID miR-6837-5p

miRNA Sequence

 ACCAGGGCCAGCAGGGAAUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon41

 miR-6840 directly targets SLC25A22 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6840 miRNA Mature ID miR-6840-3p

miRNA Sequence

 GCCCAGGACUUUGUGCGGGGUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon42

 miR-6858 directly targets SLC25A22 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6858 miRNA Mature ID miR-6858-5p

miRNA Sequence

 GUGAGGAGGGGCUGGCAGGGAC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon43

 miR-6879 directly targets SLC25A22 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6879 miRNA Mature ID miR-6879-5p

miRNA Sequence

 CAGGGCAGGGAAGGUGGGAGAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon44

 miR-7843 directly targets SLC25A22 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-7843 miRNA Mature ID miR-7843-5p

miRNA Sequence

 GAGGGCAGAGCCAGCUUCCUGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2 Genome-wide Scan for Methylation Profiles in Breast Cancer
3 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
4 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
5 DNA Methylation Dynamics in Urological Tumors.
6 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
7 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
8 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
9 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
10 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
11 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
12 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
13 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
14 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
15 TP53 regulates miRNA association with AGO2 to remodel the miRNA-mRNA interaction network. Genome Res. 2016 Mar;26(3):331-41.
16 EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21.
17 Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature. 2009 Jul 23;460(7254):479-86.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.