Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0137 Transporter Info
Gene Name	SLC20A2
Transporter Name	Sodium-dependent phosphate transporter 2
Gene ID	6575
UniProt ID	Q08357

Epigenetic Regulations of This DT (EGR)
Methylation
Atypical teratoid rhabdoid tumor	21 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC20A2 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg00025347)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.34E+00	Statistic Test	p-value:3.84E-09; Z-score:1.13E+00
Methylation in Case	4.20E-01 (Median)	Methylation in Control	3.14E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC20A2 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg10806146)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:2.22E-07; Z-score:-1.49E+00
Methylation in Case	8.97E-01 (Median)	Methylation in Control	9.33E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC20A2 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg14335429)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:8.16E-07; Z-score:-1.22E+00
Methylation in Case	9.46E-01 (Median)	Methylation in Control	9.61E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC20A2 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg15936066)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.17E+00	Statistic Test	p-value:1.59E-06; Z-score:1.45E+00
Methylation in Case	8.88E-01 (Median)	Methylation in Control	7.58E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC20A2 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg19504179)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.08E+00	Statistic Test	p-value:3.09E-06; Z-score:8.20E-01
Methylation in Case	8.63E-01 (Median)	Methylation in Control	7.96E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC20A2 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg21921016)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.57E+00	Statistic Test	p-value:5.53E-06; Z-score:-9.85E-01
Methylation in Case	2.11E-01 (Median)	Methylation in Control	3.32E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC20A2 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg22855020)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.33E+00	Statistic Test	p-value:6.54E-06; Z-score:-1.14E+00
Methylation in Case	5.27E-01 (Median)	Methylation in Control	7.01E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC20A2 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg26248082)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.06E+00	Statistic Test	p-value:1.16E-05; Z-score:-6.71E-01
Methylation in Case	7.07E-01 (Median)	Methylation in Control	7.53E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC20A2 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg03562592)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:3.67E-04; Z-score:-6.63E-01
Methylation in Case	8.95E-01 (Median)	Methylation in Control	9.15E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC20A2 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg03612649)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.34E+00	Statistic Test	p-value:3.76E-04; Z-score:-7.33E-01
Methylation in Case	1.39E-01 (Median)	Methylation in Control	1.87E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC20A2 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg04025550)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.74E+00	Statistic Test	p-value:5.31E-04; Z-score:-8.66E-01
Methylation in Case	1.31E-01 (Median)	Methylation in Control	2.27E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of SLC20A2 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg05561775)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:1.54E-03; Z-score:-5.06E-01
Methylation in Case	8.95E-01 (Median)	Methylation in Control	9.29E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon13	Methylation of SLC20A2 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg05937663)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:1.91E-03; Z-score:-6.66E-01
Methylation in Case	8.75E-01 (Median)	Methylation in Control	9.03E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon14	Methylation of SLC20A2 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg09056639)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.12E+00	Statistic Test	p-value:9.11E-03; Z-score:-6.51E-01
Methylation in Case	5.05E-01 (Median)	Methylation in Control	5.67E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon15	Methylation of SLC20A2 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg10308027)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.08E+00	Statistic Test	p-value:1.43E-02; Z-score:-2.33E-01
Methylation in Case	3.44E-01 (Median)	Methylation in Control	3.73E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon16	Methylation of SLC20A2 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg10423743)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.06E+00	Statistic Test	p-value:1.47E-02; Z-score:3.53E-01
