Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0151 Transporter Info
Gene Name SLC22A4
Transporter Name Organic cation/carnitine transporter 1
Gene ID
6583
UniProt ID
Q9H015
Epigenetic Regulations of This DT (EGR)

Methylation

  Hepatocellular carcinoma

          10 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC22A4 in hepatocellular carcinoma [ 1 ]

Location

 5'UTR (cg23955881)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.33E+00 Statistic Test p-value:7.22E-11; Z-score:-5.10E+00

Methylation in Case

 5.78E-01 (Median) Methylation in Control 7.68E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC22A4 in hepatocellular carcinoma [ 1 ]

Location

 TSS1500 (cg26922038)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.44E+00 Statistic Test p-value:1.12E-13; Z-score:-3.79E+00

Methylation in Case

 4.81E-01 (Median) Methylation in Control 6.93E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC22A4 in hepatocellular carcinoma [ 1 ]

Location

 TSS1500 (cg13373085)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.23E+00 Statistic Test p-value:1.98E-03; Z-score:-8.38E-01

Methylation in Case

 6.28E-02 (Median) Methylation in Control 7.75E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC22A4 in hepatocellular carcinoma [ 1 ]

Location

 Body (cg11083715)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.28E+00 Statistic Test p-value:1.89E-10; Z-score:-2.47E+00

Methylation in Case

 4.86E-01 (Median) Methylation in Control 6.24E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC22A4 in hepatocellular carcinoma [ 1 ]

Location

 Body (cg25350825)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.03E+00 Statistic Test p-value:2.02E-05; Z-score:-1.23E+00

Methylation in Case

 7.95E-01 (Median) Methylation in Control 8.19E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC22A4 in hepatocellular carcinoma [ 1 ]

Location

 Body (cg16087826)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.01E+00 Statistic Test p-value:1.70E-03; Z-score:-3.58E-01

Methylation in Case

 7.99E-01 (Median) Methylation in Control 8.10E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon7

 Methylation of SLC22A4 in hepatocellular carcinoma [ 1 ]

Location

 Body (cg04470557)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.27E+00 Statistic Test p-value:8.78E-03; Z-score:1.39E+00

Methylation in Case

 5.26E-01 (Median) Methylation in Control 4.15E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon8

 Methylation of SLC22A4 in hepatocellular carcinoma [ 1 ]

Location

 Body (cg26794221)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.03E+00 Statistic Test p-value:3.59E-02; Z-score:-2.19E-01

Methylation in Case

 7.70E-01 (Median) Methylation in Control 7.92E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon9

 Methylation of SLC22A4 in hepatocellular carcinoma [ 1 ]

Location

 Body (cg19848599)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.01E+00 Statistic Test p-value:4.44E-02; Z-score:5.07E-01

Methylation in Case

 9.03E-01 (Median) Methylation in Control 8.92E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon10

 Methylation of SLC22A4 in hepatocellular carcinoma [ 1 ]

Location

 3'UTR (cg01634982)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.19E+00 Statistic Test p-value:6.19E-11; Z-score:-3.70E+00

Methylation in Case

 5.91E-01 (Median) Methylation in Control 7.04E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

          11 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC22A4 in pancretic ductal adenocarcinoma [ 2 ]

Location

 5'UTR (cg22115748)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.06E+00 Statistic Test p-value:1.21E-02; Z-score:-8.76E-01

Methylation in Case

 5.17E-01 (Median) Methylation in Control 5.48E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC22A4 in pancretic ductal adenocarcinoma [ 2 ]

Location

 5'UTR (cg13774987)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.04E+00 Statistic Test p-value:4.98E-02; Z-score:4.13E-01

Methylation in Case

 8.42E-01 (Median) Methylation in Control 8.12E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC22A4 in pancretic ductal adenocarcinoma [ 2 ]

Location

 TSS1500 (cg24302235)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-2.30E+00 Statistic Test p-value:2.28E-07; Z-score:-1.20E+00

