Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0176 Transporter Info
Gene Name SLC25A17
Transporter Name Peroxisomal membrane protein PMP34
Gene ID
10478
UniProt ID
O43808
Epigenetic Regulations of This DT (EGR)

Methylation

  Colon cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC25A17 in colon adenocarcinoma [ 1 ]

Location

 5'UTR (cg06852309)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.20E+00 Statistic Test p-value:5.30E-06; Z-score:-1.92E+00

Methylation in Case

 4.35E-01 (Median) Methylation in Control 5.20E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC25A17 in colon adenocarcinoma [ 1 ]

Location

 TSS1500 (cg22971191)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.13E+00 Statistic Test p-value:3.01E-03; Z-score:-2.86E+00

Methylation in Case

 6.68E-01 (Median) Methylation in Control 7.52E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC25A17 in colon adenocarcinoma [ 1 ]

Location

 TSS1500 (cg21692194)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.22E+00 Statistic Test p-value:3.11E-03; Z-score:1.52E+00

Methylation in Case

 2.89E-01 (Median) Methylation in Control 2.38E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC25A17 in colon adenocarcinoma [ 1 ]

Location

 Body (cg00069417)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.02E+00 Statistic Test p-value:4.77E-03; Z-score:5.97E-01

Methylation in Case

 8.93E-01 (Median) Methylation in Control 8.74E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC25A17 in pancretic ductal adenocarcinoma [ 2 ]

Location

 5'UTR (cg06645921)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.25E+00 Statistic Test p-value:5.83E-04; Z-score:-1.03E+00

Methylation in Case

 4.00E-01 (Median) Methylation in Control 5.01E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC25A17 in pancretic ductal adenocarcinoma [ 2 ]

Location

 TSS1500 (cg21575465)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.13E+00 Statistic Test p-value:1.05E-03; Z-score:9.32E-01

Methylation in Case

 7.95E-01 (Median) Methylation in Control 7.06E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC25A17 in pancretic ductal adenocarcinoma [ 2 ]

Location

 TSS1500 (cg01575408)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.08E+00 Statistic Test p-value:1.75E-02; Z-score:-3.45E-01

Methylation in Case

 4.82E-02 (Median) Methylation in Control 5.20E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC25A17 in pancretic ductal adenocarcinoma [ 2 ]

Location

 TSS200 (cg01379969)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.16E+00 Statistic Test p-value:1.73E-02; Z-score:-6.82E-01

Methylation in Case

 8.80E-02 (Median) Methylation in Control 1.02E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC25A17 in pancretic ductal adenocarcinoma [ 2 ]

Location

 Body (cg16134515)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.11E+00 Statistic Test p-value:4.09E-09; Z-score:1.99E+00

Methylation in Case

 5.63E-01 (Median) Methylation in Control 5.08E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Bladder cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC25A17 in bladder cancer [ 3 ]

Location

 TSS1500 (cg15275890)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.26E+00 Statistic Test p-value:9.35E-06; Z-score:-1.12E+01

Methylation in Case

 6.55E-01 (Median) Methylation in Control 8.26E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC25A17 in bladder cancer [ 3 ]

Location

 Body (cg10954454)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.14E+00 Statistic Test p-value:4.27E-11; Z-score:-9.72E+00

Methylation in Case

 5.90E-01 (Median) Methylation in Control 6.73E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC25A17 in bladder cancer [ 3 ]

Location

 Body (cg05123106)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.19E+00 Statistic Test p-value:1.72E-05; Z-score:4.32E+00

Methylation in Case

 8.06E-01 (Median) Methylation in Control 6.75E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC25A17 in bladder cancer [ 3 ]

Location

 3'UTR (cg27077316)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.21E+00 Statistic Test p-value:8.89E-03; Z-score:1.94E+00

Methylation in Case

 7.55E-01 (Median) Methylation in Control 6.26E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC25A17 in breast cancer [ 4 ]

Location

 TSS1500 (cg23558213)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.86E+00 Statistic Test p-value:4.74E-14; Z-score:2.52E+00

Methylation in Case

 2.99E-01 (Median) Methylation in Control 1.61E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC25A17 in breast cancer [ 4 ]

Location

 TSS200 (cg03309838)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.16E+00 Statistic Test p-value:5.84E-03; Z-score:4.28E-01

Methylation in Case

 2.50E-02 (Median) Methylation in Control 2.15E-02 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC25A17 in breast cancer [ 4 ]

Location

 TSS200 (cg25201783)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.20E+00 Statistic Test p-value:3.89E-02; Z-score:3.70E-01