Methylation in Case	8.94E-02 (Median)	Methylation in Control	8.47E-02 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon17	Methylation of SLC20A2 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg11947423)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:2.63E-02; Z-score:-4.19E-01
Methylation in Case	9.33E-01 (Median)	Methylation in Control	9.52E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon18	Methylation of SLC20A2 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg14551279)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.62E+00	Statistic Test	p-value:4.75E-02; Z-score:-6.54E-01
Methylation in Case	1.28E-01 (Median)	Methylation in Control	2.07E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon19	Methylation of SLC20A2 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	3'UTR (cg00409552)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.43E+00	Statistic Test	p-value:9.77E-16; Z-score:-2.35E+00
Methylation in Case	5.40E-01 (Median)	Methylation in Control	7.75E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon20	Methylation of SLC20A2 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	3'UTR (cg21154041)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.86E+00	Statistic Test	p-value:5.39E-10; Z-score:-1.96E+00
Methylation in Case	1.68E-01 (Median)	Methylation in Control	3.12E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon21	Methylation of SLC20A2 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	3'UTR (cg26696906)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.71E+00	Statistic Test	p-value:3.09E-09; Z-score:1.84E+00
Methylation in Case	6.31E-01 (Median)	Methylation in Control	3.69E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Bladder cancer	10 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC20A2 in bladder cancer			[ 2 ]
Location	5'UTR (cg19504179)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-2.62E+00	Statistic Test	p-value:7.42E-12; Z-score:-1.69E+01
Methylation in Case	3.21E-01 (Median)	Methylation in Control	8.42E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC20A2 in bladder cancer			[ 2 ]
Location	5'UTR (cg00025347)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-2.05E+00	Statistic Test	p-value:1.32E-10; Z-score:-2.26E+01
Methylation in Case	4.10E-01 (Median)	Methylation in Control	8.41E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC20A2 in bladder cancer			[ 2 ]
Location	5'UTR (cg14335429)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.28E+00	Statistic Test	p-value:3.96E-03; Z-score:2.56E+00
Methylation in Case	5.26E-01 (Median)	Methylation in Control	4.11E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC20A2 in bladder cancer			[ 2 ]
Location	5'UTR (cg26248082)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.22E+00	Statistic Test	p-value:5.23E-03; Z-score:6.58E+00
Methylation in Case	6.05E-01 (Median)	Methylation in Control	4.97E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC20A2 in bladder cancer			[ 2 ]
Location	5'UTR (cg15936066)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.64E+00	Statistic Test	p-value:2.64E-02; Z-score:5.46E+00
Methylation in Case	4.47E-01 (Median)	Methylation in Control	2.73E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC20A2 in bladder cancer			[ 2 ]
Location	Body (cg11947423)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.09E+00	Statistic Test	p-value:1.54E-04; Z-score:-6.90E+00
Methylation in Case	8.83E-01 (Median)	Methylation in Control	9.61E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC20A2 in bladder cancer			[ 2 ]
Location	Body (cg14551279)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:9.38E-04; Z-score:-2.59E+00
Methylation in Case	8.09E-01 (Median)	Methylation in Control	8.41E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC20A2 in bladder cancer			[ 2 ]
Location	Body (cg15685762)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:3.20E-03; Z-score:-2.35E+00
Methylation in Case	8.57E-01 (Median)	Methylation in Control	8.90E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC20A2 in bladder cancer			[ 2 ]
Location	Body (cg15469704)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.06E+00	Statistic Test	p-value:5.57E-03; Z-score:-2.79E+00
Methylation in Case	7.08E-01 (Median)	Methylation in Control	7.50E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC20A2 in bladder cancer			[ 2 ]
Location	Body (cg10308027)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:1.90E-02; Z-score:-1.14E+00
Methylation in Case	8.83E-01 (Median)	Methylation in Control	8.99E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Breast cancer	13 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC20A2 in breast cancer			[ 3 ]
Location	5'UTR (cg21921016)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.29E+00	Statistic Test	p-value:3.55E-17; Z-score:3.21E+00
