Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0173 Transporter Info | ||||
| Gene Name | SLC25A15 | ||||
| Transporter Name | Mitochondrial ornithine transporter 1 | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
Methylation |
|||||
|
Bladder cancer |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC25A15 in bladder cancer | [ 1 ] | |||
|
Location |
5'UTR (cg16989646) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.48E+00 | Statistic Test | p-value:1.83E-02; Z-score:-2.03E+00 | ||
|
Methylation in Case |
1.80E-01 (Median) | Methylation in Control | 2.65E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC25A15 in bladder cancer | [ 1 ] | |||
|
Location |
TSS1500 (cg06567155) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:6.10E-03; Z-score:-1.92E+00 | ||
|
Methylation in Case |
8.83E-01 (Median) | Methylation in Control | 8.98E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Breast cancer |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC25A15 in breast cancer | [ 2 ] | |||
|
Location |
5'UTR (cg23211791) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.01E+00 | Statistic Test | p-value:2.50E-11; Z-score:2.88E+00 | ||
|
Methylation in Case |
1.87E-01 (Median) | Methylation in Control | 9.31E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC25A15 in breast cancer | [ 2 ] | |||
|
Location |
5'UTR (cg16989646) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.88E+00 | Statistic Test | p-value:3.76E-11; Z-score:3.16E+00 | ||
|
Methylation in Case |
3.12E-01 (Median) | Methylation in Control | 1.67E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC25A15 in breast cancer | [ 2 ] | |||
|
Location |
5'UTR (cg10328297) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:1.81E-04; Z-score:-6.23E-01 | ||
|
Methylation in Case |
6.20E-01 (Median) | Methylation in Control | 6.49E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC25A15 in breast cancer | [ 2 ] | |||
|
Location |
TSS1500 (cg06567155) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.09E+00 | Statistic Test | p-value:1.11E-04; Z-score:-1.14E+00 | ||
|
Methylation in Case |
8.29E-01 (Median) | Methylation in Control | 9.03E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Renal cell carcinoma |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC25A15 in clear cell renal cell carcinoma | [ 3 ] | |||
|
Location |
5'UTR (cg16989646) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.10E+00 | Statistic Test | p-value:9.32E-07; Z-score:1.57E+00 | ||
|
Methylation in Case |
3.15E-01 (Median) | Methylation in Control | 1.50E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC25A15 in clear cell renal cell carcinoma | [ 3 ] | |||
|
Location |
5'UTR (cg23211791) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.87E+00 | Statistic Test | p-value:1.48E-06; Z-score:1.60E+00 | ||
|
Methylation in Case |
1.29E-01 (Median) | Methylation in Control | 4.51E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Hepatocellular carcinoma |
5 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC25A15 in hepatocellular carcinoma | [ 4 ] | |||
|
Location |
5'UTR (cg23211791) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.55E+00 | Statistic Test | p-value:6.08E-06; Z-score:-1.21E+00 | ||
|
Methylation in Case |
1.37E-01 (Median) | Methylation in Control | 2.12E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC25A15 in hepatocellular carcinoma | [ 4 ] | |||
|
Location |
5'UTR (cg16989646) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.31E+00 | Statistic Test | p-value:3.56E-05; Z-score:-9.99E-01 | ||
|
Methylation in Case |
2.67E-01 (Median) | Methylation in Control | 3.50E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC25A15 in hepatocellular carcinoma | [ 4 ] | |||
|
Location |
TSS1500 (cg06567155) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:1.45E-07; Z-score:-1.15E+00 | ||
|
Methylation in Case |
8.51E-01 (Median) | Methylation in Control | 8.75E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC25A15 in hepatocellular carcinoma | [ 4 ] | |||
|
Location |
Body (cg25528709) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.15E+00 | Statistic Test | p-value:1.43E-25; Z-score:2.00E+00 | ||
|
Methylation in Case |
9.50E-01 (Median) | Methylation in Control | 8.25E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC25A15 in hepatocellular carcinoma | [ 4 ] | |||
|
Location |
Body (cg08737116) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.53E+00 | Statistic Test | p-value:2.87E-10; Z-score:-1.42E+00 | ||
|
Methylation in Case |
1.80E-01 (Median) | Methylation in Control | 2.74E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Lung adenocarcinoma |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC25A15 in lung adenocarcinoma | [ 5 ] | |||
|
Location |
5'UTR (cg16989646) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.30E+00 | Statistic Test | p-value:1.95E-04; Z-score:2.48E+00 | ||
|
Methylation in Case |
