Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0142 Transporter Info
Gene Name	SLC22A16
Transporter Name	Fly-like putative transporter 2
Gene ID	85413
UniProt ID	Q86VW1

Epigenetic Regulations of This DT (EGR)
Methylation
Colon cancer	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC22A16 in colon adenocarcinoma			[ 1 ]
Location	5'UTR (cg06731865)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:2.53E-04; Z-score:-1.63E+00
Methylation in Case	7.77E-01 (Median)	Methylation in Control	8.16E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC22A16 in colon adenocarcinoma			[ 1 ]
Location	Body (cg13537353)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.27E+00	Statistic Test	p-value:5.60E-05; Z-score:1.58E+00
Methylation in Case	6.10E-01 (Median)	Methylation in Control	4.79E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC22A16 in colon adenocarcinoma			[ 1 ]
Location	Body (cg10577586)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.12E+00	Statistic Test	p-value:1.39E-04; Z-score:-2.19E+00
Methylation in Case	6.24E-01 (Median)	Methylation in Control	6.99E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC22A16 in colon adenocarcinoma			[ 1 ]
Location	Body (cg10626169)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.14E+00	Statistic Test	p-value:2.25E-04; Z-score:-1.54E+00
Methylation in Case	5.48E-01 (Median)	Methylation in Control	6.27E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC22A16 in colon adenocarcinoma			[ 1 ]
Location	Body (cg08829393)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:3.13E-04; Z-score:-1.57E+00
Methylation in Case	8.23E-01 (Median)	Methylation in Control	8.43E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC22A16 in colon adenocarcinoma			[ 1 ]
Location	Body (cg10954740)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.31E+00	Statistic Test	p-value:3.75E-04; Z-score:-2.71E+00
Methylation in Case	5.23E-01 (Median)	Methylation in Control	6.86E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC22A16 in pancretic ductal adenocarcinoma			[ 2 ]
Location	5'UTR (cg17306814)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.05E+00	Statistic Test	p-value:5.45E-03; Z-score:1.17E+00
Methylation in Case	8.56E-01 (Median)	Methylation in Control	8.14E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC22A16 in pancretic ductal adenocarcinoma			[ 2 ]
Location	TSS1500 (cg25313204)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.21E+00	Statistic Test	p-value:9.01E-04; Z-score:-7.88E-01
Methylation in Case	5.36E-01 (Median)	Methylation in Control	6.51E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC22A16 in pancretic ductal adenocarcinoma			[ 2 ]
Location	Body (cg09130091)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.06E+00	Statistic Test	p-value:1.23E-08; Z-score:1.38E+00
Methylation in Case	5.21E-01 (Median)	Methylation in Control	4.91E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC22A16 in pancretic ductal adenocarcinoma			[ 2 ]
Location	Body (cg02675946)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-2.13E+00	Statistic Test	p-value:3.14E-05; Z-score:-1.74E+00
Methylation in Case	1.40E-01 (Median)	Methylation in Control	2.98E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC22A16 in pancretic ductal adenocarcinoma			[ 2 ]
Location	Body (cg01295188)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.08E+00	Statistic Test	p-value:7.59E-04; Z-score:6.31E-01
Methylation in Case	7.55E-01 (Median)	Methylation in Control	6.99E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC22A16 in pancretic ductal adenocarcinoma			[ 2 ]
Location	Body (cg27428304)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-2.70E+00	Statistic Test	p-value:1.35E-03; Z-score:-1.64E+00
Methylation in Case	9.94E-02 (Median)	Methylation in Control	2.68E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC22A16 in pancretic ductal adenocarcinoma			[ 2 ]
Location	Body (cg02557110)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.03E+00	Statistic Test	p-value:2.28E-02; Z-score:2.29E-01
Methylation in Case	8.58E-01 (Median)	Methylation in Control	8.33E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Bladder cancer	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC22A16 in bladder cancer			[ 3 ]
Location	TSS1500 (cg11605355)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.14E+00	Statistic Test	p-value:6.35E-04; Z-score:5.54E+00
Methylation in Case	8.90E-01 (Median)	Methylation in Control	7.82E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC22A16 in bladder cancer			[ 3 ]
Location	TSS1500 (cg18521925)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:1.78E-02; Z-score:-7.38E-01
Methylation in Case	7.79E-01 (Median)	Methylation in Control	7.95E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC22A16 in bladder cancer			[ 3 ]