Methylation in Case	7.86E-01 (Median)	Methylation in Control	6.11E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC20A2 in breast cancer			[ 3 ]
Location	5'UTR (cg26248082)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.14E+00	Statistic Test	p-value:1.10E-11; Z-score:1.76E+00
Methylation in Case	7.01E-01 (Median)	Methylation in Control	6.16E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC20A2 in breast cancer			[ 3 ]
Location	5'UTR (cg15936066)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.48E+00	Statistic Test	p-value:5.06E-09; Z-score:1.96E+00
Methylation in Case	4.00E-01 (Median)	Methylation in Control	2.69E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC20A2 in breast cancer			[ 3 ]
Location	5'UTR (cg00025347)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.22E+00	Statistic Test	p-value:7.98E-09; Z-score:-2.18E+00
Methylation in Case	7.08E-01 (Median)	Methylation in Control	8.60E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC20A2 in breast cancer			[ 3 ]
Location	5'UTR (cg14335429)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.28E+00	Statistic Test	p-value:6.82E-07; Z-score:2.17E+00
Methylation in Case	5.58E-01 (Median)	Methylation in Control	4.38E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC20A2 in breast cancer			[ 3 ]
Location	5'UTR (cg22855020)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.31E+00	Statistic Test	p-value:2.28E-05; Z-score:1.84E+00
Methylation in Case	5.32E-01 (Median)	Methylation in Control	4.06E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC20A2 in breast cancer			[ 3 ]
Location	5'UTR (cg10806146)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.21E+00	Statistic Test	p-value:2.95E-05; Z-score:1.41E+00
Methylation in Case	5.11E-01 (Median)	Methylation in Control	4.21E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC20A2 in breast cancer			[ 3 ]
Location	5'UTR (cg19504179)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.08E+00	Statistic Test	p-value:3.20E-04; Z-score:1.43E+00
Methylation in Case	8.99E-01 (Median)	Methylation in Control	8.29E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC20A2 in breast cancer			[ 3 ]
Location	Body (cg17999393)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:3.74E-03; Z-score:-5.47E-01
Methylation in Case	8.58E-01 (Median)	Methylation in Control	8.76E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC20A2 in breast cancer			[ 3 ]
Location	Body (cg10423743)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.01E+00	Statistic Test	p-value:1.53E-02; Z-score:3.59E-01
Methylation in Case	8.49E-01 (Median)	Methylation in Control	8.37E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC20A2 in breast cancer			[ 3 ]
Location	Body (cg24353706)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:3.00E-02; Z-score:-6.57E-01
Methylation in Case	8.63E-01 (Median)	Methylation in Control	8.82E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of SLC20A2 in breast cancer			[ 3 ]
Location	Body (cg20370839)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:3.11E-02; Z-score:-3.14E-01
Methylation in Case	9.22E-01 (Median)	Methylation in Control	9.27E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon13	Methylation of SLC20A2 in breast cancer			[ 3 ]
Location	Body (cg05937663)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:3.46E-02; Z-score:-5.48E-01
Methylation in Case	8.68E-01 (Median)	Methylation in Control	8.87E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Celiac disease	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC20A2 in celiac disease			[ 4 ]
Location	5'UTR (cg14335429)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.35E+00	Statistic Test	p-value:1.35E-02; Z-score:1.12E+00
Methylation in Case	8.83E-01 (Median)	Methylation in Control	6.53E-01 (Median)
Studied Phenotype	Celiac disease[ ICD-11:DA95]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC20A2 in celiac disease			[ 4 ]
Location	5'UTR (cg15936066)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.38E+00	Statistic Test	p-value:1.50E-02; Z-score:8.76E-01
Methylation in Case	6.45E-01 (Median)	Methylation in Control	4.69E-01 (Median)
Studied Phenotype	Celiac disease[ ICD-11:DA95]
Experimental Material	Patient tissue samples
Colon cancer	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC20A2 in colon adenocarcinoma			[ 5 ]
Location	5'UTR (cg15212349)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:3.21E+00	Statistic Test	p-value:1.27E-05; Z-score:7.04E+00
Methylation in Case	3.46E-01 (Median)	Methylation in Control	1.08E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC20A2 in colon adenocarcinoma			[ 5 ]
Location	TSS1500 (cg18141830)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.61E+00	Statistic Test	p-value:3.74E-04; Z-score:4.00E+00