4.48E-01 (Median) | Methylation in Control | 3.46E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC25A15 in lung adenocarcinoma | [ 5 ] | |||
|
Location |
5'UTR (cg23211791) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.54E+00 | Statistic Test | p-value:1.22E-03; Z-score:3.75E+00 | ||
|
Methylation in Case |
3.43E-01 (Median) | Methylation in Control | 2.23E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC25A15 in lung adenocarcinoma | [ 5 ] | |||
|
Location |
TSS200 (cg18335740) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.23E+00 | Statistic Test | p-value:4.13E-02; Z-score:2.68E+00 | ||
|
Methylation in Case |
3.27E-01 (Median) | Methylation in Control | 2.65E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Pancretic ductal adenocarcinoma |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC25A15 in pancretic ductal adenocarcinoma | [ 6 ] | |||
|
Location |
TSS1500 (cg20942339) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.12E+00 | Statistic Test | p-value:3.21E-02; Z-score:-7.44E-01 | ||
|
Methylation in Case |
4.57E-02 (Median) | Methylation in Control | 5.13E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC25A15 in pancretic ductal adenocarcinoma | [ 6 ] | |||
|
Location |
Body (cg17002851) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.17E+00 | Statistic Test | p-value:9.24E-07; Z-score:1.73E+00 | ||
|
Methylation in Case |
7.50E-01 (Median) | Methylation in Control | 6.39E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC25A15 in pancretic ductal adenocarcinoma | [ 6 ] | |||
|
Location |
Body (cg12651599) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:2.26E-06; Z-score:-6.39E-01 | ||
|
Methylation in Case |
8.70E-01 (Median) | Methylation in Control | 8.81E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colon cancer |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC25A15 in colon adenocarcinoma | [ 7 ] | |||
|
Location |
Body (cg02426464) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.20E+00 | Statistic Test | p-value:1.23E-06; Z-score:-1.91E+00 | ||
|
Methylation in Case |
3.30E-01 (Median) | Methylation in Control | 3.96E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC25A15 in colon adenocarcinoma | [ 7 ] | |||
|
Location |
Body (cg27082881) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.23E+00 | Statistic Test | p-value:1.73E-06; Z-score:-3.60E+00 | ||
|
Methylation in Case |
5.39E-01 (Median) | Methylation in Control | 6.63E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Prostate cancer |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC25A15 in prostate cancer | [ 8 ] | |||
|
Location |
Body (cg07287345) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.12E+00 | Statistic Test | p-value:1.95E-02; Z-score:2.37E+00 | ||
|
Methylation in Case |
9.55E-01 (Median) | Methylation in Control | 8.51E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC25A15 in prostate cancer | [ 8 ] | |||
|
Location |
Body (cg05887366) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.11E+00 | Statistic Test | p-value:2.06E-02; Z-score:2.16E+00 | ||
|
Methylation in Case |
8.77E-01 (Median) | Methylation in Control | 7.93E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
microRNA |
|||||
|
Unclear Phenotype |
28 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
miR-1227 directly targets SLC25A15 | [ 9 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1227 | miRNA Mature ID | miR-1227-3p | ||
|
miRNA Sequence |
CGUGCCACCCUUUUCCCCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon2 |
miR-1295b directly targets SLC25A15 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1295b | miRNA Mature ID | miR-1295b-3p | ||
|
miRNA Sequence |
AAUAGGCCACGGAUCUGGGCAA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon3 |
miR-193b directly targets SLC25A15 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
|
miRNA Stemloop ID |
miR-193b | miRNA Mature ID | miR-193b-3p | ||
|
miRNA Sequence |
AACUGGCCCUCAAAGUCCCGCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
miR-1976 directly targets SLC25A15 | [ 9 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1976 | miRNA Mature ID | miR-1976 | ||
|
miRNA Sequence |
CCUCCUGCCCUCCUUGCUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon5 |
miR-218 directly targets SLC25A15 | [ 12 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-218 | miRNA Mature ID | miR-218-5p | ||
|
miRNA Sequence |
UUGUGCUUGAUCUAACCAUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon6 |
miR-24 directly targets SLC25A15 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
|
miRNA Stemloop ID |
miR-24 | miRNA Mature ID | miR-24-3p | ||
|
miRNA Sequence |
UGGCUCAGUUCAGCAGGAACAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon7 |
miR-3176 directly targets SLC25A15 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3176 | miRNA Mature ID | miR-3176 | ||
|
miRNA Sequence |
ACUGGCCUGGGACUACCGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon8 |
miR-3186 directly targets SLC25A15 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3186 | miRNA Mature ID | miR-3186-5p | ||
|
miRNA Sequence |
CAGGCGUCUGUCUACGUGGCUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon9 |
miR-3922 directly targets SLC25A15 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3922 | miRNA Mature ID | miR-3922-3p | ||
|
miRNA Sequence |
UCUGGCCUUGACUUGACUCUUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon10 |
miR-423 directly targets SLC25A15 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
|
miRNA Stemloop ID |
miR-423 | miRNA Mature ID | miR-423-3p | ||
|
miRNA Sequence |
AGCUCGGUCUGAGGCCCCUCAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon11 |
miR-4252 directly targets SLC25A15 | [ 9 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4252 | miRNA Mature ID | miR-4252 | ||
|
miRNA Sequence |
GGCCACUGAGUCAGCACCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon12 |
miR-4279 directly targets SLC25A15 | [ 9 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4279 | miRNA Mature ID | miR-4279 | ||
|
miRNA Sequence |
CUCUCCUCCCGGCUUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon13 |
miR-4537 directly targets SLC25A15 | [ 9 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4537 | miRNA Mature ID | miR-4537 | ||
|
miRNA Sequence |
UGAGCCGAGCUGAGCUUAGCUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon14 |
miR-455 directly targets SLC25A15 | [ 9 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-455 | miRNA Mature ID | miR-455-3p | ||
|
miRNA Sequence |
GCAGUCCAUGGGCAUAUACAC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon15 |
miR-4722 directly targets SLC25A15 | [ 9 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4722 | miRNA Mature ID | miR-4722-3p | ||
|
miRNA Sequence |
ACCUGCCAGCACCUCCCUGCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon16 |
miR-4731 directly targets SLC25A15 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4731 | miRNA Mature ID | miR-4731-5p | ||
|
miRNA Sequence |
UGCUGGGGGCCACAUGAGUGUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon17 |
miR-5089 directly targets SLC25A15 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-5089 | miRNA Mature ID | miR-5089-5p | ||
|
miRNA Sequence |
GUGGGAUUUCUGAGUAGCAUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon18 |
miR-5589 directly targets SLC25A15 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-5589 | miRNA Mature ID | miR-5589-5p | ||
|
miRNA Sequence |
GGCUGGGUGCUCUUGUGCAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon19 |
miR-619 directly targets SLC25A15 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-619 | miRNA Mature ID | miR-619-5p | ||
|
miRNA Sequence |
GCUGGGAUUACAGGCAUGAGCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon20 |
miR-6499 directly targets SLC25A15 | [ 9 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6499 | miRNA Mature ID | miR-6499-3p | ||
|
miRNA Sequence |
AGCAGUGUUUGUUUUGCCCACA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon21 |
miR-6506 directly targets SLC25A15 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6506 | miRNA Mature ID | miR-6506-5p | ||
|
miRNA Sequence |
ACUGGGAUGUCACUGAAUAUGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon22 |
miR-6516 directly targets SLC25A15 | [ 9 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6516 | miRNA Mature ID | miR-6516-5p | ||
|
miRNA Sequence |
UUUGCAGUAACAGGUGUGAGCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon23 |
miR-668 directly targets SLC25A15 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-668 | miRNA Mature ID | miR-668-5p | ||
|
miRNA Sequence |
UGCGCCUCGGGUGAGCAUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon24 |
miR-6720 directly targets SLC25A15 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6720 | miRNA Mature ID | miR-6720-3p | ||
|
miRNA Sequence |
CGCGCCUGCAGGAACUGGUAGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon25 |
miR-6727 directly targets SLC25A15 | [ 9 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6727 | miRNA Mature ID | miR-6727-3p | ||
|
miRNA Sequence |
UCCUGCCACCUCCUCCGCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon26 |
miR-6747 directly targets SLC25A15 | [ 9 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6747 | miRNA Mature ID | miR-6747-3p | ||
|
miRNA Sequence |
UCCUGCCUUCCUCUGCACCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon27 |
miR-6807 directly targets SLC25A15 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6807 | miRNA Mature ID | miR-6807-5p | ||
|
miRNA Sequence |
GUGAGCCAGUGGAAUGGAGAGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon28 |
miR-7-5p directly targets SLC25A15 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
|
miRNA Stemloop ID |
miR-7-5p | miRNA Mature ID | miR-7-5p | ||
|
miRNA Sequence |
UGGAAGACUAGUGAUUUUGUUGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.