Location	TSS1500 (cg24926253)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:3.47E-02; Z-score:-1.34E+00
Methylation in Case	8.08E-01 (Median)	Methylation in Control	8.46E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC22A16 in bladder cancer			[ 3 ]
Location	TSS200 (cg19980771)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:3.87E+00	Statistic Test	p-value:7.20E-06; Z-score:5.91E+00
Methylation in Case	6.57E-01 (Median)	Methylation in Control	1.70E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC22A16 in bladder cancer			[ 3 ]
Location	TSS200 (cg12929486)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.57E+00	Statistic Test	p-value:1.57E-05; Z-score:4.62E+00
Methylation in Case	2.53E-01 (Median)	Methylation in Control	9.85E-02 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC22A16 in bladder cancer			[ 3 ]
Location	Body (cg23210852)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:4.22E+00	Statistic Test	p-value:5.74E-07; Z-score:2.16E+01
Methylation in Case	4.59E-01 (Median)	Methylation in Control	1.09E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC22A16 in bladder cancer			[ 3 ]
Location	Body (cg04014105)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:4.50E+00	Statistic Test	p-value:1.04E-06; Z-score:1.58E+01
Methylation in Case	4.60E-01 (Median)	Methylation in Control	1.02E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC22A16 in bladder cancer			[ 3 ]
Location	Body (cg22334665)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:3.81E+00	Statistic Test	p-value:1.90E-06; Z-score:2.34E+01
Methylation in Case	3.30E-01 (Median)	Methylation in Control	8.67E-02 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC22A16 in bladder cancer			[ 3 ]
Location	Body (cg13665414)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.21E+00	Statistic Test	p-value:1.30E-03; Z-score:-2.65E+00
Methylation in Case	3.57E-01 (Median)	Methylation in Control	4.32E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Breast cancer	11 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC22A16 in breast cancer			[ 4 ]
Location	TSS1500 (cg11605355)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.06E+00	Statistic Test	p-value:6.76E-04; Z-score:7.92E-01
Methylation in Case	8.37E-01 (Median)	Methylation in Control	7.92E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC22A16 in breast cancer			[ 4 ]
Location	TSS1500 (cg18521925)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:7.32E-03; Z-score:-6.71E-01
Methylation in Case	7.69E-01 (Median)	Methylation in Control	7.97E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC22A16 in breast cancer			[ 4 ]
Location	TSS1500 (cg22607760)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.03E+00	Statistic Test	p-value:1.85E-02; Z-score:6.42E-01
Methylation in Case	8.80E-01 (Median)	Methylation in Control	8.51E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC22A16 in breast cancer			[ 4 ]
Location	TSS200 (cg19980771)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.34E+00	Statistic Test	p-value:3.37E-13; Z-score:3.77E+00
Methylation in Case	4.03E-01 (Median)	Methylation in Control	1.72E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC22A16 in breast cancer			[ 4 ]
Location	TSS200 (cg12929486)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.68E+00	Statistic Test	p-value:1.81E-05; Z-score:1.04E+00
Methylation in Case	1.38E-01 (Median)	Methylation in Control	8.22E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC22A16 in breast cancer			[ 4 ]
Location	Body (cg22334665)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.29E+00	Statistic Test	p-value:2.77E-11; Z-score:3.95E+00
Methylation in Case	1.76E-01 (Median)	Methylation in Control	7.68E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC22A16 in breast cancer			[ 4 ]
Location	Body (cg04014105)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.10E+00	Statistic Test	p-value:1.01E-10; Z-score:3.40E+00
Methylation in Case	1.70E-01 (Median)	Methylation in Control	8.08E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC22A16 in breast cancer			[ 4 ]
Location	Body (cg23210852)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.73E+00	Statistic Test	p-value:1.27E-09; Z-score:2.85E+00
Methylation in Case	1.56E-01 (Median)	Methylation in Control	9.01E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC22A16 in breast cancer			[ 4 ]
Location	Body (cg13665414)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.20E+00	Statistic Test	p-value:4.18E-03; Z-score:-1.19E+00
Methylation in Case	3.77E-01 (Median)	Methylation in Control	4.53E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC22A16 in breast cancer			[ 4 ]
Location	Body (cg26197117)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.04E+00	Statistic Test	p-value:5.03E-03; Z-score:1.62E-01