Methylation in Case	3.12E-01 (Median)	Methylation in Control	1.94E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Colorectal cancer	11 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC20A2 in colorectal cancer			[ 6 ]
Location	5'UTR (cg21921016)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.26E+00	Statistic Test	p-value:5.34E-07; Z-score:1.81E+00
Methylation in Case	8.34E-01 (Median)	Methylation in Control	6.63E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC20A2 in colorectal cancer			[ 6 ]
Location	5'UTR (cg10806146)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.33E+00	Statistic Test	p-value:1.96E-04; Z-score:1.30E+00
Methylation in Case	7.36E-01 (Median)	Methylation in Control	5.55E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC20A2 in colorectal cancer			[ 6 ]
Location	5'UTR (cg22855020)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.21E+00	Statistic Test	p-value:2.67E-04; Z-score:1.08E+00
Methylation in Case	8.34E-01 (Median)	Methylation in Control	6.90E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC20A2 in colorectal cancer			[ 6 ]
Location	5'UTR (cg15936066)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.22E+00	Statistic Test	p-value:5.93E-04; Z-score:1.17E+00
Methylation in Case	7.90E-01 (Median)	Methylation in Control	6.47E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC20A2 in colorectal cancer			[ 6 ]
Location	5'UTR (cg00025347)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:2.16E-03; Z-score:-4.76E-01
Methylation in Case	9.45E-01 (Median)	Methylation in Control	9.51E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC20A2 in colorectal cancer			[ 6 ]
Location	Body (cg14551279)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.00E+00	Statistic Test	p-value:4.31E-03; Z-score:1.59E-01
Methylation in Case	9.36E-01 (Median)	Methylation in Control	9.35E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC20A2 in colorectal cancer			[ 6 ]
Location	Body (cg20370839)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.01E+00	Statistic Test	p-value:8.45E-03; Z-score:4.92E-01
Methylation in Case	9.63E-01 (Median)	Methylation in Control	9.58E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC20A2 in colorectal cancer			[ 6 ]
Location	Body (cg10308027)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.00E+00	Statistic Test	p-value:2.84E-02; Z-score:-2.13E-01
Methylation in Case	9.41E-01 (Median)	Methylation in Control	9.43E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC20A2 in colorectal cancer			[ 6 ]
Location	Body (cg05937663)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.00E+00	Statistic Test	p-value:2.95E-02; Z-score:1.62E-01
Methylation in Case	9.59E-01 (Median)	Methylation in Control	9.59E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC20A2 in colorectal cancer			[ 6 ]
Location	Body (cg05561775)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.00E+00	Statistic Test	p-value:4.69E-02; Z-score:-2.53E-02
Methylation in Case	9.37E-01 (Median)	Methylation in Control	9.37E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC20A2 in colorectal cancer			[ 6 ]
Location	3'UTR (cg00409552)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.01E+00	Statistic Test	p-value:2.15E-03; Z-score:4.57E-01
Methylation in Case	9.67E-01 (Median)	Methylation in Control	9.62E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Depression	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC20A2 in depression			[ 7 ]
Location	5'UTR (cg21921016)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.02E+00	Statistic Test	p-value:1.78E-03; Z-score:5.65E-01
Methylation in Case	8.48E-01 (Median)	Methylation in Control	8.34E-01 (Median)
Studied Phenotype	Depression[ ICD-11:6A8Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC20A2 in depression			[ 7 ]
Location	5'UTR (cg10806146)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.03E+00	Statistic Test	p-value:3.46E-02; Z-score:1.86E-01
Methylation in Case	3.68E-01 (Median)	Methylation in Control	3.57E-01 (Median)
Studied Phenotype	Depression[ ICD-11:6A8Z]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC20A2 in hepatocellular carcinoma			[ 8 ]
Location	5'UTR (cg10806146)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.16E+00	Statistic Test	p-value:1.98E-03; Z-score:-6.84E-01
Methylation in Case	4.15E-01 (Median)	Methylation in Control	4.81E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC20A2 in hepatocellular carcinoma			[ 8 ]
Location	5'UTR (cg00025347)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:2.43E-03; Z-score:-5.08E-01
Methylation in Case	8.75E-01 (Median)	Methylation in Control	8.83E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC20A2 in hepatocellular carcinoma			[ 8 ]
Location	5'UTR (cg26248082)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:2.56E-03; Z-score:-5.14E-01
Methylation in Case	6.43E-01 (Median)	Methylation in Control	6.67E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC20A2 in hepatocellular carcinoma			[ 8 ]
