General Information of Drug Transporter (DT)
DT ID DTD0170 Transporter Info
Gene Name SLC25A12
Transporter Name Calcium-binding mitochondrial carrier protein Aralar1
Gene ID
8604
UniProt ID
O75746
Epigenetic Regulations of This DT (EGR)

Methylation

  Hepatocellular carcinoma

         12 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A12 in hepatocellular carcinoma [ 1 ]

Location

TSS1500 (cg08856772)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.01E+00 Statistic Test p-value:9.54E-06; Z-score:5.25E-02

Methylation in Case

7.22E-02 (Median) Methylation in Control 7.14E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A12 in hepatocellular carcinoma [ 1 ]

Location

TSS1500 (cg03539474)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.14E+00 Statistic Test p-value:2.58E-05; Z-score:6.84E-01

Methylation in Case

5.91E-02 (Median) Methylation in Control 5.17E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC25A12 in hepatocellular carcinoma [ 1 ]

Location

TSS1500 (cg27230724)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.06E+00 Statistic Test p-value:3.95E-05; Z-score:5.98E-01

Methylation in Case

8.94E-02 (Median) Methylation in Control 8.40E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC25A12 in hepatocellular carcinoma [ 1 ]

Location

TSS200 (cg07751764)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.30E+00 Statistic Test p-value:3.77E-10; Z-score:-1.39E+00

Methylation in Case

4.04E-01 (Median) Methylation in Control 5.25E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC25A12 in hepatocellular carcinoma [ 1 ]

Location

TSS200 (cg20104535)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:1.41E-05; Z-score:2.29E-01

Methylation in Case

7.36E-02 (Median) Methylation in Control 7.03E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC25A12 in hepatocellular carcinoma [ 1 ]

Location

TSS200 (cg19655006)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.06E+00 Statistic Test p-value:1.50E-05; Z-score:9.02E-02

Methylation in Case

3.05E-02 (Median) Methylation in Control 2.88E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC25A12 in hepatocellular carcinoma [ 1 ]

Location

1stExon (cg03770593)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.11E+00 Statistic Test p-value:4.76E-06; Z-score:3.94E-01

Methylation in Case

1.02E-01 (Median) Methylation in Control 9.19E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC25A12 in hepatocellular carcinoma [ 1 ]

Location

Body (cg00040027)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:2.41E-06; Z-score:-9.05E-01

Methylation in Case

8.16E-01 (Median) Methylation in Control 8.49E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC25A12 in hepatocellular carcinoma [ 1 ]

Location

Body (cg19931596)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:2.50E-05; Z-score:-1.32E+00

Methylation in Case

8.12E-01 (Median) Methylation in Control 8.39E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC25A12 in hepatocellular carcinoma [ 1 ]

Location

Body (cg10446968)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:6.10E-04; Z-score:-1.45E-01

Methylation in Case

8.92E-02 (Median) Methylation in Control 9.15E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC25A12 in hepatocellular carcinoma [ 1 ]

Location

Body (cg23262213)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:1.64E-02; Z-score:-2.49E-01

Methylation in Case

8.36E-01 (Median) Methylation in Control 8.48E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC25A12 in hepatocellular carcinoma [ 1 ]

Location

3'UTR (cg22166516)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:4.32E-04; Z-score:-6.99E-01

Methylation in Case

8.66E-01 (Median) Methylation in Control 8.82E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Pancretic ductal adenocarcinoma

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A12 in pancretic ductal adenocarcinoma [ 2 ]

Location

TSS1500 (cg03616221)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.29E+00 Statistic Test p-value:3.49E-08; Z-score:1.38E+00

Methylation in Case

3.37E-01 (Median) Methylation in Control 2.62E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A12 in pancretic ductal adenocarcinoma [ 2 ]

Location

Body (cg08832227)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.53E+00 Statistic Test p-value:3.77E-20; Z-score:3.29E+00

Methylation in Case

5.77E-01 (Median) Methylation in Control 3.78E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC25A12 in pancretic ductal adenocarcinoma [ 2 ]

Location

Body (cg21216258)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:7.29E-06; Z-score:-7.20E-01

Methylation in Case

7.60E-01 (Median) Methylation in Control 8.01E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC25A12 in pancretic ductal adenocarcinoma [ 2 ]

Location

Body (cg16997104)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:9.77E-03; Z-score:-1.16E+00

Methylation in Case

7.92E-01 (Median) Methylation in Control 8.63E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Panic disorder

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A12 in panic disorder [ 3 ]

Location

TSS1500 (cg27230724)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:9.74E-01 Statistic Test p-value:4.24E-02; Z-score:4.19E-01

Methylation in Case

-4.13E+00 (Median) Methylation in Control -4.24E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A12 in panic disorder [ 3 ]

Location

Body (cg04337734)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-6.96E-01 Statistic Test p-value:4.64E-02; Z-score:-1.29E-01

Methylation in Case

-1.64E-01 (Median) Methylation in Control -1.14E-01 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A12 in papillary thyroid cancer [ 4 ]

Location

TSS1500 (cg03539474)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:3.76E-02; Z-score:-4.37E-01

Methylation in Case

4.71E-02 (Median) Methylation in Control 5.00E-02 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A12 in papillary thyroid cancer [ 4 ]

Location

Body (cg04337734)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:6.93E-05; Z-score:-6.70E-01

Methylation in Case

8.71E-01 (Median) Methylation in Control 8.84E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC25A12 in papillary thyroid cancer [ 4 ]

Location

Body (cg23098068)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:3.85E-03; Z-score:7.46E-01

Methylation in Case

7.38E-01 (Median) Methylation in Control 7.05E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Prostate cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A12 in prostate cancer [ 5 ]

Location

TSS1500 (cg03561565)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.88E+00 Statistic Test p-value:3.07E-04; Z-score:4.98E+00

Methylation in Case

7.65E-01 (Median) Methylation in Control 4.08E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Systemic lupus erythematosus

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A12 in systemic lupus erythematosus [ 6 ]

Location

TSS1500 (cg08856772)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:2.25E-02; Z-score:-1.51E-01

Methylation in Case

7.36E-02 (Median) Methylation in Control 7.62E-02 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Breast cancer

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A12 in breast cancer [ 7 ]

Location

TSS200 (cg20104535)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:2.60E-02; Z-score:-3.49E-01

Methylation in Case

6.11E-02 (Median) Methylation in Control 6.51E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A12 in breast cancer [ 7 ]

Location

Body (cg23098068)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.33E+00 Statistic Test p-value:2.37E-07; Z-score:1.80E+00

Methylation in Case

5.37E-01 (Median) Methylation in Control 4.04E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC25A12 in breast cancer [ 7 ]

Location

Body (cg04337734)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.14E+00 Statistic Test p-value:2.68E-05; Z-score:1.12E+00

Methylation in Case

7.91E-01 (Median) Methylation in Control 6.92E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC25A12 in breast cancer [ 7 ]

Location

Body (ch.2.3493243F)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.24E+00 Statistic Test p-value:3.10E-04; Z-score:-8.47E-01

Methylation in Case

8.25E-02 (Median) Methylation in Control 1.02E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Renal cell carcinoma

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A12 in clear cell renal cell carcinoma [ 8 ]

Location

TSS200 (cg19655006)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.00E+00 Statistic Test p-value:3.76E-02; Z-score:1.29E-02

Methylation in Case

1.74E-02 (Median) Methylation in Control 1.74E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A12 in clear cell renal cell carcinoma [ 8 ]

Location

Body (cg10446968)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:3.31E-02; Z-score:3.21E-01

Methylation in Case

2.57E-02 (Median) Methylation in Control 2.41E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Colorectal cancer

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A12 in colorectal cancer [ 9 ]

Location

TSS200 (cg19655006)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.22E+00 Statistic Test p-value:1.86E-02; Z-score:-5.23E-01