Methylation in Case	1.26E-01 (Median)	Methylation in Control	1.21E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC22A16 in breast cancer			[ 4 ]
Location	Body (cg10616767)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:4.65E-02; Z-score:-7.25E-01
Methylation in Case	8.58E-01 (Median)	Methylation in Control	8.77E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Colorectal cancer	11 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC22A16 in colorectal cancer			[ 5 ]
Location	TSS1500 (cg24926253)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:1.09E-03; Z-score:-7.78E-01
Methylation in Case	8.85E-01 (Median)	Methylation in Control	9.05E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC22A16 in colorectal cancer			[ 5 ]
Location	TSS1500 (cg22607760)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.02E+00	Statistic Test	p-value:1.40E-02; Z-score:7.62E-01
Methylation in Case	9.37E-01 (Median)	Methylation in Control	9.16E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC22A16 in colorectal cancer			[ 5 ]
Location	TSS200 (cg19980771)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.76E+00	Statistic Test	p-value:1.05E-06; Z-score:1.72E+00
Methylation in Case	8.14E-01 (Median)	Methylation in Control	4.61E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC22A16 in colorectal cancer			[ 5 ]
Location	TSS200 (cg12929486)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.62E+00	Statistic Test	p-value:7.70E-06; Z-score:1.05E+00
Methylation in Case	4.19E-01 (Median)	Methylation in Control	2.58E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC22A16 in colorectal cancer			[ 5 ]
Location	Body (cg13665414)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.36E+00	Statistic Test	p-value:2.69E-10; Z-score:-2.14E+00
Methylation in Case	4.27E-01 (Median)	Methylation in Control	5.81E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC22A16 in colorectal cancer			[ 5 ]
Location	Body (cg23210852)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.67E+00	Statistic Test	p-value:1.78E-08; Z-score:1.82E+00
Methylation in Case	6.51E-01 (Median)	Methylation in Control	3.90E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC22A16 in colorectal cancer			[ 5 ]
Location	Body (cg04014105)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.04E+00	Statistic Test	p-value:4.44E-08; Z-score:1.85E+00
Methylation in Case	5.71E-01 (Median)	Methylation in Control	2.80E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC22A16 in colorectal cancer			[ 5 ]
Location	Body (cg22334665)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.61E+00	Statistic Test	p-value:1.65E-06; Z-score:1.50E+00
Methylation in Case	5.79E-01 (Median)	Methylation in Control	3.59E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC22A16 in colorectal cancer			[ 5 ]
Location	Body (cg26197117)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.20E+00	Statistic Test	p-value:1.86E-03; Z-score:9.77E-01
Methylation in Case	5.69E-01 (Median)	Methylation in Control	4.74E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC22A16 in colorectal cancer			[ 5 ]
Location	Body (cg10616767)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.00E+00	Statistic Test	p-value:1.89E-02; Z-score:-5.66E-01
Methylation in Case	9.43E-01 (Median)	Methylation in Control	9.46E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC22A16 in hepatocellular carcinoma			[ 6 ]
Location	TSS1500 (cg18521925)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:1.15E-05; Z-score:-1.96E+00
Methylation in Case	7.79E-01 (Median)	Methylation in Control	8.14E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC22A16 in hepatocellular carcinoma			[ 6 ]
Location	TSS1500 (cg24926253)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:2.03E-04; Z-score:-4.00E-01
Methylation in Case	8.25E-01 (Median)	Methylation in Control	8.45E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC22A16 in hepatocellular carcinoma			[ 6 ]
Location	TSS200 (cg12929486)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.47E+00	Statistic Test	p-value:1.09E-05; Z-score:7.96E-01
Methylation in Case	3.56E-01 (Median)	Methylation in Control	2.43E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC22A16 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg05916255)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.17E+00	Statistic Test	p-value:1.02E-17; Z-score:-4.30E+00
Methylation in Case	7.42E-01 (Median)	Methylation in Control	8.67E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC22A16 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg09674468)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.65E+00	Statistic Test	p-value:3.92E-17; Z-score:-2.74E+00
