Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0178 Transporter Info | ||||
| Gene Name | SLC25A19 | ||||
| Transporter Name | Mitochondrial thiamine pyrophosphate carrier | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
microRNA |
|||||
|
Unclear Phenotype |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
let-7b directly targets SLC25A19 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Proteomics | ||
|
miRNA Stemloop ID |
let-7b | miRNA Mature ID | let-7b-5p | ||
|
miRNA Sequence |
UGAGGUAGUAGGUUGUGUGGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
|
Epigenetic Phenomenon2 |
miR-1 directly targets SLC25A19 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Proteomics | ||
|
miRNA Stemloop ID |
miR-1 | miRNA Mature ID | miR-1-3p | ||
|
miRNA Sequence |
UGGAAUGUAAAGAAGUAUGUAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
|
Epigenetic Phenomenon3 |
miR-155 directly targets SLC25A19 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Proteomics | ||
|
miRNA Stemloop ID |
miR-155 | miRNA Mature ID | miR-155-5p | ||
|
miRNA Sequence |
UUAAUGCUAAUCGUGAUAGGGGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
|
Epigenetic Phenomenon4 |
miR-543 directly targets SLC25A19 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-543 | miRNA Mature ID | miR-543 | ||
|
miRNA Sequence |
AAACAUUCGCGGUGCACUUCUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Methylation |
|||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.