Location	Body (cg15469704)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:2.14E-05; Z-score:-6.68E-01
Methylation in Case	6.77E-01 (Median)	Methylation in Control	7.05E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC20A2 in hepatocellular carcinoma			[ 8 ]
Location	Body (cg10308027)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:2.10E-04; Z-score:-9.33E-01
Methylation in Case	8.62E-01 (Median)	Methylation in Control	8.80E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC20A2 in hepatocellular carcinoma			[ 8 ]
Location	Body (cg10423743)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.00E+00	Statistic Test	p-value:1.32E-02; Z-score:-3.11E-01
Methylation in Case	8.68E-01 (Median)	Methylation in Control	8.72E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC20A2 in hepatocellular carcinoma			[ 8 ]
Location	3'UTR (cg21163347)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-2.94E+00	Statistic Test	p-value:1.19E-25; Z-score:-4.36E+00
Methylation in Case	2.54E-01 (Median)	Methylation in Control	7.48E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
HIV infection	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC20A2 in HIV infection			[ 9 ]
Location	5'UTR (cg22855020)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.48E+00	Statistic Test	p-value:3.14E-09; Z-score:3.91E+00
Methylation in Case	6.80E-01 (Median)	Methylation in Control	4.59E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC20A2 in HIV infection			[ 9 ]
Location	5'UTR (cg15936066)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.49E+00	Statistic Test	p-value:1.30E-08; Z-score:3.66E+00
Methylation in Case	5.80E-01 (Median)	Methylation in Control	3.90E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC20A2 in HIV infection			[ 9 ]
Location	5'UTR (cg10806146)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.40E+00	Statistic Test	p-value:5.73E-07; Z-score:2.89E+00
Methylation in Case	5.64E-01 (Median)	Methylation in Control	4.03E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC20A2 in HIV infection			[ 9 ]
Location	5'UTR (cg26248082)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.08E+00	Statistic Test	p-value:4.51E-06; Z-score:1.44E+00
Methylation in Case	8.25E-01 (Median)	Methylation in Control	7.62E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC20A2 in HIV infection			[ 9 ]
Location	5'UTR (cg21921016)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.01E+00	Statistic Test	p-value:3.04E-02; Z-score:3.78E-01
Methylation in Case	9.32E-01 (Median)	Methylation in Control	9.23E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC20A2 in HIV infection			[ 9 ]
Location	Body (cg24353706)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:7.82E-04; Z-score:-8.84E-01
Methylation in Case	9.16E-01 (Median)	Methylation in Control	9.28E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC20A2 in lung adenocarcinoma			[ 10 ]
Location	5'UTR (cg10806146)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.45E+00	Statistic Test	p-value:1.88E-05; Z-score:5.89E+00
Methylation in Case	5.52E-01 (Median)	Methylation in Control	3.79E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC20A2 in lung adenocarcinoma			[ 10 ]
Location	5'UTR (cg15936066)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.52E+00	Statistic Test	p-value:7.06E-05; Z-score:4.23E+00
Methylation in Case	5.51E-01 (Median)	Methylation in Control	3.62E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC20A2 in lung adenocarcinoma			[ 10 ]
Location	5'UTR (cg26248082)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.17E+00	Statistic Test	p-value:9.38E-04; Z-score:2.26E+00
Methylation in Case	7.25E-01 (Median)	Methylation in Control	6.20E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC20A2 in lung adenocarcinoma			[ 10 ]
Location	5'UTR (cg22855020)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.32E+00	Statistic Test	p-value:1.21E-03; Z-score:3.60E+00
Methylation in Case	6.21E-01 (Median)	Methylation in Control	4.69E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Panic disorder	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC20A2 in panic disorder			[ 11 ]
Location	5'UTR (cg10806146)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-7.07E-01	Statistic Test	p-value:2.22E-04; Z-score:-6.41E-01
Methylation in Case	-1.67E+00 (Median)	Methylation in Control	-1.18E+00 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC20A2 in panic disorder			[ 11 ]
Location	5'UTR (cg15936066)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-7.85E-01	Statistic Test	p-value:5.30E-03; Z-score:-5.61E-01
Methylation in Case	-1.41E+00 (Median)	Methylation in Control	-1.10E+00 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC20A2 in panic disorder			[ 11 ]
Location	5'UTR (cg22855020)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-6.85E-01	Statistic Test	p-value:1.33E-02; Z-score:-4.81E-01