Methylation in Case	2.48E-01 (Median)	Methylation in Control	4.09E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC22A16 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg19426594)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.53E+00	Statistic Test	p-value:2.61E-15; Z-score:-2.39E+00
Methylation in Case	5.19E-01 (Median)	Methylation in Control	7.96E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC22A16 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg13825334)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.33E+00	Statistic Test	p-value:2.36E-13; Z-score:-1.40E+01
Methylation in Case	6.37E-01 (Median)	Methylation in Control	8.48E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC22A16 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg26197117)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.28E+00	Statistic Test	p-value:4.84E-03; Z-score:1.30E+00
Methylation in Case	4.26E-01 (Median)	Methylation in Control	3.34E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC22A16 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg13665414)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.12E+00	Statistic Test	p-value:1.41E-02; Z-score:-6.49E-01
Methylation in Case	3.49E-01 (Median)	Methylation in Control	3.92E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC22A16 in papillary thyroid cancer			[ 7 ]
Location	TSS1500 (cg22607760)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.04E+00	Statistic Test	p-value:3.02E-02; Z-score:6.87E-01
Methylation in Case	9.21E-01 (Median)	Methylation in Control	8.86E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC22A16 in papillary thyroid cancer			[ 7 ]
Location	Body (cg04014105)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.10E+00	Statistic Test	p-value:2.75E-04; Z-score:6.33E-01
Methylation in Case	1.21E-01 (Median)	Methylation in Control	1.10E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC22A16 in papillary thyroid cancer			[ 7 ]
Location	Body (cg23210852)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.07E+00	Statistic Test	p-value:6.64E-03; Z-score:3.31E-01
Methylation in Case	9.28E-02 (Median)	Methylation in Control	8.70E-02 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Renal cell carcinoma	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC22A16 in clear cell renal cell carcinoma			[ 8 ]
Location	TSS200 (cg19980771)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.45E+00	Statistic Test	p-value:1.37E-03; Z-score:5.60E-01
Methylation in Case	1.27E-01 (Median)	Methylation in Control	8.74E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC22A16 in clear cell renal cell carcinoma			[ 8 ]
Location	Body (cg13665414)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.16E+00	Statistic Test	p-value:1.90E-04; Z-score:-1.59E+00
Methylation in Case	5.16E-01 (Median)	Methylation in Control	5.99E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC22A16 in clear cell renal cell carcinoma			[ 8 ]
Location	Body (cg04014105)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.16E+00	Statistic Test	p-value:6.60E-04; Z-score:4.86E-01
Methylation in Case	9.31E-02 (Median)	Methylation in Control	8.05E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC22A16 in clear cell renal cell carcinoma			[ 8 ]
Location	Body (cg23210852)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.03E+00	Statistic Test	p-value:1.21E-03; Z-score:8.48E-02
Methylation in Case	1.08E-01 (Median)	Methylation in Control	1.05E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC22A16 in clear cell renal cell carcinoma			[ 8 ]
Location	Body (cg22334665)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.17E+00	Statistic Test	p-value:1.74E-03; Z-score:4.29E-01
Methylation in Case	1.04E-01 (Median)	Methylation in Control	8.87E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC22A16 in clear cell renal cell carcinoma			[ 8 ]
Location	Body (cg26197117)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.74E+00	Statistic Test	p-value:2.10E-03; Z-score:-1.84E+00
Methylation in Case	1.92E-01 (Median)	Methylation in Control	3.34E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
HIV infection	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC22A16 in HIV infection			[ 9 ]
Location	TSS200 (cg19980771)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.28E+00	Statistic Test	p-value:3.41E-02; Z-score:6.56E-01
Methylation in Case	3.71E-01 (Median)	Methylation in Control	2.89E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC22A16 in HIV infection			[ 9 ]
Location	Body (cg13665414)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.29E+00	Statistic Test	p-value:1.15E-04; Z-score:1.56E+00
Methylation in Case	9.20E-02 (Median)	Methylation in Control	7.10E-02 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC22A16 in HIV infection			[ 9 ]
Location	Body (cg04014105)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.54E+00	Statistic Test	p-value:1.57E-04; Z-score:1.83E+00
Methylation in Case	8.81E-02 (Median)	Methylation in Control	5.71E-02 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC22A16 in HIV infection			[ 9 ]
Location	Body (cg22334665)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.30E+00	Statistic Test	p-value:1.09E-03; Z-score:9.96E-01
Methylation in Case	7.83E-02 (Median)	Methylation in Control	6.02E-02 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC22A16 in HIV infection			[ 9 ]
Location	Body (cg23210852)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.44E+00	Statistic Test	p-value:1.79E-03; Z-score:1.25E+00
Methylation in Case	8.62E-02 (Median)	Methylation in Control	5.99E-02 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC22A16 in HIV infection			[ 9 ]
Location	Body (cg26197117)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.40E+00	Statistic Test	p-value:2.40E-03; Z-score:1.34E+00
Methylation in Case	6.76E-02 (Median)	Methylation in Control	4.83E-02 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC22A16 in HIV infection			[ 9 ]
Location	Body (cg10616767)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:1.61E-02; Z-score:-5.16E-01
Methylation in Case	9.27E-01 (Median)	Methylation in Control	9.36E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC22A16 in lung adenocarcinoma			[ 10 ]
Location	TSS200 (cg19980771)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.69E+00	Statistic Test	p-value:5.96E-03; Z-score:2.00E+00
Methylation in Case	5.38E-01 (Median)	Methylation in Control	3.19E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC22A16 in lung adenocarcinoma			[ 10 ]
Location	Body (cg22334665)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.29E+00	Statistic Test	p-value:4.80E-03; Z-score:1.28E+01
Methylation in Case	2.89E-01 (Median)	Methylation in Control	1.26E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC22A16 in lung adenocarcinoma			[ 10 ]
Location	Body (cg04014105)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.23E+00	Statistic Test	p-value:9.72E-03; Z-score:1.50E+01
Methylation in Case	2.69E-01 (Median)	Methylation in Control	1.21E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC22A16 in lung adenocarcinoma			[ 10 ]
Location	Body (cg23210852)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.90E+00	Statistic Test	p-value:1.80E-02; Z-score:9.84E+00
Methylation in Case	2.44E-01 (Median)	Methylation in Control	1.28E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Prostate cancer	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC22A16 in prostate cancer			[ 11 ]
Location	TSS200 (cg26215887)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.25E+00	Statistic Test	p-value:2.30E-02; Z-score:2.56E+00
Methylation in Case	7.22E-02 (Median)	Methylation in Control	5.77E-02 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC22A16 in prostate cancer			[ 11 ]
Location	Body (cg02672229)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.08E+00	Statistic Test	p-value:1.25E-02; Z-score:7.28E+00
Methylation in Case	9.32E-01 (Median)	Methylation in Control	8.66E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC22A16 in prostate cancer			[ 11 ]
Location	Body (cg21334510)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.28E+00	Statistic Test	p-value:1.98E-02; Z-score:-2.64E+00
Methylation in Case	4.32E-01 (Median)	Methylation in Control	5.51E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC22A16 in prostate cancer			[ 11 ]
Location	Body (cg16241391)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.25E+00	Statistic Test	p-value:3.05E-02; Z-score:-3.38E+00
Methylation in Case	6.72E-01 (Median)	Methylation in Control	8.39E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Atypical teratoid rhabdoid tumor	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC22A16 in atypical teratoid rhabdoid tumor			[ 12 ]
Location	Body (cg04014105)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:5.24E-04; Z-score:-1.14E+00
Methylation in Case	8.66E-01 (Median)	Methylation in Control	9.09E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC22A16 in atypical teratoid rhabdoid tumor			[ 12 ]
Location	Body (cg10616767)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.04E+00	Statistic Test	p-value:1.66E-02; Z-score:6.55E-01
Methylation in Case	9.06E-01 (Median)	Methylation in Control	8.75E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC22A16 in atypical teratoid rhabdoid tumor			[ 12 ]
Location	Body (cg13665414)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.20E+00	Statistic Test	p-value:3.78E-02; Z-score:5.36E-01
Methylation in Case	4.04E-01 (Median)	Methylation in Control	3.36E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC22A16 in systemic lupus erythematosus			[ 13 ]
Location	Body (cg04014105)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.01E+00	Statistic Test	p-value:2.97E-02; Z-score:2.70E-02
Methylation in Case	6.55E-02 (Median)	Methylation in Control	6.50E-02 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Gastric cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Moderate/significant/moderate hypermethylation of SLC22A16 in gastric cancer disease than that in healthy individual/adjacent tissue/other disease section
Studied Phenotype	Gastric cancer [ICD-11:2B72]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:3.83E-27; Fold-change:0.267439225; Z-score:2.265762915
The Methylation Level of Disease Section Compare with the Adjacent Tissue	p-value:3.33E-59; Fold-change:0.348241622; Z-score:74.26918302
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue adjacent to the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data of patients in the normal section of the tissue adjacent to the disease section Download DT methylation data in the tissue of healthy individual
Liver cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant/significant hypermethylation of SLC22A16 in liver cancer than that in healthy individual/adjacent tissue
Studied Phenotype	Liver cancer [ICD-11:2C12]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:6.29E-05; Fold-change:0.414174728; Z-score:1.200750533
The Methylation Level of Disease Section Compare with the Adjacent Tissue	p-value:1.41E-11; Fold-change:0.320491867; Z-score:2.663132007
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue adjacent to the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals DT methylation level in tissue other than the diseased tissue of patients
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data of patients in the normal section of the tissue adjacent to the disease section Download DT methylation data in the tissue of healthy individual Download DT methylation data in the tissue of the other disease section
Malignant astrocytoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Moderate hypermethylation of SLC22A16 in malignant astrocytoma than that in healthy individual
Studied Phenotype	Malignant astrocytoma [ICD-11:2A00.12]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:7.41E-17; Fold-change:0.239954267; Z-score:1.160602918
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Oligodendroglioma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Moderate hypermethylation of SLC22A16 in oligodendroglioma than that in healthy individual
Studied Phenotype	Oligodendroglioma [ICD-11:2A00.0Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:3.88E-06; Fold-change:0.240636033; Z-score:0.931788198
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Acute myeloid leukemia	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Moderate hypomethylation of SLC22A16 in acute myeloid leukemia than that in healthy individual
Studied Phenotype	Acute myeloid leukemia [ICD-11:2A60]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:2.24E-05; Fold-change:-0.259021751; Z-score:-0.884391789
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Glioblastoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypermethylation of SLC22A16 in glioblastoma than that in healthy individual
Studied Phenotype	Glioblastoma [ICD-11:2A00.00]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:0.039421725; Fold-change:0.322957869; Z-score:0.952188812
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Lymphoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypermethylation of SLC22A16 in lymphoma than that in healthy individual
Studied Phenotype	Lymphoma [ICD-11:2B30]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:2.53E-22; Fold-change:0.551485645; Z-score:2.135456641
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
microRNA
Unclear Phenotype	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	miR-335 directly targets SLC22A16			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
miRNA Stemloop ID	miR-335	miRNA Mature ID	miR-335-5p
miRNA Sequence	UCAAGAGCAAUAACGAAAAAUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human

References
1	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
2	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
3	DNA Methylation Dynamics in Urological Tumors.
4	Genome-wide Scan for Methylation Profiles in Breast Cancer
5	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
7	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
8	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
9	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
10	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
11	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
12	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
13	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
14	Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence