Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0139 Transporter Info | ||||
| Gene Name | SLC22A13 | ||||
| Transporter Name | Organic cation transporter-like 3 | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
Methylation |
|||||
|
Bladder cancer |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC22A13 in bladder cancer | [ 1 ] | |||
|
Location |
TSS1500 (cg25411725) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.06E+00 | Statistic Test | p-value:5.24E-04; Z-score:3.69E+00 | ||
|
Methylation in Case |
8.30E-01 (Median) | Methylation in Control | 7.81E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC22A13 in bladder cancer | [ 1 ] | |||
|
Location |
Body (cg14511417) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.14E+00 | Statistic Test | p-value:4.33E-04; Z-score:-4.42E+00 | ||
|
Methylation in Case |
6.82E-01 (Median) | Methylation in Control | 7.74E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Breast cancer |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC22A13 in breast cancer | [ 2 ] | |||
|
Location |
TSS1500 (cg24867653) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:1.64E-06; Z-score:-9.50E-01 | ||
|
Methylation in Case |
8.01E-01 (Median) | Methylation in Control | 8.39E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC22A13 in breast cancer | [ 2 ] | |||
|
Location |
1stExon (cg21615171) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:1.28E-03; Z-score:-9.00E-01 | ||
|
Methylation in Case |
8.27E-01 (Median) | Methylation in Control | 8.70E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC22A13 in breast cancer | [ 2 ] | |||
|
Location |
Body (cg14511417) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:5.66E-04; Z-score:-6.54E-01 | ||
|
Methylation in Case |
7.05E-01 (Median) | Methylation in Control | 7.29E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colorectal cancer |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC22A13 in colorectal cancer | [ 3 ] | |||
|
Location |
TSS1500 (cg24867653) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:7.96E-03; Z-score:-4.10E-01 | ||
|
Methylation in Case |
8.70E-01 (Median) | Methylation in Control | 8.78E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC22A13 in colorectal cancer | [ 3 ] | |||
|
Location |
1stExon (cg21615171) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:2.59E-02; Z-score:-8.23E-03 | ||
|
Methylation in Case |
9.38E-01 (Median) | Methylation in Control | 9.38E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC22A13 in colorectal cancer | [ 3 ] | |||
|
Location |
Body (cg14511417) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:3.14E-03; Z-score:-7.31E-01 | ||
|
Methylation in Case |
8.78E-01 (Median) | Methylation in Control | 8.90E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC22A13 in colorectal cancer | [ 3 ] | |||
|
Location |
3'UTR (cg12355794) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:5.95E-04; Z-score:-6.29E-01 | ||
|
Methylation in Case |
9.26E-01 (Median) | Methylation in Control | 9.32E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Hepatocellular carcinoma |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC22A13 in hepatocellular carcinoma | [ 4 ] | |||
|
Location |
TSS1500 (cg24867653) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:3.32E-03; Z-score:-1.72E-01 | ||
|
Methylation in Case |
7.82E-01 (Median) | Methylation in Control | 7.90E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC22A13 in hepatocellular carcinoma | [ 4 ] | |||
|
Location |
1stExon (cg21615171) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.00E+00 | Statistic Test | p-value:2.87E-02; Z-score:1.16E-01 | ||
|
Methylation in Case |
8.52E-01 (Median) | Methylation in Control | 8.49E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC22A13 in hepatocellular carcinoma | [ 4 ] | |||
|
Location |
Body (cg14511417) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:1.25E-05; Z-score:-9.43E-01 | ||
|
Methylation in Case |
7.43E-01 (Median) | Methylation in Control | 7.72E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
HIV infection |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC22A13 in HIV infection | [ 5 ] | |||
|
Location |
TSS1500 (cg24867653) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:5.07E-05; Z-score:-1.29E+00 | ||
|
Methylation in Case |
8.40E-01 (Median) | Methylation in Control | 8.83E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC22A13 in HIV infection | [ 5 ] | |||
|
Location |
Body (cg14511417) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:1.74E-04; Z-score:-1.22E+00 | ||
|
Methylation in Case |
8.56E-01 (Median) | Methylation in Control | 8.85E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Papillary thyroid cancer |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC22A13 in papillary thyroid cancer | [ 6 ] | |||
|
Location |
TSS1500 (cg24867653) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:9.25E-03; Z-score:-3.72E-01 | ||
|
Methylation in Case |
8.12E-01 (Median) | Methylation in Control | 8.24E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC22A13 in papillary thyroid cancer | [ 6 ] | |||
|
Location |
TSS1500 (cg25411725) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:1.61E-02; Z-score:9.75E-01 | ||
|
Methylation in Case |
8.68E-01 (Median) | Methylation in Control | 8.44E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC22A13 in papillary thyroid cancer | [ 6 ] | |||
|
Location |
1stExon (cg21615171) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:2.32E-02; Z-score:-8.19E-01 | ||
|
Methylation in Case |
9.27E-01 (Median) | Methylation in Control | 9.35E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Atypical teratoid rhabdoid tumor |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC22A13 in atypical teratoid rhabdoid tumor | [ 7 ] | |||
|
Location |
1stExon (cg21615171) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.14E+00 | Statistic Test | p-value:7.76E-17; Z-score:-3.54E+00 | ||
|
Methylation in Case |
8.07E-01 (Median) | Methylation in Control | 9.20E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC22A13 in atypical teratoid rhabdoid tumor | [ 7 ] | |||
|
Location |
Body (cg14511417) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.13E+00 | Statistic Test | p-value:4.71E-02; Z-score:-5.43E-01 | ||
|
Methylation in Case |
4.88E-01 (Median) | Methylation in Control | 5.53E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC22A13 in atypical teratoid rhabdoid tumor | [ 7 ] | |||
|
Location |
3'UTR (cg12355794) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.51E+00 | Statistic Test | p-value:1.28E-11; Z-score:-2.00E+00 | ||
|
Methylation in Case |
1.67E-01 (Median) | Methylation in Control | 2.52E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Pancretic ductal adenocarcinoma |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC22A13 in pancretic ductal adenocarcinoma | [ 8 ] | |||
|
Location |
Body (cg18236477) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.72E+00 | Statistic Test | p-value:7.30E-13; Z-score:2.40E+00 | ||
|
Methylation in Case |
5.49E-01 (Median) | Methylation in Control | 3.19E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC22A13 in pancretic ductal adenocarcinoma | [ 8 ] | |||
|
Location |
Body (cg08737116) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.44E+00 | Statistic Test | p-value:1.97E-05; Z-score:-1.36E+00 | ||
|
Methylation in Case |
2.57E-01 (Median) | Methylation in Control | 3.71E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC22A13 in pancretic ductal adenocarcinoma | [ 8 ] | |||
|
Location |
Body (cg03723715) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.12E+00 | Statistic Test | p-value:9.34E-05; Z-score:-1.22E+00 | ||
|
Methylation in Case |
6.26E-01 (Median) | Methylation in Control | 6.99E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Systemic lupus erythematosus |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC22A13 in systemic lupus erythematosus | [ 9 ] | |||
|
Location |
3'UTR (cg12355794) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:4.09E-02; Z-score:-1.47E-01 | ||
|
Methylation in Case |
8.83E-01 (Median) | Methylation in Control | 8.88E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
microRNA |
|||||
|
Unclear Phenotype |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
miR-26b directly targets SLC22A13 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
|
miRNA Stemloop ID |
miR-26b | miRNA Mature ID | miR-26b-5p | ||
|
miRNA Sequence |
UUCAAGUAAUUCAGGAUAGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.