Methylation in Case	-8.96E-01 (Median)	Methylation in Control	-6.13E-01 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC20A2 in panic disorder			[ 11 ]
Location	Body (cg05937663)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:3.44E-02; Z-score:-2.82E-01
Methylation in Case	3.12E+00 (Median)	Methylation in Control	3.28E+00 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	12 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC20A2 in pancretic ductal adenocarcinoma			[ 12 ]
Location	TSS1500 (cg04622103)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.16E+00	Statistic Test	p-value:1.24E-02; Z-score:-5.73E-01
Methylation in Case	1.03E-01 (Median)	Methylation in Control	1.20E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC20A2 in pancretic ductal adenocarcinoma			[ 12 ]
Location	TSS1500 (cg13976045)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:1.48E-02; Z-score:-3.22E-01
Methylation in Case	7.14E-02 (Median)	Methylation in Control	7.45E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC20A2 in pancretic ductal adenocarcinoma			[ 12 ]
Location	TSS200 (cg13280283)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.06E+00	Statistic Test	p-value:4.35E-03; Z-score:2.34E-01
Methylation in Case	4.41E-02 (Median)	Methylation in Control	4.16E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC20A2 in pancretic ductal adenocarcinoma			[ 12 ]
Location	TSS200 (cg00199007)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.16E+00	Statistic Test	p-value:1.30E-02; Z-score:-3.44E-01
Methylation in Case	1.73E-01 (Median)	Methylation in Control	2.00E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC20A2 in pancretic ductal adenocarcinoma			[ 12 ]
Location	1stExon (cg25010124)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:2.88E-02; Z-score:-3.13E-01
Methylation in Case	5.90E-01 (Median)	Methylation in Control	6.22E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC20A2 in pancretic ductal adenocarcinoma			[ 12 ]
Location	Body (cg03924551)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.14E+00	Statistic Test	p-value:1.09E-14; Z-score:-1.92E+00
Methylation in Case	6.80E-01 (Median)	Methylation in Control	7.76E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC20A2 in pancretic ductal adenocarcinoma			[ 12 ]
Location	Body (cg10791541)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.31E+00	Statistic Test	p-value:2.52E-08; Z-score:-1.76E+00
Methylation in Case	4.15E-01 (Median)	Methylation in Control	5.44E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC20A2 in pancretic ductal adenocarcinoma			[ 12 ]
Location	Body (cg14645545)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.58E+00	Statistic Test	p-value:5.10E-08; Z-score:-1.43E+00
Methylation in Case	1.75E-01 (Median)	Methylation in Control	2.77E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC20A2 in pancretic ductal adenocarcinoma			[ 12 ]
Location	Body (cg25211622)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.59E+00	Statistic Test	p-value:7.71E-06; Z-score:1.75E+00
Methylation in Case	9.45E-01 (Median)	Methylation in Control	5.94E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC20A2 in pancretic ductal adenocarcinoma			[ 12 ]
Location	Body (cg18517517)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.02E+00	Statistic Test	p-value:5.92E-04; Z-score:5.85E-01
Methylation in Case	7.89E-01 (Median)	Methylation in Control	7.77E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC20A2 in pancretic ductal adenocarcinoma			[ 12 ]
Location	Body (cg09884940)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.01E+00	Statistic Test	p-value:2.61E-02; Z-score:5.50E-01
Methylation in Case	8.98E-01 (Median)	Methylation in Control	8.92E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of SLC20A2 in pancretic ductal adenocarcinoma			[ 12 ]
Location	Body (cg06637017)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.00E+00	Statistic Test	p-value:4.62E-02; Z-score:3.07E-02
Methylation in Case	8.53E-01 (Median)	Methylation in Control	8.52E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Prostate cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC20A2 in prostate cancer			[ 13 ]
Location	TSS1500 (cg14450766)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.63E+00	Statistic Test	p-value:6.05E-03; Z-score:3.27E+00
Methylation in Case	6.59E-01 (Median)	Methylation in Control	4.04E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC20A2 in prostate cancer			[ 13 ]
Location	Body (cg20682573)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.05E+00	Statistic Test	p-value:1.78E-02; Z-score:2.35E+00
Methylation in Case	9.54E-01 (Median)	Methylation in Control	9.12E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC20A2 in prostate cancer			[ 13 ]
Location	Body (cg00790847)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.03E+00	Statistic Test	p-value:3.73E-02; Z-score:1.81E+00
