Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0160 Transporter Info | ||||
| Gene Name | SLC23A3 | ||||
| Transporter Name | Na(+)/L-ascorbic acid transporter 3 | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
microRNA |
|||||
|
Unclear Phenotype |
14 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
miR-2054 directly targets SLC23A3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-2054 | miRNA Mature ID | miR-2054 | ||
|
miRNA Sequence |
CUGUAAUAUAAAUUUAAUUUAUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon2 |
miR-24-1 directly targets SLC23A3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-24-1 | miRNA Mature ID | miR-24-1-5p | ||
|
miRNA Sequence |
UGCCUACUGAGCUGAUAUCAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon3 |
miR-24-2 directly targets SLC23A3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-24-2 | miRNA Mature ID | miR-24-2-5p | ||
|
miRNA Sequence |
UGCCUACUGAGCUGAAACACAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon4 |
miR-329 directly targets SLC23A3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-329 | miRNA Mature ID | miR-329-3p | ||
|
miRNA Sequence |
AACACACCUGGUUAACCUCUUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon5 |
miR-362 directly targets SLC23A3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-362 | miRNA Mature ID | miR-362-3p | ||
|
miRNA Sequence |
AACACACCUAUUCAAGGAUUCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon6 |
miR-374c directly targets SLC23A3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-374c | miRNA Mature ID | miR-374c-5p | ||
|
miRNA Sequence |
AUAAUACAACCUGCUAAGUGCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon7 |
miR-380 directly targets SLC23A3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-380 | miRNA Mature ID | miR-380-3p | ||
|
miRNA Sequence |
UAUGUAAUAUGGUCCACAUCUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon8 |
miR-3941 directly targets SLC23A3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3941 | miRNA Mature ID | miR-3941 | ||
|
miRNA Sequence |
UUACACACAACUGAGGAUCAUA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon9 |
miR-4789 directly targets SLC23A3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4789 | miRNA Mature ID | miR-4789-3p | ||
|
miRNA Sequence |
CACACAUAGCAGGUGUAUAUA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon10 |
miR-5001 directly targets SLC23A3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-5001 | miRNA Mature ID | miR-5001-3p | ||
|
miRNA Sequence |
UUCUGCCUCUGUCCAGGUCCUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon11 |
miR-603 directly targets SLC23A3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-603 | miRNA Mature ID | miR-603 | ||
|
miRNA Sequence |
CACACACUGCAAUUACUUUUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon12 |
miR-655 directly targets SLC23A3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-655 | miRNA Mature ID | miR-655-3p | ||
|
miRNA Sequence |
AUAAUACAUGGUUAACCUCUUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon13 |
miR-6780a directly targets SLC23A3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6780a | miRNA Mature ID | miR-6780a-3p | ||
|
miRNA Sequence |
CUCCUCUGUUUUCUUUCCUAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon14 |
miR-8485 directly targets SLC23A3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-8485 | miRNA Mature ID | miR-8485 | ||
|
miRNA Sequence |
CACACACACACACACACGUAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Methylation |
|||||
|
Brain neuroblastoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Moderate hypomethylation of SLC23A3 in brain neuroblastoma than that in healthy individual | ||||
Studied Phenotype |
Brain neuroblastoma [ICD-11:2A00.11] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:1.73E-13; Fold-change:-0.267310791; Z-score:-3.090328338 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
| ||||
|
Chordoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Moderate hypomethylation of SLC23A3 in chordoma than that in healthy individual | ||||
Studied Phenotype |
Chordoma [ICD-11:5A61.0] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:0.008828974; Fold-change:-0.227680169; Z-score:-8.982760255 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
| ||||
| References | |||||
|---|---|---|---|---|---|
| 1 | Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32. | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.