Methylation in Case

 1.10E-01 (Median) Methylation in Control 2.52E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC22A4 in pancretic ductal adenocarcinoma [ 2 ]

Location

 TSS1500 (cg04544931)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.42E+00 Statistic Test p-value:5.88E-05; Z-score:-1.24E+00

Methylation in Case

 1.78E-01 (Median) Methylation in Control 2.53E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC22A4 in pancretic ductal adenocarcinoma [ 2 ]

Location

 TSS200 (cg07719512)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.10E+00 Statistic Test p-value:2.89E-07; Z-score:-1.30E+00

Methylation in Case

 5.55E-01 (Median) Methylation in Control 6.13E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC22A4 in pancretic ductal adenocarcinoma [ 2 ]

Location

 TSS200 (cg07888856)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.09E+00 Statistic Test p-value:9.04E-04; Z-score:5.88E-01

Methylation in Case

 4.91E-02 (Median) Methylation in Control 4.50E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon7

 Methylation of SLC22A4 in pancretic ductal adenocarcinoma [ 2 ]

Location

 TSS200 (cg26912984)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.01E+00 Statistic Test p-value:1.39E-03; Z-score:-6.76E-02

Methylation in Case

 1.23E-01 (Median) Methylation in Control 1.24E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon8

 Methylation of SLC22A4 in pancretic ductal adenocarcinoma [ 2 ]

Location

 TSS200 (cg05429359)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.26E+00 Statistic Test p-value:1.40E-03; Z-score:-6.72E-01

Methylation in Case

 1.30E-01 (Median) Methylation in Control 1.63E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon9

 Methylation of SLC22A4 in pancretic ductal adenocarcinoma [ 2 ]

Location

 Body (cg17687493)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:2.37E+00 Statistic Test p-value:2.10E-30; Z-score:6.11E+00

Methylation in Case

 2.59E-01 (Median) Methylation in Control 1.09E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon10

 Methylation of SLC22A4 in pancretic ductal adenocarcinoma [ 2 ]

Location

 Body (cg19777470)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.08E+00 Statistic Test p-value:6.76E-03; Z-score:-3.59E-01

Methylation in Case

 2.01E-01 (Median) Methylation in Control 2.16E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon11

 Methylation of SLC22A4 in pancretic ductal adenocarcinoma [ 2 ]

Location

 Body (cg01019875)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.18E+00 Statistic Test p-value:3.78E-02; Z-score:-5.69E-01

Methylation in Case

 4.51E-01 (Median) Methylation in Control 5.30E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Breast cancer

          11 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC22A4 in breast cancer [ 3 ]

Location

 TSS1500 (cg13373085)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.27E+00 Statistic Test p-value:5.63E-05; Z-score:6.91E-01

Methylation in Case

 6.76E-02 (Median) Methylation in Control 5.33E-02 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC22A4 in breast cancer [ 3 ]

Location

 TSS1500 (cg07354253)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.05E+00 Statistic Test p-value:2.96E-02; Z-score:-3.56E-01

Methylation in Case

 1.06E-01 (Median) Methylation in Control 1.11E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC22A4 in breast cancer [ 3 ]

Location

 TSS200 (cg07810106)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.16E+00 Statistic Test p-value:5.08E-03; Z-score:-3.53E-01

Methylation in Case

 7.07E-02 (Median) Methylation in Control 8.21E-02 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC22A4 in breast cancer [ 3 ]

Location

 TSS200 (cg11387240)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.09E+00 Statistic Test p-value:2.09E-02; Z-score:-3.43E-01

Methylation in Case

 6.32E-02 (Median) Methylation in Control 6.91E-02 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC22A4 in breast cancer [ 3 ]

Location

 1stExon (cg17111895)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.15E+00 Statistic Test p-value:7.36E-03; Z-score:-5.53E-01

Methylation in Case

 5.06E-02 (Median) Methylation in Control 5.83E-02 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC22A4 in breast cancer [ 3 ]

Location

 Body (cg04470557)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-2.76E+00 Statistic Test p-value:4.26E-28; Z-score:-4.08E+00

Methylation in Case

 1.46E-01 (Median) Methylation in Control 4.03E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon7

 Methylation of SLC22A4 in breast cancer [ 3 ]

Location

 Body (cg05231888)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-2.00E+00 Statistic Test p-value:2.90E-23; Z-score:-3.06E+00

Methylation in Case

 1.12E-01 (Median) Methylation in Control 2.25E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon8

 Methylation of SLC22A4 in breast cancer [ 3 ]

Location

 Body (cg19848599)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.29E+00 Statistic Test p-value:9.00E-08; Z-score:1.65E+00

Methylation in Case

 8.18E-01 (Median) Methylation in Control 6.36E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon9

 Methylation of SLC22A4 in breast cancer [ 3 ]

Location

 Body (cg25350825)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.02E+00 Statistic Test p-value:9.67E-04; Z-score:-5.63E-01

Methylation in Case

 8.22E-01 (Median) Methylation in Control 8.41E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon10

 Methylation of SLC22A4 in breast cancer [ 3 ]

Location

 Body (cg16087826)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.06E+00 Statistic Test p-value:7.36E-03; Z-score:-8.24E-01

Methylation in Case

 6.80E-01 (Median) Methylation in Control 7.24E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon11

 Methylation of SLC22A4 in breast cancer [ 3 ]

Location

 3'UTR (cg12468553)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.05E+00 Statistic Test p-value:6.42E-05; Z-score:-1.02E+00

Methylation in Case

 8.01E-01 (Median) Methylation in Control 8.41E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC22A4 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS1500 (cg13373085)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.61E+00 Statistic Test p-value:2.76E-05; Z-score:1.77E+00

Methylation in Case

 2.75E-02 (Median) Methylation in Control 1.71E-02 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC22A4 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS200 (cg11387240)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.19E+00 Statistic Test p-value:1.50E-04; Z-score:8.47E-01

Methylation in Case

 3.02E-02 (Median) Methylation in Control 2.53E-02 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC22A4 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS200 (cg07810106)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.15E+00 Statistic Test p-value:2.84E-04; Z-score:7.17E-01

Methylation in Case

 3.01E-02 (Median) Methylation in Control 2.61E-02 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC22A4 in clear cell renal cell carcinoma [ 4 ]

Location

 Body (cg04470557)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-2.15E+00 Statistic Test p-value:9.26E-08; Z-score:-3.49E+00

Methylation in Case

 1.67E-01 (Median) Methylation in Control 3.58E-01 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC22A4 in clear cell renal cell carcinoma [ 4 ]

Location

 Body (cg05231888)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-2.06E+00 Statistic Test p-value:9.79E-08; Z-score:-2.96E+00

Methylation in Case

 8.75E-02 (Median) Methylation in Control 1.81E-01 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Colon cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC22A4 in colon adenocarcinoma [ 5 ]

Location

 TSS1500 (cg26317549)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.37E+00 Statistic Test p-value:4.37E-07; Z-score:-5.36E+00

Methylation in Case

 5.33E-01 (Median) Methylation in Control 7.29E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC22A4 in colon adenocarcinoma [ 5 ]

Location

 TSS1500 (cg27365825)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:2.22E+00 Statistic Test p-value:7.23E-05; Z-score:5.05E+00

Methylation in Case

 4.53E-01 (Median) Methylation in Control 2.04E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC22A4 in colon adenocarcinoma [ 5 ]

Location

 TSS200 (cg26851500)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.38E+00 Statistic Test p-value:3.98E-07; Z-score:-5.28E+00

Methylation in Case

 5.64E-01 (Median) Methylation in Control 7.78E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC22A4 in colon adenocarcinoma [ 5 ]

Location

 Body (cg14574489)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.35E+00 Statistic Test p-value:1.42E-05; Z-score:-4.65E+00

Methylation in Case

 5.20E-01 (Median) Methylation in Control 7.03E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC22A4 in colon adenocarcinoma [ 5 ]

Location

 Body (cg04968806)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.19E+00 Statistic Test p-value:4.26E-05; Z-score:9.93E-01

Methylation in Case

 5.27E-01 (Median) Methylation in Control 4.43E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC22A4 in colorectal cancer [ 6 ]

Location

 TSS1500 (cg13654253)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.39E+00 Statistic Test p-value:3.81E-03; Z-score:-6.61E-01

Methylation in Case

 1.92E-02 (Median) Methylation in Control 2.67E-02 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC22A4 in colorectal cancer [ 6 ]

Location

 TSS1500 (cg26229274)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.11E+00 Statistic Test p-value:4.68E-02; Z-score:6.07E-01

Methylation in Case

 7.62E-02 (Median) Methylation in Control 6.85E-02 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC22A4 in colorectal cancer [ 6 ]

Location

 Body (cg04470557)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.43E+00 Statistic Test p-value:8.16E-04; Z-score:-1.18E+00

Methylation in Case

 2.49E-01 (Median) Methylation in Control 3.57E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC22A4 in colorectal cancer [ 6 ]

Location

 Body (cg25350825)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.01E+00 Statistic Test p-value:2.70E-02; Z-score:-5.67E-01

Methylation in Case

 9.13E-01 (Median) Methylation in Control 9.21E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC22A4 in colorectal cancer [ 6 ]

Location

 Body (cg26794221)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.19E+00 Statistic Test p-value:3.72E-02; Z-score:8.64E-01

Methylation in Case

 7.12E-01 (Median) Methylation in Control 5.99E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  HIV infection

          11 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC22A4 in HIV infection [ 7 ]

Location

 TSS1500 (cg13373085)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.35E+00 Statistic Test p-value:4.10E-03; Z-score:1.31E+00

Methylation in Case

 9.51E-02 (Median) Methylation in Control 7.04E-02 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC22A4 in HIV infection [ 7 ]

Location

 TSS1500 (cg26229274)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.21E+00 Statistic Test p-value:6.00E-03; Z-score:-1.03E+00

Methylation in Case

 4.30E-02 (Median) Methylation in Control 5.20E-02 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC22A4 in HIV infection [ 7 ]

Location

 TSS200 (cg11387240)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.13E+00 Statistic Test p-value:8.15E-03; Z-score:-6.92E-01

Methylation in Case

 6.71E-02 (Median) Methylation in Control 7.56E-02 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC22A4 in HIV infection [ 7 ]

Location

 TSS200 (cg07810106)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.02E+00 Statistic Test p-value:2.49E-02; Z-score:-1.24E-01

Methylation in Case

 6.88E-02 (Median) Methylation in Control 7.03E-02 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC22A4 in HIV infection [ 7 ]

Location

 TSS200 (cg08833630)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.13E+00 Statistic Test p-value:3.68E-02; Z-score:4.13E-01

Methylation in Case

 2.86E-02 (Median) Methylation in Control 2.52E-02 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC22A4 in HIV infection [ 7 ]

Location

 Body (cg25350825)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.07E+00 Statistic Test p-value:6.49E-08; Z-score:1.89E+00

Methylation in Case

 8.35E-01 (Median) Methylation in Control 7.80E-01 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon7

 Methylation of SLC22A4 in HIV infection [ 7 ]

Location

 Body (cg04470557)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.36E+00 Statistic Test p-value:5.32E-05; Z-score:1.27E+00

Methylation in Case

 5.34E-02 (Median) Methylation in Control 3.92E-02 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon8

 Methylation of SLC22A4 in HIV infection [ 7 ]

Location

 Body (cg05231888)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.29E+00 Statistic Test p-value:1.78E-04; Z-score:1.30E+00

Methylation in Case

 6.79E-02 (Median) Methylation in Control 5.27E-02 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon9

 Methylation of SLC22A4 in HIV infection [ 7 ]

Location

 Body (cg26794221)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.02E+00 Statistic Test p-value:1.56E-03; Z-score:6.97E-01

Methylation in Case

 9.04E-01 (Median) Methylation in Control 8.88E-01 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon10

 Methylation of SLC22A4 in HIV infection [ 7 ]

Location

 Body (cg16087826)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.02E+00 Statistic Test p-value:1.13E-02; Z-score:-6.49E-01

Methylation in Case

 8.79E-01 (Median) Methylation in Control 8.92E-01 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon11

 Methylation of SLC22A4 in HIV infection [ 7 ]

Location

 3'UTR (cg12468553)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.06E+00 Statistic Test p-value:1.14E-03; Z-score:-1.20E+00

Methylation in Case

 8.45E-01 (Median) Methylation in Control 8.93E-01 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC22A4 in lung adenocarcinoma [ 8 ]

Location

 TSS1500 (cg13373085)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.49E+00 Statistic Test p-value:1.14E-03; Z-score:4.40E+00

Methylation in Case

 1.35E-01 (Median) Methylation in Control 9.08E-02 (Median)

Studied Phenotype

 Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC22A4 in lung adenocarcinoma [ 8 ]

Location

 TSS200 (cg08833630)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.21E+00 Statistic Test p-value:3.62E-02; Z-score:-1.41E+00

Methylation in Case

 4.87E-02 (Median) Methylation in Control 5.88E-02 (Median)

Studied Phenotype

 Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC22A4 in lung adenocarcinoma [ 8 ]

Location

 Body (cg26794221)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.15E+00 Statistic Test p-value:4.77E-04; Z-score:2.06E+00

Methylation in Case

 8.22E-01 (Median) Methylation in Control 7.14E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC22A4 in lung adenocarcinoma [ 8 ]

Location

 Body (cg16087826)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.06E+00 Statistic Test p-value:1.59E-02; Z-score:-2.11E+00

Methylation in Case

 7.88E-01 (Median) Methylation in Control 8.39E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC22A4 in lung adenocarcinoma [ 8 ]

Location

 Body (cg19848599)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.08E+00 Statistic Test p-value:3.52E-02; Z-score:1.12E+00

Methylation in Case

 8.23E-01 (Median) Methylation in Control 7.62E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC22A4 in lung adenocarcinoma [ 8 ]

Location

 Body (cg04470557)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.32E+00 Statistic Test p-value:3.94E-02; Z-score:-1.32E+00

Methylation in Case

 3.05E-01 (Median) Methylation in Control 4.02E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

 Patient tissue samples

  Prostate cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC22A4 in prostate cancer [ 9 ]

Location

 TSS1500 (cg23413506)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.40E+00 Statistic Test p-value:2.74E-03; Z-score:3.34E+00

Methylation in Case

 8.03E-01 (Median) Methylation in Control 5.73E-01 (Median)

Studied Phenotype

 Prostate cancer[ ICD-11:2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC22A4 in prostate cancer [ 9 ]

Location

 Body (cg25620760)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.21E+00 Statistic Test p-value:2.08E-03; Z-score:3.24E+00

Methylation in Case

 8.90E-01 (Median) Methylation in Control 7.33E-01 (Median)

Studied Phenotype

 Prostate cancer[ ICD-11:2C82]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC22A4 in systemic lupus erythematosus [ 10 ]

Location

 TSS1500 (cg13373085)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.10E+00 Statistic Test p-value:8.65E-03; Z-score:2.15E-01

Methylation in Case

 1.38E-01 (Median) Methylation in Control 1.25E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC22A4 in systemic lupus erythematosus [ 10 ]

Location

 TSS200 (cg11387240)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.01E+00 Statistic Test p-value:3.49E-02; Z-score:-4.77E-02

Methylation in Case

 9.44E-02 (Median) Methylation in Control 9.53E-02 (Median)

Studied Phenotype

 Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC22A4 in systemic lupus erythematosus [ 10 ]

Location

 TSS200 (cg07810106)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.02E+00 Statistic Test p-value:3.71E-02; Z-score:-1.29E-01

Methylation in Case

 8.43E-02 (Median) Methylation in Control 8.63E-02 (Median)

Studied Phenotype

 Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC22A4 in systemic lupus erythematosus [ 10 ]

Location

 1stExon (cg17111895)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.03E+00 Statistic Test p-value:2.58E-02; Z-score:-1.40E-01

Methylation in Case

 8.06E-02 (Median) Methylation in Control 8.27E-02 (Median)

Studied Phenotype

 Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

 Patient tissue samples

  Bladder cancer

            9 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC22A4 in bladder cancer [ 11 ]

Location

 TSS200 (cg07810106)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.35E+00 Statistic Test p-value:1.61E-03; Z-score:-2.82E+00

Methylation in Case

 8.45E-02 (Median) Methylation in Control 1.14E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC22A4 in bladder cancer [ 11 ]

Location

 TSS200 (cg08833630)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.39E+00 Statistic Test p-value:3.62E-02; Z-score:-1.90E+00

Methylation in Case

 3.05E-02 (Median) Methylation in Control 4.24E-02 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC22A4 in bladder cancer [ 11 ]

Location

 1stExon (cg17111895)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.14E+00 Statistic Test p-value:9.60E-03; Z-score:-1.70E+00

Methylation in Case

 5.66E-02 (Median) Methylation in Control 6.45E-02 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC22A4 in bladder cancer [ 11 ]

Location

 Body (cg04470557)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-4.14E+00 Statistic Test p-value:7.65E-07; Z-score:-7.49E+00

Methylation in Case

 1.02E-01 (Median) Methylation in Control 4.20E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC22A4 in bladder cancer [ 11 ]

Location

 Body (cg26794221)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.33E+00 Statistic Test p-value:8.75E-05; Z-score:-6.39E+00

Methylation in Case

 4.68E-01 (Median) Methylation in Control 6.22E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC22A4 in bladder cancer [ 11 ]

Location

 Body (cg05231888)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-2.12E+00 Statistic Test p-value:3.49E-04; Z-score:-3.61E+00

Methylation in Case

 6.50E-02 (Median) Methylation in Control 1.38E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon7

 Methylation of SLC22A4 in bladder cancer [ 11 ]

Location

 Body (cg25350825)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.04E+00 Statistic Test p-value:8.61E-04; Z-score:-2.28E+00

Methylation in Case

 7.93E-01 (Median) Methylation in Control 8.22E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon8

 Methylation of SLC22A4 in bladder cancer [ 11 ]

Location

 Body (cg19848599)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.10E+00 Statistic Test p-value:3.46E-03; Z-score:2.34E+00

Methylation in Case

 8.43E-01 (Median) Methylation in Control 7.65E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon9

 Methylation of SLC22A4 in bladder cancer [ 11 ]

Location

 3'UTR (cg12468553)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.06E+00 Statistic Test p-value:1.39E-02; Z-score:-1.45E+00

Methylation in Case

 7.83E-01 (Median) Methylation in Control 8.29E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC22A4 in papillary thyroid cancer [ 12 ]

Location

 TSS200 (cg07810106)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.07E+00 Statistic Test p-value:5.53E-03; Z-score:-3.30E-01

Methylation in Case

 5.88E-02 (Median) Methylation in Control 6.29E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC22A4 in papillary thyroid cancer [ 12 ]

Location

 Body (cg04470557)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.60E+00 Statistic Test p-value:1.04E-17; Z-score:-2.52E+00

Methylation in Case

 3.07E-01 (Median) Methylation in Control 4.92E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC22A4 in papillary thyroid cancer [ 12 ]

Location

 Body (cg19848599)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.06E+00 Statistic Test p-value:2.92E-08; Z-score:9.72E-01

Methylation in Case

 7.71E-01 (Median) Methylation in Control 7.25E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC22A4 in papillary thyroid cancer [ 12 ]

Location

 Body (cg05231888)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.35E+00 Statistic Test p-value:7.18E-08; Z-score:-1.18E+00

Methylation in Case

 9.06E-02 (Median) Methylation in Control 1.22E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC22A4 in papillary thyroid cancer [ 12 ]

Location

 Body (cg16087826)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.03E+00 Statistic Test p-value:2.26E-06; Z-score:-9.77E-01

Methylation in Case

 8.60E-01 (Median) Methylation in Control 8.90E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC22A4 in papillary thyroid cancer [ 12 ]

Location

 Body (cg26794221)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.19E+00 Statistic Test p-value:1.72E-03; Z-score:1.43E+00

Methylation in Case

 6.26E-01 (Median) Methylation in Control 5.24E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon7

 Methylation of SLC22A4 in papillary thyroid cancer [ 12 ]

Location

 Body (cg25350825)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.03E+00 Statistic Test p-value:3.40E-02; Z-score:8.68E-01

Methylation in Case

 9.02E-01 (Median) Methylation in Control 8.77E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Atypical teratoid rhabdoid tumor

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC22A4 in atypical teratoid rhabdoid tumor [ 13 ]

Location

 1stExon (cg17111895)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.71E+00 Statistic Test p-value:7.15E-18; Z-score:-2.44E+00

Methylation in Case

 3.93E-01 (Median) Methylation in Control 6.74E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC22A4 in atypical teratoid rhabdoid tumor [ 13 ]

Location

 Body (cg04470557)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.06E+00 Statistic Test p-value:7.90E-04; Z-score:5.06E-01

Methylation in Case

 8.97E-01 (Median) Methylation in Control 8.48E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC22A4 in atypical teratoid rhabdoid tumor [ 13 ]

Location

 Body (cg05231888)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.13E+00 Statistic Test p-value:1.34E-03; Z-score:7.68E-01

Methylation in Case

 7.59E-01 (Median) Methylation in Control 6.74E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC22A4 in atypical teratoid rhabdoid tumor [ 13 ]

Location

 3'UTR (cg12468553)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.57E+00 Statistic Test p-value:1.39E-11; Z-score:1.84E+00

Methylation in Case

 2.76E-01 (Median) Methylation in Control 1.76E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  Celiac disease

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC22A4 in celiac disease [ 14 ]

Location

 Body (cg25350825)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.03E+00 Statistic Test p-value:4.67E-02; Z-score:-8.98E-01

Methylation in Case

 9.27E-01 (Median) Methylation in Control 9.56E-01 (Median)

Studied Phenotype

 Celiac disease[ ICD-11:DA95]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

            8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 miR-329 directly targets SLC22A4 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-329 miRNA Mature ID miR-329-3p

miRNA Sequence

 AACACACCUGGUUAACCUCUUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon2

 miR-362 directly targets SLC22A4 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-362 miRNA Mature ID miR-362-3p

miRNA Sequence

 AACACACCUAUUCAAGGAUUCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon3

 miR-3941 directly targets SLC22A4 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3941 miRNA Mature ID miR-3941

miRNA Sequence

 UUACACACAACUGAGGAUCAUA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon4

 miR-4789 directly targets SLC22A4 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4789 miRNA Mature ID miR-4789-3p

miRNA Sequence

 CACACAUAGCAGGUGUAUAUA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon5

 miR-603 directly targets SLC22A4 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-603 miRNA Mature ID miR-603

miRNA Sequence

 CACACACUGCAAUUACUUUUGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon6

 miR-6755 directly targets SLC22A4 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6755 miRNA Mature ID miR-6755-3p

miRNA Sequence

 UGUUGUCAUGUUUUUUCCCUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon7

 miR-6879 directly targets SLC22A4 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6879 miRNA Mature ID miR-6879-3p

miRNA Sequence

 UGUCACCCGCUCCUUGCCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon8

 miR-8485 directly targets SLC22A4 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-8485 miRNA Mature ID miR-8485

miRNA Sequence

 CACACACACACACACACGUAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
2 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
5 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
6 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
7 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
8 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
9 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
10 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
11 DNA Methylation Dynamics in Urological Tumors.
12 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
13 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
14 The methylome of the celiac intestinal epithelium harbours genotype-independent alterations in the HLA region. Mol Ther Oncolytics. 2019 Feb 5;12:235-245.
15 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.