Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0143 Transporter Info
Gene Name SLC22A17
Transporter Name Brain-type organic cation transporter
Gene ID
51310
UniProt ID
Q8WUG5
Epigenetic Regulations of This DT (EGR)

Methylation

  Bladder cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC22A17 in bladder cancer [ 1 ]

Location

 TSS1500 (cg26922038)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-2.27E+00 Statistic Test p-value:8.66E-13; Z-score:-1.40E+01

Methylation in Case

 2.78E-01 (Median) Methylation in Control 6.32E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC22A17 in bladder cancer [ 1 ]

Location

 TSS1500 (cg09372750)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.63E+00 Statistic Test p-value:4.43E-07; Z-score:-6.54E+00

Methylation in Case

 2.58E-01 (Median) Methylation in Control 4.22E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC22A17 in colorectal cancer [ 2 ]

Location

 TSS1500 (cg26922038)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.07E+00 Statistic Test p-value:3.61E-06; Z-score:-2.05E+00

Methylation in Case

 7.65E-01 (Median) Methylation in Control 8.15E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC22A17 in hepatocellular carcinoma [ 3 ]

Location

 TSS1500 (cg09372750)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.35E+00 Statistic Test p-value:1.64E-09; Z-score:-2.96E+00

Methylation in Case

 4.86E-01 (Median) Methylation in Control 6.56E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC22A17 in hepatocellular carcinoma [ 3 ]

Location

 Body (cg11817038)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.19E+00 Statistic Test p-value:9.13E-11; Z-score:-4.06E+00

Methylation in Case

 6.74E-01 (Median) Methylation in Control 8.04E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC22A17 in lung adenocarcinoma [ 4 ]

Location

 TSS1500 (cg09372750)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.18E+00 Statistic Test p-value:3.72E-02; Z-score:1.87E+00

Methylation in Case

 7.18E-01 (Median) Methylation in Control 6.06E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

 Patient tissue samples

  Cutaneous melanoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Complex methylation in Cutaneous melanoma [ 5 ]

Location

 Promoter (hypo) & Intragenic (hyper)

Epigenetic Type

 Methylation Experiment Method TCGA/GEO bioinformatics & experimental validation

Related Molecular Changes

 Down regulation ofSLC22A17 Experiment Method Bisulfite sequencing, 5-Aza treatment, qRT-PCR

Studied Phenotype

 Cutaneous melanoma[ ICD-11:2C30]

Experimental Material

 Melanoma cell lines, CM patient tissues vs nevi

Additional Notes

 SLC22A17 shows promoter hypomethylation (associated with activation) and intragenic hypermethylation (correlating with better prognosis) in CM. Two intragenic methylation hotspots are clinically significant. 5-Azacytidine treatment confirms epigenetic regulation.

  Gastrointestinal cancers

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Promoter hypomethylation in GI cancers [ 6 ]

Location

 Promoter

Epigenetic Type

 Methylation Experiment Method TCGA/GTEx bioinformatics

Related Molecular Changes

 Down regulation ofSLC22A17 Experiment Method Bisulfite sequencing, qRT-PCR

Studied Phenotype

 Gastrointestinal cancers

Experimental Material

 Pan-cancer datasets (TCGA)

Additional Notes

 SLC22A17 shows consistent downregulation in GI cancers with promoter hypomethylation negatively correlating with expression. Part of LCN2-SLC22A17-MMP9 network regulating iron metabolism in TME.

  Liver cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Significant/significant/moderate hypomethylation of SLC22A17 in liver cancer disease than that in healthy individual/adjacent tissue/other disease section

Studied Phenotype

 Liver cancer [ICD-11:2C12]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value:1.43E-07; Fold-change:-0.355334115; Z-score:-1.840486939

The Methylation Level of Disease Section Compare with the Adjacent Tissue

 p-value:4.89E-14; Fold-change:-0.360417357; Z-score:-26.14994106

The Methylation Level of Disease Section Compare with the Other Disease Section

 p-value:0.038631317; Fold-change:-0.232239586; Z-score:-0.860611077
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
DT methylation level in tissue other than the diseased tissue of patients
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data of patients in the normal section of the tissue adjacent to the disease section
Download DT methylation data in the tissue of healthy individual
Download DT methylation data in the tissue of the other disease section

  Brain neuroblastoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Significant hypomethylation of SLC22A17 in brain neuroblastoma than that in healthy individual

Studied Phenotype

 Brain neuroblastoma [ICD-11:2A00.11]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value:6.18E-21; Fold-change:-0.311157184; Z-score:-11.19061909
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

microRNA

  Unclear Phenotype

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 miR-3529 directly targets SLC22A17 [ 7 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3529 miRNA Mature ID miR-3529-3p

miRNA Sequence

 AACAACAAAAUCACUAGUCUUCCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon2

 miR-5195 directly targets SLC22A17 [ 7 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-5195 miRNA Mature ID miR-5195-5p

miRNA Sequence

 AACCCCUAAGGCAACUGGAUGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 DNA Methylation Dynamics in Urological Tumors.
2 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
3 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
4 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
5 Identification of SLC22A17 DNA methylation hotspot as a potential biomarker in cutaneous melanoma. J Transl Med. 2024 Oct 2;22(1):887.
6 Bioinformatic analysis of the LCN2-SLC22A17-MMP9 network in cancer: The role of DNA methylation in the modulation of tumor microenvironment. Front Cell Dev Biol. 2022 Sep 21;10:945586.
7 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.