Methylation in Case

1.46E-02 (Median) Methylation in Control 1.78E-02 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A12 in colorectal cancer [ 9 ]

Location

1stExon (cg03770593)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.08E+00 Statistic Test p-value:7.33E-04; Z-score:5.07E-01

Methylation in Case

8.50E-02 (Median) Methylation in Control 7.86E-02 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC25A12 in colorectal cancer [ 9 ]

Location

Body (ch.2.3493243F)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.96E+00 Statistic Test p-value:8.37E-07; Z-score:2.17E+00

Methylation in Case

4.31E-01 (Median) Methylation in Control 2.20E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Atypical teratoid rhabdoid tumor

           5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A12 in atypical teratoid rhabdoid tumor [ 10 ]

Location

1stExon (cg03770593)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.66E+00 Statistic Test p-value:1.46E-25; Z-score:-3.66E+00

Methylation in Case

5.01E-01 (Median) Methylation in Control 8.30E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A12 in atypical teratoid rhabdoid tumor [ 10 ]

Location

Body (cg00040027)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.36E+00 Statistic Test p-value:1.56E-05; Z-score:-7.15E-01

Methylation in Case

1.09E-01 (Median) Methylation in Control 1.48E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC25A12 in atypical teratoid rhabdoid tumor [ 10 ]

Location

Body (cg04337734)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.03E+00 Statistic Test p-value:7.19E-04; Z-score:5.68E-01

Methylation in Case

9.15E-01 (Median) Methylation in Control 8.91E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC25A12 in atypical teratoid rhabdoid tumor [ 10 ]

Location

Body (cg10446968)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.00E+00 Statistic Test p-value:1.48E-02; Z-score:-1.33E-01

Methylation in Case

9.56E-01 (Median) Methylation in Control 9.59E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC25A12 in atypical teratoid rhabdoid tumor [ 10 ]

Location

3'UTR (cg22166516)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:6.00E-10; Z-score:-1.43E+00

Methylation in Case

7.50E-01 (Median) Methylation in Control 8.31E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  HIV infection

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A12 in HIV infection [ 11 ]

Location

1stExon (cg03770593)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:1.28E-02; Z-score:-5.58E-01

Methylation in Case

6.21E-02 (Median) Methylation in Control 6.77E-02 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A12 in HIV infection [ 11 ]

Location

Body (cg23098068)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.65E+00 Statistic Test p-value:4.14E-08; Z-score:3.43E+00

Methylation in Case

5.67E-01 (Median) Methylation in Control 3.43E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Bladder cancer

           5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A12 in bladder cancer [ 12 ]

Location

Body (cg23098068)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.28E+00 Statistic Test p-value:2.01E-05; Z-score:4.61E+00

Methylation in Case

8.22E-01 (Median) Methylation in Control 6.44E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A12 in bladder cancer [ 12 ]

Location

Body (cg23262213)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:7.28E-04; Z-score:-2.63E+00

Methylation in Case

8.30E-01 (Median) Methylation in Control 8.49E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC25A12 in bladder cancer [ 12 ]

Location

Body (cg19931596)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.17E+00 Statistic Test p-value:5.19E-03; Z-score:2.15E+00

Methylation in Case

8.45E-01 (Median) Methylation in Control 7.23E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC25A12 in bladder cancer [ 12 ]

Location

Body (cg00040027)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:2.41E-02; Z-score:-1.06E+00

Methylation in Case

8.86E-01 (Median) Methylation in Control 9.04E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC25A12 in bladder cancer [ 12 ]

Location

3'UTR (cg22166516)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:4.51E-02; Z-score:-1.73E+00

Methylation in Case

8.86E-01 (Median) Methylation in Control 9.02E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Colon cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A12 in colon adenocarcinoma [ 13 ]

Location

Body (cg13507893)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:4.84E-03; Z-score:-1.51E+00

Methylation in Case

7.27E-01 (Median) Methylation in Control 8.07E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Depression

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A12 in depression [ 14 ]

Location

Body (cg04337734)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:4.08E-02; Z-score:-4.96E-01

Methylation in Case

7.70E-01 (Median) Methylation in Control 7.87E-01 (Median)

Studied Phenotype

Depression[ ICD-11:6A8Z]

Experimental Material

Patient tissue samples

  Lung adenocarcinoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A12 in lung adenocarcinoma [ 15 ]

Location

Body (cg19931596)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.14E+00 Statistic Test p-value:4.26E-02; Z-score:1.71E+00

Methylation in Case

8.27E-01 (Median) Methylation in Control 7.26E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

Histone acetylation

  Hepatocellular carcinoma

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Hyperacetylation of SLC25A12 in hepatocellular carcinoma (compare with normal human hepatocytes) [ 16 ]

Location

Promoter

Epigenetic Type

Histone acetylation Experiment Method Chromatin immunoprecipitation

Related Molecular Changes

Up regulation ofSLC25A12 Experiment Method Western Blot

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Human hepatocellular carcinoma cell line (HepG2)

Additional Notes

SLC25A12 is epigenetically induced in HCC by mechanisms involving histone acetylation but not DNA methylation.

  Epigenetic Phenomenon2

Hyperacetylation of SLC25A12 in hepatocellular carcinoma (compare with normal human hepatocytes) [ 16 ]

Location

Promoter

Epigenetic Type

Histone acetylation Experiment Method Chromatin immunoprecipitation

Related Molecular Changes

Up regulation ofSLC25A12 Experiment Method Western Blot

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Human hepatocellular carcinoma cell line (HepG2)

Additional Notes

SLC25A12 is epigenetically induced in HCC by mechanisms involving histone acetylation but not DNA methylation.

microRNA

  Unclear Phenotype

         51 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

let-7b directly targets SLC25A12 [ 17 ]

Epigenetic Type

microRNA Experiment Method Proteomics

miRNA Stemloop ID

let-7b miRNA Mature ID let-7b-5p

miRNA Sequence

UGAGGUAGUAGGUUGUGUGGUU

miRNA Target Type

Direct

Experimental Material

Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon2

let-7f directly targets SLC25A12 [ 18 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

let-7f miRNA Mature ID let-7f-5p

miRNA Sequence

UGAGGUAGUAGAUUGUAUAGUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon3

miR-100 directly targets SLC25A12 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-100 miRNA Mature ID miR-100-3p

miRNA Sequence

CAAGCUUGUAUCUAUAGGUAUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon4

miR-1267 directly targets SLC25A12 [ 20 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1267 miRNA Mature ID miR-1267

miRNA Sequence

CCUGUUGAAGUGUAAUCCCCA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon5

miR-1277 directly targets SLC25A12 [ 20 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1277 miRNA Mature ID miR-1277-5p

miRNA Sequence

AAAUAUAUAUAUAUAUGUACGUAU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon6

miR-129-1 directly targets SLC25A12 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-129-1 miRNA Mature ID miR-129-1-3p

miRNA Sequence

AAGCCCUUACCCCAAAAAGUAU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon7

miR-129-2 directly targets SLC25A12 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-129-2 miRNA Mature ID miR-129-2-3p

miRNA Sequence

AAGCCCUUACCCCAAAAAGCAU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon8

miR-15a directly targets SLC25A12 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-15a miRNA Mature ID miR-15a-5p

miRNA Sequence

UAGCAGCACAUAAUGGUUUGUG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon9

miR-15b directly targets SLC25A12 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-15b miRNA Mature ID miR-15b-5p

miRNA Sequence

UAGCAGCACAUCAUGGUUUACA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon10

miR-16 directly targets SLC25A12 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-16 miRNA Mature ID miR-16-5p

miRNA Sequence

UAGCAGCACGUAAAUAUUGGCG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon11

miR-190a directly targets SLC25A12 [ 20 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-190a miRNA Mature ID miR-190a-3p

miRNA Sequence

CUAUAUAUCAAACAUAUUCCU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon12

miR-195 directly targets SLC25A12 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-195 miRNA Mature ID miR-195-5p

miRNA Sequence

UAGCAGCACAGAAAUAUUGGC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon13

miR-19a directly targets SLC25A12 [ 22 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-19a miRNA Mature ID miR-19a-3p

miRNA Sequence

UGUGCAAAUCUAUGCAAAACUGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon14

miR-19b directly targets SLC25A12 [ 22 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-19b miRNA Mature ID miR-19b-3p

miRNA Sequence

UGUGCAAAUCCAUGCAAAACUGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon15

miR-297 directly targets SLC25A12 [ 20 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-297 miRNA Mature ID miR-297

miRNA Sequence

AUGUAUGUGUGCAUGUGCAUG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon16

miR-30c directly targets SLC25A12 [ 18 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-30c miRNA Mature ID miR-30c-5p

miRNA Sequence

UGUAAACAUCCUACACUCUCAGC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon17

miR-3177 directly targets SLC25A12 [ 20 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3177 miRNA Mature ID miR-3177-5p

miRNA Sequence

UGUGUACACACGUGCCAGGCGCU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon18

miR-320b directly targets SLC25A12 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-320b miRNA Mature ID miR-320b

miRNA Sequence

AAAAGCUGGGUUGAGAGGGCAA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon19

miR-320c directly targets SLC25A12 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-320c miRNA Mature ID miR-320c

miRNA Sequence

AAAAGCUGGGUUGAGAGGGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon20

miR-320d directly targets SLC25A12 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-320d miRNA Mature ID miR-320d

miRNA Sequence

AAAAGCUGGGUUGAGAGGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon21

miR-3613 directly targets SLC25A12 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3613 miRNA Mature ID miR-3613-3p

miRNA Sequence

ACAAAAAAAAAAGCCCAACCCUUC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon22

miR-367 directly targets SLC25A12 [ 20 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-367 miRNA Mature ID miR-367-5p

miRNA Sequence

ACUGUUGCUAAUAUGCAACUCU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon23

miR-3924 directly targets SLC25A12 [ 20 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3924 miRNA Mature ID miR-3924

miRNA Sequence

AUAUGUAUAUGUGACUGCUACU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon24

miR-424 directly targets SLC25A12 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-424 miRNA Mature ID miR-424-5p

miRNA Sequence

CAGCAGCAAUUCAUGUUUUGAA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon25

miR-4429 directly targets SLC25A12 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4429 miRNA Mature ID miR-4429

miRNA Sequence

AAAAGCUGGGCUGAGAGGCG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon26

miR-4432 directly targets SLC25A12 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4432 miRNA Mature ID miR-4432

miRNA Sequence

AAAGACUCUGCAAGAUGCCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon27

miR-4524a directly targets SLC25A12 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4524a miRNA Mature ID miR-4524a-5p

miRNA Sequence

AUAGCAGCAUGAACCUGUCUCA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon28

miR-4524b directly targets SLC25A12 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4524b miRNA Mature ID miR-4524b-5p

miRNA Sequence

AUAGCAGCAUAAGCCUGUCUC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon29

miR-4687 directly targets SLC25A12 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4687 miRNA Mature ID miR-4687-5p

miRNA Sequence

CAGCCCUCCUCCCGCACCCAAA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon30

miR-4777 directly targets SLC25A12 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4777 miRNA Mature ID miR-4777-3p

miRNA Sequence

AUACCUCAUCUAGAAUGCUGUA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon31

miR-4789 directly targets SLC25A12 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4789 miRNA Mature ID miR-4789-3p

miRNA Sequence

CACACAUAGCAGGUGUAUAUA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon32

miR-493 directly targets SLC25A12 [ 20 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-493 miRNA Mature ID miR-493-5p

miRNA Sequence

UUGUACAUGGUAGGCUUUCAUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon33

miR-494 directly targets SLC25A12 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-494 miRNA Mature ID miR-494-3p

miRNA Sequence

UGAAACAUACACGGGAAACCUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon34

miR-497 directly targets SLC25A12 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-497 miRNA Mature ID miR-497-5p

miRNA Sequence

CAGCAGCACACUGUGGUUUGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon35

miR-499a directly targets SLC25A12 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-499a miRNA Mature ID miR-499a-5p

miRNA Sequence

UUAAGACUUGCAGUGAUGUUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon36

miR-5011 directly targets SLC25A12 [ 20 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-5011 miRNA Mature ID miR-5011-5p

miRNA Sequence

UAUAUAUACAGCCAUGCACUC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon37

miR-503 directly targets SLC25A12 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-503 miRNA Mature ID miR-503-5p

miRNA Sequence

UAGCAGCGGGAACAGUUCUGCAG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon38

miR-505 directly targets SLC25A12 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-505 miRNA Mature ID miR-505-3p

miRNA Sequence

CGUCAACACUUGCUGGUUUCCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon39

miR-510 directly targets SLC25A12 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-510 miRNA Mature ID miR-510-3p

miRNA Sequence

AUUGAAACCUCUAAGAGUGGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon40

miR-511 directly targets SLC25A12 [ 20 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-511 miRNA Mature ID miR-511-3p

miRNA Sequence

AAUGUGUAGCAAAAGACAGA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon41

miR-545 directly targets SLC25A12 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-545 miRNA Mature ID miR-545-3p

miRNA Sequence

UCAGCAAACAUUUAUUGUGUGC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon42

miR-548p directly targets SLC25A12 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-548p miRNA Mature ID miR-548p

miRNA Sequence

UAGCAAAAACUGCAGUUACUUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon43

miR-5580 directly targets SLC25A12 [ 20 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-5580 miRNA Mature ID miR-5580-3p

miRNA Sequence

CACAUAUGAAGUGAGCCAGCAC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon44

miR-567 directly targets SLC25A12 [ 20 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-567 miRNA Mature ID miR-567

miRNA Sequence

AGUAUGUUCUUCCAGGACAGAAC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon45

miR-646 directly targets SLC25A12 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-646 miRNA Mature ID miR-646

miRNA Sequence

AAGCAGCUGCCUCUGAGGC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon46

miR-6779 directly targets SLC25A12 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6779 miRNA Mature ID miR-6779-3p

miRNA Sequence

AAGCCCUGUCUCCUCCCAUCU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon47

miR-6838 directly targets SLC25A12 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6838 miRNA Mature ID miR-6838-5p

miRNA Sequence

AAGCAGCAGUGGCAAGACUCCU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon48

miR-6867 directly targets SLC25A12 [ 20 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6867 miRNA Mature ID miR-6867-5p

miRNA Sequence

UGUGUGUGUAGAGGAAGAAGGGA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon49

miR-766 directly targets SLC25A12 [ 18 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-766 miRNA Mature ID miR-766-3p

miRNA Sequence

ACUCCAGCCCCACAGCCUCAGC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon50

miR-8087 directly targets SLC25A12 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-8087 miRNA Mature ID miR-8087

miRNA Sequence

GAAGACUUCUUGGAUUACAGGGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon51

miR-9 directly targets SLC25A12 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-9 miRNA Mature ID miR-9-3p

miRNA Sequence

AUAAAGCUAGAUAACCGAAAGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human
References
1 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
2 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
3 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
4 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
5 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
6 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
7 Genome-wide Scan for Methylation Profiles in Breast Cancer
8 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
9 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
10 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
11 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
12 DNA Methylation Dynamics in Urological Tumors.
13 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
14 DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
15 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
16 Epigenetic upregulation and functional role of the mitochondrial aspartate/glutamate carrier isoform 1 in hepatocellular carcinoma. Biochim Biophys Acta Mol Basis Dis. 2019 Jan;1865(1):38-47.
17 Widespread changes in protein synthesis induced by microRNAs. Nature. 2008 Sep 4;455(7209):58-63.
18 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
19 The viral and cellular microRNA targetome in lymphoblastoid cell lines. PLoS Pathog. 2012 Jan;8(1):e1002484.
20 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
21 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
22 EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.