Methylation in Case

 5.85E-02 (Median) Methylation in Control 4.88E-02 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC25A17 in breast cancer [ 4 ]

Location

 Body (cg05123106)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.06E+00 Statistic Test p-value:1.24E-05; Z-score:8.55E-01

Methylation in Case

 8.15E-01 (Median) Methylation in Control 7.72E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC25A17 in breast cancer [ 4 ]

Location

 Body (cg23013931)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.15E+00 Statistic Test p-value:3.65E-03; Z-score:-4.38E-01

Methylation in Case

 7.29E-02 (Median) Methylation in Control 8.37E-02 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC25A17 in breast cancer [ 4 ]

Location

 Body (cg10954454)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.06E+00 Statistic Test p-value:3.93E-02; Z-score:-4.32E-01

Methylation in Case

 6.16E-01 (Median) Methylation in Control 6.52E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC25A17 in clear cell renal cell carcinoma [ 5 ]

Location

 TSS1500 (cg26356892)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.23E+00 Statistic Test p-value:6.55E-06; Z-score:1.30E+00

Methylation in Case

 4.39E-02 (Median) Methylation in Control 3.56E-02 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC25A17 in clear cell renal cell carcinoma [ 5 ]

Location

 TSS1500 (cg15275890)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.00E+00 Statistic Test p-value:3.29E-02; Z-score:-3.32E-01

Methylation in Case

 9.44E-01 (Median) Methylation in Control 9.49E-01 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC25A17 in clear cell renal cell carcinoma [ 5 ]

Location

 TSS200 (cg25201783)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.09E+00 Statistic Test p-value:2.05E-02; Z-score:4.53E-01

Methylation in Case

 2.12E-02 (Median) Methylation in Control 1.95E-02 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC25A17 in clear cell renal cell carcinoma [ 5 ]

Location

 1stExon (cg16167174)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.03E+00 Statistic Test p-value:4.03E-02; Z-score:1.67E-01

Methylation in Case

 1.02E-02 (Median) Methylation in Control 9.94E-03 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC25A17 in clear cell renal cell carcinoma [ 5 ]

Location

 Body (cg26688803)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.05E+00 Statistic Test p-value:2.10E-02; Z-score:3.47E-01

Methylation in Case

 5.44E-02 (Median) Methylation in Control 5.17E-02 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC25A17 in colorectal cancer [ 6 ]

Location

 TSS1500 (cg15275890)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.01E+00 Statistic Test p-value:1.53E-04; Z-score:-6.44E-01

Methylation in Case

 8.96E-01 (Median) Methylation in Control 9.06E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC25A17 in colorectal cancer [ 6 ]

Location

 TSS1500 (cg26356892)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.30E+00 Statistic Test p-value:5.39E-03; Z-score:-7.72E-01

Methylation in Case

 1.13E-01 (Median) Methylation in Control 1.47E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC25A17 in colorectal cancer [ 6 ]

Location

 TSS200 (cg21694044)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.17E+00 Statistic Test p-value:5.14E-06; Z-score:9.33E-01

Methylation in Case

 8.41E-02 (Median) Methylation in Control 7.16E-02 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC25A17 in colorectal cancer [ 6 ]

Location

 Body (cg10954454)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.06E+00 Statistic Test p-value:8.75E-08; Z-score:-1.67E+00

Methylation in Case

 6.60E-01 (Median) Methylation in Control 7.03E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC25A17 in colorectal cancer [ 6 ]

Location

 Body (cg26548134)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.00E+00 Statistic Test p-value:6.75E-03; Z-score:3.48E-01

Methylation in Case

 9.44E-01 (Median) Methylation in Control 9.41E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC25A17 in colorectal cancer [ 6 ]

Location

 Body (cg26688803)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.04E+00 Statistic Test p-value:3.30E-02; Z-score:4.70E-01

Methylation in Case

 1.53E-01 (Median) Methylation in Control 1.47E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon7

 Methylation of SLC25A17 in colorectal cancer [ 6 ]

Location

 Body (cg06342838)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.00E+00 Statistic Test p-value:3.58E-02; Z-score:3.80E-01

Methylation in Case

 9.66E-01 (Median) Methylation in Control 9.64E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC25A17 in hepatocellular carcinoma [ 7 ]

Location

 TSS1500 (cg15275890)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.06E+00 Statistic Test p-value:8.91E-08; Z-score:-7.64E-01

Methylation in Case

 7.79E-01 (Median) Methylation in Control 8.26E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC25A17 in hepatocellular carcinoma [ 7 ]

Location

 TSS1500 (cg23558213)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.23E+00 Statistic Test p-value:1.83E-03; Z-score:-9.99E-01

Methylation in Case

 2.20E-01 (Median) Methylation in Control 2.72E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC25A17 in hepatocellular carcinoma [ 7 ]

Location

 Body (cg23013931)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.07E+00 Statistic Test p-value:2.07E-03; Z-score:-6.00E-01

Methylation in Case

 6.52E-02 (Median) Methylation in Control 6.97E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC25A17 in hepatocellular carcinoma [ 7 ]

Location

 Body (cg05123106)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.00E+00 Statistic Test p-value:2.35E-02; Z-score:-3.55E-02

Methylation in Case

 8.35E-01 (Median) Methylation in Control 8.36E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  HIV infection

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC25A17 in HIV infection [ 8 ]

Location

 TSS1500 (cg23558213)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.56E+00 Statistic Test p-value:2.05E-05; Z-score:2.08E+00

Methylation in Case

 3.07E-01 (Median) Methylation in Control 1.96E-01 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC25A17 in HIV infection [ 8 ]

Location

 Body (cg26548134)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.06E+00 Statistic Test p-value:3.37E-03; Z-score:-8.33E-01

Methylation in Case

 7.48E-01 (Median) Methylation in Control 7.96E-01 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC25A17 in HIV infection [ 8 ]

Location

 Body (cg23013931)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.04E+00 Statistic Test p-value:1.15E-02; Z-score:-3.29E-01

Methylation in Case

 7.86E-02 (Median) Methylation in Control 8.20E-02 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC25A17 in HIV infection [ 8 ]

Location

 Body (cg08157194)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.00E+00 Statistic Test p-value:3.30E-02; Z-score:2.15E-01

Methylation in Case

 8.99E-01 (Median) Methylation in Control 8.95E-01 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC25A17 in HIV infection [ 8 ]

Location

 Body (cg26688803)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.06E+00 Statistic Test p-value:3.72E-02; Z-score:-4.37E-01

Methylation in Case

 8.81E-02 (Median) Methylation in Control 9.32E-02 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC25A17 in HIV infection [ 8 ]

Location

 Body (cg05123106)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.03E+00 Statistic Test p-value:3.88E-02; Z-score:-8.29E-01

Methylation in Case

 8.78E-01 (Median) Methylation in Control 9.03E-01 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC25A17 in papillary thyroid cancer [ 9 ]

Location

 TSS1500 (cg26356892)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.13E+00 Statistic Test p-value:2.85E-02; Z-score:-5.62E-01

Methylation in Case

 1.42E-01 (Median) Methylation in Control 1.61E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC25A17 in papillary thyroid cancer [ 9 ]

Location

 TSS200 (cg25201783)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.06E+00 Statistic Test p-value:4.37E-02; Z-score:-3.37E-01

Methylation in Case

 7.09E-02 (Median) Methylation in Control 7.50E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Prostate cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC25A17 in prostate cancer [ 10 ]

Location

 TSS1500 (cg15275890)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.03E+00 Statistic Test p-value:1.03E-02; Z-score:2.11E+00

Methylation in Case

 9.41E-01 (Median) Methylation in Control 9.16E-01 (Median)

Studied Phenotype

 Prostate cancer[ ICD-11:2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC25A17 in prostate cancer [ 10 ]

Location

 TSS200 (cg12799349)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.37E+00 Statistic Test p-value:5.15E-04; Z-score:5.09E+00

Methylation in Case

 1.30E-01 (Median) Methylation in Control 9.48E-02 (Median)

Studied Phenotype

 Prostate cancer[ ICD-11:2C82]

Experimental Material

 Patient tissue samples

  Depression

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC25A17 in depression [ 11 ]

Location

 TSS200 (cg13836920)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.05E+00 Statistic Test p-value:3.75E-02; Z-score:3.86E-01

Methylation in Case

 3.77E-02 (Median) Methylation in Control 3.58E-02 (Median)

Studied Phenotype

 Depression[ ICD-11:6A8Z]

Experimental Material

 Patient tissue samples

  Atypical teratoid rhabdoid tumor

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC25A17 in atypical teratoid rhabdoid tumor [ 12 ]

Location

 1stExon (cg16167174)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.80E+00 Statistic Test p-value:4.78E-18; Z-score:2.61E+00

Methylation in Case

 6.16E-01 (Median) Methylation in Control 3.42E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC25A17 in atypical teratoid rhabdoid tumor [ 12 ]

Location

 Body (cg03888645)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.56E+00 Statistic Test p-value:4.64E-04; Z-score:-4.80E-01

Methylation in Case

 8.19E-02 (Median) Methylation in Control 1.28E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC25A17 in atypical teratoid rhabdoid tumor [ 12 ]

Location

 Body (cg05123106)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.09E+00 Statistic Test p-value:1.25E-03; Z-score:-7.58E-01

Methylation in Case

 8.09E-01 (Median) Methylation in Control 8.86E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC25A17 in atypical teratoid rhabdoid tumor [ 12 ]

Location

 Body (cg06342838)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.54E+00 Statistic Test p-value:2.30E-03; Z-score:-9.17E-01

Methylation in Case

 2.31E-01 (Median) Methylation in Control 3.56E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC25A17 in atypical teratoid rhabdoid tumor [ 12 ]

Location

 Body (cg08157194)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.04E+00 Statistic Test p-value:5.45E-03; Z-score:2.68E-01

Methylation in Case

 9.16E-01 (Median) Methylation in Control 8.81E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC25A17 in atypical teratoid rhabdoid tumor [ 12 ]

Location

 Body (cg10954454)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.22E+00 Statistic Test p-value:1.93E-02; Z-score:8.24E-01

Methylation in Case

 6.63E-01 (Median) Methylation in Control 5.42E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon7

 Methylation of SLC25A17 in atypical teratoid rhabdoid tumor [ 12 ]

Location

 3'UTR (cg27077316)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.11E+00 Statistic Test p-value:3.29E-09; Z-score:-1.56E+00

Methylation in Case

 7.29E-01 (Median) Methylation in Control 8.08E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  Panic disorder

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC25A17 in panic disorder [ 13 ]

Location

 1stExon (cg16167174)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:9.89E-01 Statistic Test p-value:2.78E-02; Z-score:2.42E-01

Methylation in Case

 -5.46E+00 (Median) Methylation in Control -5.52E+00 (Median)

Studied Phenotype

 Panic disorder[ ICD-11:6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC25A17 in panic disorder [ 13 ]

Location

 Body (cg08157194)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.03E+00 Statistic Test p-value:2.63E-02; Z-score:1.91E-01

Methylation in Case

 3.06E+00 (Median) Methylation in Control 2.98E+00 (Median)

Studied Phenotype

 Panic disorder[ ICD-11:6B01]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC25A17 in systemic lupus erythematosus [ 14 ]

Location

 Body (cg26688803)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.03E+00 Statistic Test p-value:3.14E-02; Z-score:-2.06E-01

Methylation in Case

 1.10E-01 (Median) Methylation in Control 1.14E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

          10 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 miR-196a directly targets SLC25A17 [ 15 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-196a miRNA Mature ID miR-196a-5p

miRNA Sequence

 UAGGUAGUUUCAUGUUGUUGGG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon2

 miR-2276 directly targets SLC25A17 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-2276 miRNA Mature ID miR-2276-5p

miRNA Sequence

 GCCCUCUGUCACCUUGCAGACG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon3

 miR-4433a directly targets SLC25A17 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4433a miRNA Mature ID miR-4433a-3p

miRNA Sequence

 ACAGGAGUGGGGGUGGGACAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon4

 miR-4469 directly targets SLC25A17 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4469 miRNA Mature ID miR-4469

miRNA Sequence

 GCUCCCUCUAGGGUCGCUCGGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon5

 miR-4496 directly targets SLC25A17 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4496 miRNA Mature ID miR-4496

miRNA Sequence

 GAGGAAACUGAAGCUGAGAGGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon6

 miR-4768 directly targets SLC25A17 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4768 miRNA Mature ID miR-4768-3p

miRNA Sequence

 CCAGGAGAUCCAGAGAGAAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon7

 miR-526b directly targets SLC25A17 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-526b miRNA Mature ID miR-526b-5p

miRNA Sequence

 CUCUUGAGGGAAGCACUUUCUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon8

 miR-642a directly targets SLC25A17 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-642a miRNA Mature ID miR-642a-5p

miRNA Sequence

 GUCCCUCUCCAAAUGUGUCUUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon9

 miR-6892 directly targets SLC25A17 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6892 miRNA Mature ID miR-6892-3p

miRNA Sequence

 UCCCUCUCCCACCCCUUGCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon10

 miR-766 directly targets SLC25A17 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-766 miRNA Mature ID miR-766-5p

miRNA Sequence

 AGGAGGAAUUGGUGCUGGUCUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
2 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
3 DNA Methylation Dynamics in Urological Tumors.
4 Genome-wide Scan for Methylation Profiles in Breast Cancer
5 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
6 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
7 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
8 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
9 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
10 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
11 DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
12 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
13 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
14 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
15 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
16 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.