Methylation in Case	9.26E-01 (Median)	Methylation in Control	9.02E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC20A2 in prostate cancer			[ 13 ]
Location	Body (cg14061497)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.03E+00	Statistic Test	p-value:3.90E-02; Z-score:1.67E+00
Methylation in Case	9.46E-01 (Median)	Methylation in Control	9.19E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Renal cell carcinoma	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC20A2 in clear cell renal cell carcinoma			[ 14 ]
Location	Body (cg10423743)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.01E+00	Statistic Test	p-value:2.30E-05; Z-score:1.01E+00
Methylation in Case	9.68E-01 (Median)	Methylation in Control	9.58E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC20A2 in clear cell renal cell carcinoma			[ 14 ]
Location	Body (cg05561775)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.01E+00	Statistic Test	p-value:2.08E-03; Z-score:9.02E-01
Methylation in Case	9.65E-01 (Median)	Methylation in Control	9.55E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC20A2 in papillary thyroid cancer			[ 15 ]
Location	Body (cg14551279)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:1.63E-04; Z-score:-6.49E-01
Methylation in Case	8.73E-01 (Median)	Methylation in Control	8.85E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC20A2 in papillary thyroid cancer			[ 15 ]
Location	Body (cg10423743)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.02E+00	Statistic Test	p-value:3.47E-04; Z-score:1.15E+00
Methylation in Case	9.30E-01 (Median)	Methylation in Control	9.07E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC20A2 in papillary thyroid cancer			[ 15 ]
Location	Body (cg04025550)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.00E+00	Statistic Test	p-value:2.31E-03; Z-score:-4.37E-01
Methylation in Case	9.43E-01 (Median)	Methylation in Control	9.47E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC20A2 in papillary thyroid cancer			[ 15 ]
Location	Body (cg05937663)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:7.81E-03; Z-score:-6.13E-01
Methylation in Case	9.48E-01 (Median)	Methylation in Control	9.54E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC20A2 in systemic lupus erythematosus			[ 16 ]
Location	Body (cg05561775)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:6.73E-04; Z-score:-2.41E-01
Methylation in Case	9.06E-01 (Median)	Methylation in Control	9.10E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC20A2 in systemic lupus erythematosus			[ 16 ]
Location	Body (cg05937663)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.00E+00	Statistic Test	p-value:2.58E-03; Z-score:-1.47E-01
Methylation in Case	9.25E-01 (Median)	Methylation in Control	9.28E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC20A2 in systemic lupus erythematosus			[ 16 ]
Location	3'UTR (cg26696906)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.00E+00	Statistic Test	p-value:1.06E-02; Z-score:-1.90E-01
Methylation in Case	9.40E-01 (Median)	Methylation in Control	9.43E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
microRNA
Unclear Phenotype	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	miR-218 directly targets SLC20A2			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-218	miRNA Mature ID	miR-218-5p
miRNA Sequence	UUGUGCUUGAUCUAACCAUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon2	miR-877 directly targets SLC20A2			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	CLASH
miRNA Stemloop ID	miR-877	miRNA Mature ID	miR-877-3p
miRNA Sequence	UCCUCUUCUCCCUCCUCCCAG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)

References
1	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2	DNA Methylation Dynamics in Urological Tumors.
3	Genome-wide Scan for Methylation Profiles in Breast Cancer
4	The methylome of the celiac intestinal epithelium harbours genotype-independent alterations in the HLA region. Mol Ther Oncolytics. 2019 Feb 5;12:235-245.
5	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
6	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
7	DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
8	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
9	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
10	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
11	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
12	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
13	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
14	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
15	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
16	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
17	MicroRNA 218 acts as a tumor suppressor by targeting multiple cancer phenotype-associated genes in medulloblastoma. J Biol Chem. 2013 Jan 18;288(3):1918-28.
18	Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence