Detail Information of Epigenetic Regulations
General Information of Drug Transporter (DT) | |||||
---|---|---|---|---|---|
DT ID | DTD0133 Transporter Info | ||||
Gene Name | SLC1A5 | ||||
Transporter Name | Alanine/serine/cysteine/threonine transporter 2 | ||||
Gene ID | |||||
UniProt ID | |||||
Epigenetic Regulations of This DT (EGR) | |||||
---|---|---|---|---|---|
Methylation |
|||||
Bladder cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC1A5 in bladder cancer | [ 1 ] | |||
Location |
TSS1500 (cg08533710) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.22E+00 | Statistic Test | p-value:2.73E-02; Z-score:-2.13E+00 | ||
Methylation in Case |
3.93E-01 (Median) | Methylation in Control | 4.79E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Breast cancer |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC1A5 in breast cancer | [ 2 ] | |||
Location |
TSS1500 (cg23391214) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.61E+00 | Statistic Test | p-value:1.47E-03; Z-score:-1.94E+00 | ||
Methylation in Case |
7.72E-02 (Median) | Methylation in Control | 1.24E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC1A5 in breast cancer | [ 2 ] | |||
Location |
TSS1500 (cg08533710) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.16E+00 | Statistic Test | p-value:2.90E-02; Z-score:-1.44E+00 | ||
Methylation in Case |
4.78E-01 (Median) | Methylation in Control | 5.57E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Renal cell carcinoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC1A5 in clear cell renal cell carcinoma | [ 3 ] | |||
Location |
TSS1500 (cg08533710) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.07E+00 | Statistic Test | p-value:6.80E-03; Z-score:7.57E-01 | ||
Methylation in Case |
6.24E-01 (Median) | Methylation in Control | 5.86E-01 (Median) | ||
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
Experimental Material |
Patient tissue samples | ||||
Colorectal cancer |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC1A5 in colorectal cancer | [ 4 ] | |||
Location |
TSS1500 (cg23391214) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.83E+00 | Statistic Test | p-value:1.67E-04; Z-score:-1.61E+00 | ||
Methylation in Case |
2.43E-01 (Median) | Methylation in Control | 4.45E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC1A5 in colorectal cancer | [ 4 ] | |||
Location |
TSS1500 (cg12297570) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.11E+00 | Statistic Test | p-value:1.00E-03; Z-score:8.01E-01 | ||
Methylation in Case |
9.37E-02 (Median) | Methylation in Control | 8.42E-02 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC1A5 in colorectal cancer | [ 4 ] | |||
Location |
TSS1500 (cg08533710) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:1.06E-02; Z-score:-6.49E-01 | ||
Methylation in Case |
6.80E-01 (Median) | Methylation in Control | 7.34E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Hepatocellular carcinoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC1A5 in hepatocellular carcinoma | [ 5 ] | |||
Location |
TSS1500 (cg08533710) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.12E+00 | Statistic Test | p-value:7.23E-05; Z-score:6.30E-01 | ||
Methylation in Case |
6.12E-01 (Median) | Methylation in Control | 5.46E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Systemic lupus erythematosus |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC1A5 in systemic lupus erythematosus | [ 6 ] | |||
Location |
TSS1500 (cg23391214) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:3.25E-03; Z-score:-2.16E-01 | ||
Methylation in Case |
8.71E-02 (Median) | Methylation in Control | 9.16E-02 (Median) | ||
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Colon cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC1A5 in colon adenocarcinoma | [ 7 ] | |||
Location |
TSS200 (cg20551181) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.27E+00 | Statistic Test | p-value:1.05E-03; Z-score:9.75E-01 | ||
Methylation in Case |
4.64E-01 (Median) | Methylation in Control | 3.65E-01 (Median) | ||
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
Experimental Material |
Patient tissue samples | ||||
Pancretic ductal adenocarcinoma |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC1A5 in pancretic ductal adenocarcinoma | [ 8 ] | |||
Location |
Body (cg22708635) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.08E+00 | Statistic Test | p-value:1.07E-04; Z-score:9.88E-01 | ||
Methylation in Case |
7.46E-01 (Median) | Methylation in Control | 6.93E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC1A5 in pancretic ductal adenocarcinoma | [ 8 ] | |||
Location |
Body (cg09481056) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.17E-02; Z-score:-1.48E-01 | ||
Methylation in Case |
8.05E-01 (Median) | Methylation in Control | 8.10E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Rheumatoid arthritis |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Hypomethylation of SLC1A5 in rheumatoid arthritis | [ 10 ] | |||
Epigenetic Type |
Methylation | Experiment Method | HumanMethylation450 BeadChip | ||
Studied Phenotype |
Rheumatoid arthritis[ ICD-11:FA20] | ||||
Experimental Material |
Patient tissue samples | ||||
Additional Notes |
SLC1A5 was the most hypermethyaltion gene in rheumatoid arthritis. | ||||
Craniopharyngioma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Significant hypomethylation of SLC1A5 in craniopharyngioma than that in healthy individual | ||||
Studied Phenotype |
Craniopharyngioma [ICD-11:2F9A] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:6.42E-17; Fold-change:-0.436998223; Z-score:-10.59168556 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() | ||||
Esthesioneuroblastoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Significant hypomethylation of SLC1A5 in esthesioneuroblastoma than that in healthy individual | ||||
Studied Phenotype |
Esthesioneuroblastoma [ICD-11:2D50.1] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:6.96E-18; Fold-change:-0.44574971; Z-score:-11.75569871 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() | ||||
Obesity |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Significant hypomethylation of SLC1A5 in obesity than that in healthy individual | ||||
Studied Phenotype |
Obesity [ICD-11:5B81] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:3.40E-13; Fold-change:-0.310174486; Z-score:-3.20449883 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() | ||||
Histone acetylation |
|||||
Chronic social defeat stress |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Hyperacetylation of SLC1A5 in chronic social defeat stress (compare with normal control mice) | [ 9 ] | |||
Location |
Promoter | ||||
Epigenetic Type |
Histone acetylation | Experiment Method | Chromatin immunoprecipitation | ||
Related Molecular Changes | Up regulation ofSLC1A5 | Experiment Method | RT-qPCR | ||
Studied Phenotype |
Chronic social defeat stress[ ICD-11:QE01] | ||||
Experimental Material |
Model organism in vivo (mouse) | ||||
Additional Notes |
Chronic social stress activates ASCT2 transcription via histone acetylation in its promoter. | ||||
Epigenetic Phenomenon2 |
Hyperacetylation of SLC1A5 in chronic social defeat stress (compare with normal control mice) | [ 9 ] | |||
Location |
Promoter | ||||
Epigenetic Type |
Histone acetylation | Experiment Method | Chromatin immunoprecipitation | ||
Related Molecular Changes | Up regulation ofSLC1A5 | Experiment Method | RT-qPCR | ||
Studied Phenotype |
Chronic social defeat stress[ ICD-11:QE01] | ||||
Experimental Material |
Model organism in vivo (mouse) | ||||
Additional Notes |
Chronic social stress activates ASCT2 transcription via histone acetylation in its promoter. | ||||
microRNA |
|||||
Unclear Phenotype |
160 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
miR-106a directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-106a | miRNA Mature ID | miR-106a-5p | ||
miRNA Sequence |
AAAAGUGCUUACAGUGCAGGUAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon2 |
miR-106b directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-106b | miRNA Mature ID | miR-106b-5p | ||
miRNA Sequence |
UAAAGUGCUGACAGUGCAGAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon3 |
miR-122 directly targets SLC1A5 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-122 | miRNA Mature ID | miR-122-5p | ||
miRNA Sequence |
UGGAGUGUGACAAUGGUGUUUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon4 |
miR-1224 directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-1224 | miRNA Mature ID | miR-1224-3p | ||
miRNA Sequence |
CCCCACCUCCUCUCUCCUCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon5 |
miR-1226 directly targets SLC1A5 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
miRNA Stemloop ID |
miR-1226 | miRNA Mature ID | miR-1226-3p | ||
miRNA Sequence |
UCACCAGCCCUGUGUUCCCUAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon6 |
miR-1227 directly targets SLC1A5 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-1227 | miRNA Mature ID | miR-1227-3p | ||
miRNA Sequence |
CGUGCCACCCUUUUCCCCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Left ventricular cardiac tissues of human | ||||
Epigenetic Phenomenon7 |
miR-1234 directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-1234 | miRNA Mature ID | miR-1234-3p | ||
miRNA Sequence |
UCGGCCUGACCACCCACCCCAC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon8 |
miR-125a directly targets SLC1A5 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-125a | miRNA Mature ID | miR-125a-3p | ||
miRNA Sequence |
ACAGGUGAGGUUCUUGGGAGCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon9 |
miR-125a directly targets SLC1A5 | [ 15 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Sequencing | ||
miRNA Stemloop ID |
miR-125a | miRNA Mature ID | miR-125a-5p | ||
miRNA Sequence |
UCCCUGAGACCCUUUAACCUGUGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon10 |
miR-1260a directly targets SLC1A5 | [ 16 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-1260a | miRNA Mature ID | miR-1260a | ||
miRNA Sequence |
AUCCCACCUCUGCCACCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon11 |
miR-1260b directly targets SLC1A5 | [ 16 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-1260b | miRNA Mature ID | miR-1260b | ||
miRNA Sequence |
AUCCCACCACUGCCACCAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon12 |
miR-1267 directly targets SLC1A5 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-1267 | miRNA Mature ID | miR-1267 | ||
miRNA Sequence |
CCUGUUGAAGUGUAAUCCCCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon13 |
miR-1295b directly targets SLC1A5 | [ 16 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-1295b | miRNA Mature ID | miR-1295b-3p | ||
miRNA Sequence |
AAUAGGCCACGGAUCUGGGCAA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon14 |
miR-1304 directly targets SLC1A5 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-1304 | miRNA Mature ID | miR-1304-3p | ||
miRNA Sequence |
UCUCACUGUAGCCUCGAACCCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon15 |
miR-1307 directly targets SLC1A5 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-1307 | miRNA Mature ID | miR-1307-3p | ||
miRNA Sequence |
ACUCGGCGUGGCGUCGGUCGUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon16 |
miR-143 directly targets SLC1A5 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-143 | miRNA Mature ID | miR-143-5p | ||
miRNA Sequence |
GGUGCAGUGCUGCAUCUCUGGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon17 |
miR-149 directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-149 | miRNA Mature ID | miR-149-3p | ||
miRNA Sequence |
AGGGAGGGACGGGGGCUGUGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon18 |
miR-150 directly targets SLC1A5 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-150 | miRNA Mature ID | miR-150-5p | ||
miRNA Sequence |
UCUCCCAACCCUUGUACCAGUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Left ventricular cardiac tissues of human | ||||
Epigenetic Phenomenon19 |
miR-155 directly targets SLC1A5 | [ 17 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Proteomics | ||
miRNA Stemloop ID |
miR-155 | miRNA Mature ID | miR-155-5p | ||
miRNA Sequence |
UUAAUGCUAAUCGUGAUAGGGGUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
Epigenetic Phenomenon20 |
miR-15a directly targets SLC1A5 | [ 16 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-15a | miRNA Mature ID | miR-15a-3p | ||
miRNA Sequence |
CAGGCCAUAUUGUGCUGCCUCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon21 |
miR-15b directly targets SLC1A5 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
miRNA Stemloop ID |
miR-15b | miRNA Mature ID | miR-15b-5p | ||
miRNA Sequence |
UAGCAGCACAUCAUGGUUUACA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon22 |
miR-16 directly targets SLC1A5 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
miRNA Stemloop ID |
miR-16 | miRNA Mature ID | miR-16-5p | ||
miRNA Sequence |
UAGCAGCACGUAAAUAUUGGCG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon23 |
miR-17 directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-17 | miRNA Mature ID | miR-17-5p | ||
miRNA Sequence |
CAAAGUGCUUACAGUGCAGGUAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon24 |
miR-186 directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-186 | miRNA Mature ID | miR-186-3p | ||
miRNA Sequence |
GCCCAAAGGUGAAUUUUUUGGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon25 |
miR-188 directly targets SLC1A5 | [ 16 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-188 | miRNA Mature ID | miR-188-3p | ||
miRNA Sequence |
CUCCCACAUGCAGGGUUUGCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon26 |
miR-193b directly targets SLC1A5 | [ 18 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Proteomics | ||
miRNA Stemloop ID |
miR-193b | miRNA Mature ID | miR-193b-3p | ||
miRNA Sequence |
AACUGGCCCUCAAAGUCCCGCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human breast adenocarcinoma cell line (MCF-7) | ||||
Epigenetic Phenomenon27 |
miR-1976 directly targets SLC1A5 | [ 19 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-1976 | miRNA Mature ID | miR-1976 | ||
miRNA Sequence |
CCUCCUGCCCUCCUUGCUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon28 |
miR-20a directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-20a | miRNA Mature ID | miR-20a-5p | ||
miRNA Sequence |
UAAAGUGCUUAUAGUGCAGGUAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon29 |
miR-20b directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-20b | miRNA Mature ID | miR-20b-5p | ||
miRNA Sequence |
CAAAGUGCUCAUAGUGCAGGUAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon30 |
miR-214 directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-214 | miRNA Mature ID | miR-214-5p | ||
miRNA Sequence |
UGCCUGUCUACACUUGCUGUGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon31 |
miR-218 directly targets SLC1A5 | [ 20 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-218 | miRNA Mature ID | miR-218-5p | ||
miRNA Sequence |
UUGUGCUUGAUCUAACCAUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon32 |
miR-2276 directly targets SLC1A5 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-2276 | miRNA Mature ID | miR-2276-3p | ||
miRNA Sequence |
UCUGCAAGUGUCAGAGGCGAGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon33 |
miR-23a directly targets SLC1A5 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-23a | miRNA Mature ID | miR-23a-5p | ||
miRNA Sequence |
GGGGUUCCUGGGGAUGGGAUUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon34 |
miR-23b directly targets SLC1A5 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-23b | miRNA Mature ID | miR-23b-5p | ||
miRNA Sequence |
UGGGUUCCUGGCAUGCUGAUUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon35 |
miR-24 directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-24 | miRNA Mature ID | miR-24-3p | ||
miRNA Sequence |
UGGCUCAGUUCAGCAGGAACAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon36 |
miR-2681 directly targets SLC1A5 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-2681 | miRNA Mature ID | miR-2681-3p | ||
miRNA Sequence |
UAUCAUGGAGUUGGUAAAGCAC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon37 |
miR-29a directly targets SLC1A5 | [ 16 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-29a | miRNA Mature ID | miR-29a-5p | ||
miRNA Sequence |
ACUGAUUUCUUUUGGUGUUCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon38 |
miR-302a directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-302a | miRNA Mature ID | miR-302a-3p | ||
miRNA Sequence |
UAAGUGCUUCCAUGUUUUGGUGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon39 |
miR-302b directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-302b | miRNA Mature ID | miR-302b-3p | ||
miRNA Sequence |
UAAGUGCUUCCAUGUUUUAGUAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon40 |
miR-302c directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-302c | miRNA Mature ID | miR-302c-3p | ||
miRNA Sequence |
UAAGUGCUUCCAUGUUUCAGUGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon41 |
miR-302d directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-302d | miRNA Mature ID | miR-302d-3p | ||
miRNA Sequence |
UAAGUGCUUCCAUGUUUGAGUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon42 |
miR-302e directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-302e | miRNA Mature ID | miR-302e | ||
miRNA Sequence |
UAAGUGCUUCCAUGCUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon43 |
miR-30b directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-30b | miRNA Mature ID | miR-30b-3p | ||
miRNA Sequence |
CUGGGAGGUGGAUGUUUACUUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon44 |
miR-3122 directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3122 | miRNA Mature ID | miR-3122 | ||
miRNA Sequence |
GUUGGGACAAGAGGACGGUCUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon45 |
miR-3130 directly targets SLC1A5 | [ 21 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3130 | miRNA Mature ID | miR-3130-3p | ||
miRNA Sequence |
GCUGCACCGGAGACUGGGUAA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon46 |
miR-3135b directly targets SLC1A5 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3135b | miRNA Mature ID | miR-3135b | ||
miRNA Sequence |
GGCUGGAGCGAGUGCAGUGGUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon47 |
miR-3156 directly targets SLC1A5 | [ 16 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3156 | miRNA Mature ID | miR-3156-3p | ||
miRNA Sequence |
CUCCCACUUCCAGAUCUUUCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon48 |
miR-3159 directly targets SLC1A5 | [ 19 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3159 | miRNA Mature ID | miR-3159 | ||
miRNA Sequence |
UAGGAUUACAAGUGUCGGCCAC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon49 |
miR-3192 directly targets SLC1A5 | [ 16 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3192 | miRNA Mature ID | miR-3192-3p | ||
miRNA Sequence |
CUCUGAUCGCCCUCUCAGCUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon50 |
miR-3199 directly targets SLC1A5 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3199 | miRNA Mature ID | miR-3199 | ||
miRNA Sequence |
AGGGACUGCCUUAGGAGAAAGUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Left ventricular cardiac tissues of human | ||||
Epigenetic Phenomenon51 |
miR-324 directly targets SLC1A5 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
miRNA Stemloop ID |
miR-324 | miRNA Mature ID | miR-324-3p | ||
miRNA Sequence |
CCCACUGCCCCAGGUGCUGCUGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon52 |
miR-330 directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-330 | miRNA Mature ID | miR-330-3p | ||
miRNA Sequence |
GCAAAGCACACGGCCUGCAGAGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon53 |
miR-331 directly targets SLC1A5 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-331 | miRNA Mature ID | miR-331-3p | ||
miRNA Sequence |
GCCCCUGGGCCUAUCCUAGAA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon54 |
miR-34a directly targets SLC1A5 | [ 22 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Proteomics | ||
miRNA Stemloop ID |
miR-34a | miRNA Mature ID | miR-34a-5p | ||
miRNA Sequence |
UGGCAGUGUCUUAGCUGGUUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human colorectal cancer cell line (SW480) | ||||
Epigenetic Phenomenon55 |
miR-3622b directly targets SLC1A5 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3622b | miRNA Mature ID | miR-3622b-5p | ||
miRNA Sequence |
AGGCAUGGGAGGUCAGGUGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon56 |
miR-3652 directly targets SLC1A5 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3652 | miRNA Mature ID | miR-3652 | ||
miRNA Sequence |
CGGCUGGAGGUGUGAGGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon57 |
miR-365a directly targets SLC1A5 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-365a | miRNA Mature ID | miR-365a-5p | ||
miRNA Sequence |
AGGGACUUUUGGGGGCAGAUGUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Left ventricular cardiac tissues of human | ||||
Epigenetic Phenomenon58 |
miR-365b directly targets SLC1A5 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-365b | miRNA Mature ID | miR-365b-5p | ||
miRNA Sequence |
AGGGACUUUCAGGGGCAGCUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Left ventricular cardiac tissues of human | ||||
Epigenetic Phenomenon59 |
miR-3664 directly targets SLC1A5 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3664 | miRNA Mature ID | miR-3664-5p | ||
miRNA Sequence |
AACUCUGUCUUCACUCAUGAGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon60 |
miR-367 directly targets SLC1A5 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-367 | miRNA Mature ID | miR-367-5p | ||
miRNA Sequence |
ACUGUUGCUAAUAUGCAACUCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon61 |
miR-3689c directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3689c | miRNA Mature ID | miR-3689c | ||
miRNA Sequence |
CUGGGAGGUGUGAUAUUGUGGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon62 |
miR-372 directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-372 | miRNA Mature ID | miR-372-3p | ||
miRNA Sequence |
AAAGUGCUGCGACAUUUGAGCGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon63 |
miR-373 directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-373 | miRNA Mature ID | miR-373-3p | ||
miRNA Sequence |
GAAGUGCUUCGAUUUUGGGGUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon64 |
miR-378a directly targets SLC1A5 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-378a | miRNA Mature ID | miR-378a-5p | ||
miRNA Sequence |
CUCCUGACUCCAGGUCCUGUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon65 |
miR-383 directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-383 | miRNA Mature ID | miR-383-3p | ||
miRNA Sequence |
ACAGCACUGCCUGGUCAGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon66 |
miR-3909 directly targets SLC1A5 | [ 23 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3909 | miRNA Mature ID | miR-3909 | ||
miRNA Sequence |
UGUCCUCUAGGGCCUGCAGUCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon67 |
miR-3913 directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3913 | miRNA Mature ID | miR-3913-5p | ||
miRNA Sequence |
UUUGGGACUGAUCUUGAUGUCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon68 |
miR-3920 directly targets SLC1A5 | [ 16 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3920 | miRNA Mature ID | miR-3920 | ||
miRNA Sequence |
ACUGAUUAUCUUAACUCUCUGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon69 |
miR-3926 directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3926 | miRNA Mature ID | miR-3926 | ||
miRNA Sequence |
UGGCCAAAAAGCAGGCAGAGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon70 |
miR-3934 directly targets SLC1A5 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3934 | miRNA Mature ID | miR-3934-5p | ||
miRNA Sequence |
UCAGGUGUGGAAACUGAGGCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon71 |
miR-3940 directly targets SLC1A5 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3940 | miRNA Mature ID | miR-3940-5p | ||
miRNA Sequence |
GUGGGUUGGGGCGGGCUCUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon72 |
miR-4252 directly targets SLC1A5 | [ 21 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4252 | miRNA Mature ID | miR-4252 | ||
miRNA Sequence |
GGCCACUGAGUCAGCACCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon73 |
miR-4279 directly targets SLC1A5 | [ 19 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4279 | miRNA Mature ID | miR-4279 | ||
miRNA Sequence |
CUCUCCUCCCGGCUUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon74 |
miR-4284 directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4284 | miRNA Mature ID | miR-4284 | ||
miRNA Sequence |
GGGCUCACAUCACCCCAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon75 |
miR-4292 directly targets SLC1A5 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4292 | miRNA Mature ID | miR-4292 | ||
miRNA Sequence |
CCCCUGGGCCGGCCUUGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon76 |
miR-4313 directly targets SLC1A5 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4313 | miRNA Mature ID | miR-4313 | ||
miRNA Sequence |
AGCCCCCUGGCCCCAAACCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon77 |
miR-433 directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-433 | miRNA Mature ID | miR-433-3p | ||
miRNA Sequence |
AUCAUGAUGGGCUCCUCGGUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon78 |
miR-4423 directly targets SLC1A5 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4423 | miRNA Mature ID | miR-4423-5p | ||
miRNA Sequence |
AGUUGCCUUUUUGUUCCCAUGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon79 |
miR-4430 directly targets SLC1A5 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4430 | miRNA Mature ID | miR-4430 | ||
miRNA Sequence |
AGGCUGGAGUGAGCGGAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon80 |
miR-4436b directly targets SLC1A5 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4436b | miRNA Mature ID | miR-4436b-5p | ||
miRNA Sequence |
GUCCACUUCUGCCUGCCCUGCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon81 |
miR-4438 directly targets SLC1A5 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4438 | miRNA Mature ID | miR-4438 | ||
miRNA Sequence |
CACAGGCUUAGAAAAGACAGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Left ventricular cardiac tissues of human | ||||
Epigenetic Phenomenon82 |
miR-4454 directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4454 | miRNA Mature ID | miR-4454 | ||
miRNA Sequence |
GGAUCCGAGUCACGGCACCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon83 |
miR-4507 directly targets SLC1A5 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4507 | miRNA Mature ID | miR-4507 | ||
miRNA Sequence |
CUGGGUUGGGCUGGGCUGGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon84 |
miR-455 directly targets SLC1A5 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-455 | miRNA Mature ID | miR-455-5p | ||
miRNA Sequence |
UAUGUGCCUUUGGACUACAUCG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Left ventricular cardiac tissues of human | ||||
Epigenetic Phenomenon85 |
miR-4638 directly targets SLC1A5 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4638 | miRNA Mature ID | miR-4638-5p | ||
miRNA Sequence |
ACUCGGCUGCGGUGGACAAGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon86 |
miR-4639 directly targets SLC1A5 | [ 23 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4639 | miRNA Mature ID | miR-4639-5p | ||
miRNA Sequence |
UUGCUAAGUAGGCUGAGAUUGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon87 |
miR-4690 directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4690 | miRNA Mature ID | miR-4690-5p | ||
miRNA Sequence |
GAGCAGGCGAGGCUGGGCUGAA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon88 |
miR-4715 directly targets SLC1A5 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4715 | miRNA Mature ID | miR-4715-3p | ||
miRNA Sequence |
GUGCCACCUUAACUGCAGCCAAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Left ventricular cardiac tissues of human | ||||
Epigenetic Phenomenon89 |
miR-4717 directly targets SLC1A5 | [ 16 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4717 | miRNA Mature ID | miR-4717-5p | ||
miRNA Sequence |
UAGGCCACAGCCACCCAUGUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon90 |
miR-4722 directly targets SLC1A5 | [ 19 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4722 | miRNA Mature ID | miR-4722-3p | ||
miRNA Sequence |
ACCUGCCAGCACCUCCCUGCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon91 |
miR-4728 directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4728 | miRNA Mature ID | miR-4728-5p | ||
miRNA Sequence |
UGGGAGGGGAGAGGCAGCAAGCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon92 |
miR-4742 directly targets SLC1A5 | [ 21 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4742 | miRNA Mature ID | miR-4742-3p | ||
miRNA Sequence |
UCUGUAUUCUCCUUUGCCUGCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon93 |
miR-4762 directly targets SLC1A5 | [ 16 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4762 | miRNA Mature ID | miR-4762-3p | ||
miRNA Sequence |
CUUCUGAUCAAGAUUUGUGGUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon94 |
miR-4772 directly targets SLC1A5 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4772 | miRNA Mature ID | miR-4772-3p | ||
miRNA Sequence |
CCUGCAACUUUGCCUGAUCAGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon95 |
miR-500b directly targets SLC1A5 | [ 21 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-500b | miRNA Mature ID | miR-500b-3p | ||
miRNA Sequence |
GCACCCAGGCAAGGAUUCUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon96 |
miR-504 directly targets SLC1A5 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-504 | miRNA Mature ID | miR-504-3p | ||
miRNA Sequence |
GGGAGUGCAGGGCAGGGUUUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon97 |
miR-519d directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-519d | miRNA Mature ID | miR-519d-3p | ||
miRNA Sequence |
CAAAGUGCCUCCCUUUAGAGUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon98 |
miR-520a directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-520a | miRNA Mature ID | miR-520a-3p | ||
miRNA Sequence |
AAAGUGCUUCCCUUUGGACUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon99 |
miR-520c directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-520c | miRNA Mature ID | miR-520c-3p | ||
miRNA Sequence |
AAAGUGCUUCCUUUUAGAGGGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon100 |
miR-520d directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-520d | miRNA Mature ID | miR-520d-3p | ||
miRNA Sequence |
AAAGUGCUUCUCUUUGGUGGGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon101 |
miR-520g directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-520g | miRNA Mature ID | miR-520g-3p | ||
miRNA Sequence |
ACAAAGUGCUUCCCUUUAGAGUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon102 |
miR-520h directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-520h | miRNA Mature ID | miR-520h | ||
miRNA Sequence |
ACAAAGUGCUUCCCUUUAGAGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon103 |
miR-526b directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-526b | miRNA Mature ID | miR-526b-3p | ||
miRNA Sequence |
GAAAGUGCUUCCUUUUAGAGGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon104 |
miR-552 directly targets SLC1A5 | [ 19 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-552 | miRNA Mature ID | miR-552-3p | ||
miRNA Sequence |
AACAGGUGACUGGUUAGACAA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon105 |
miR-562 directly targets SLC1A5 | [ 19 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-562 | miRNA Mature ID | miR-562 | ||
miRNA Sequence |
AAAGUAGCUGUACCAUUUGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon106 |
miR-5693 directly targets SLC1A5 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-5693 | miRNA Mature ID | miR-5693 | ||
miRNA Sequence |
GCAGUGGCUCUGAAAUGAACUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon107 |
miR-5697 directly targets SLC1A5 | [ 19 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-5697 | miRNA Mature ID | miR-5697 | ||
miRNA Sequence |
UCAAGUAGUUUCAUGAUAAAGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon108 |
miR-5698 directly targets SLC1A5 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-5698 | miRNA Mature ID | miR-5698 | ||
miRNA Sequence |
UGGGGGAGUGCAGUGAUUGUGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon109 |
miR-5704 directly targets SLC1A5 | [ 16 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-5704 | miRNA Mature ID | miR-5704 | ||
miRNA Sequence |
UUAGGCCAUCAUCCCAUUAUGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon110 |
miR-589 directly targets SLC1A5 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-589 | miRNA Mature ID | miR-589-3p | ||
miRNA Sequence |
UCAGAACAAAUGCCGGUUCCCAGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon111 |
miR-590 directly targets SLC1A5 | [ 23 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-590 | miRNA Mature ID | miR-590-3p | ||
miRNA Sequence |
UAAUUUUAUGUAUAAGCUAGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon112 |
miR-619 directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-619 | miRNA Mature ID | miR-619-5p | ||
miRNA Sequence |
GCUGGGAUUACAGGCAUGAGCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon113 |
miR-635 directly targets SLC1A5 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-635 | miRNA Mature ID | miR-635 | ||
miRNA Sequence |
ACUUGGGCACUGAAACAAUGUCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon114 |
miR-640 directly targets SLC1A5 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-640 | miRNA Mature ID | miR-640 | ||
miRNA Sequence |
AUGAUCCAGGAACCUGCCUCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon115 |
miR-6499 directly targets SLC1A5 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6499 | miRNA Mature ID | miR-6499-3p | ||
miRNA Sequence |
AGCAGUGUUUGUUUUGCCCACA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon116 |
miR-6501 directly targets SLC1A5 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6501 | miRNA Mature ID | miR-6501-5p | ||
miRNA Sequence |
AGUUGCCAGGGCUGCCUUUGGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon117 |
miR-6504 directly targets SLC1A5 | [ 19 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6504 | miRNA Mature ID | miR-6504-3p | ||
miRNA Sequence |
CAUUACAGCACAGCCAUUCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon118 |
miR-6513 directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6513 | miRNA Mature ID | miR-6513-5p | ||
miRNA Sequence |
UUUGGGAUUGACGCCACAUGUCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon119 |
miR-6514 directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6514 | miRNA Mature ID | miR-6514-3p | ||
miRNA Sequence |
CUGCCUGUUCUUCCACUCCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon120 |
miR-6727 directly targets SLC1A5 | [ 19 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6727 | miRNA Mature ID | miR-6727-3p | ||
miRNA Sequence |
UCCUGCCACCUCCUCCGCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon121 |
miR-6729 directly targets SLC1A5 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6729 | miRNA Mature ID | miR-6729-3p | ||
miRNA Sequence |
UCAUCCCCCUCGCCCUCUCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon122 |
miR-6741 directly targets SLC1A5 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6741 | miRNA Mature ID | miR-6741-3p | ||
miRNA Sequence |
UCGGCUCUCUCCCUCACCCUAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon123 |
miR-6742 directly targets SLC1A5 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6742 | miRNA Mature ID | miR-6742-3p | ||
miRNA Sequence |
ACCUGGGUUGUCCCCUCUAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon124 |
miR-6746 directly targets SLC1A5 | [ 16 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6746 | miRNA Mature ID | miR-6746-3p | ||
miRNA Sequence |
CAGCCGCCGCCUGUCUCCACAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon125 |
miR-6747 directly targets SLC1A5 | [ 19 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6747 | miRNA Mature ID | miR-6747-3p | ||
miRNA Sequence |
UCCUGCCUUCCUCUGCACCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon126 |
miR-6767 directly targets SLC1A5 | [ 24 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6767 | miRNA Mature ID | miR-6767-3p | ||
miRNA Sequence |
CCACGUGCUUCUCUUUCCGCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon127 |
miR-6774 directly targets SLC1A5 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6774 | miRNA Mature ID | miR-6774-5p | ||
miRNA Sequence |
ACUUGGGCAGGAGGGACCCUGUAUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon128 |
miR-6778 directly targets SLC1A5 | [ 19 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6778 | miRNA Mature ID | miR-6778-3p | ||
miRNA Sequence |
UGCCUCCCUGACAUUCCACAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon129 |
miR-6779 directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6779 | miRNA Mature ID | miR-6779-5p | ||
miRNA Sequence |
CUGGGAGGGGCUGGGUUUGGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon130 |
miR-6780a directly targets SLC1A5 | [ 23 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6780a | miRNA Mature ID | miR-6780a-3p | ||
miRNA Sequence |
CUCCUCUGUUUUCUUUCCUAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon131 |
miR-6785 directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6785 | miRNA Mature ID | miR-6785-5p | ||
miRNA Sequence |
UGGGAGGGCGUGGAUGAUGGUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon132 |
miR-6788 directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6788 | miRNA Mature ID | miR-6788-5p | ||
miRNA Sequence |
CUGGGAGAAGAGUGGUGAAGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon133 |
miR-6790 directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6790 | miRNA Mature ID | miR-6790-3p | ||
miRNA Sequence |
CGACCUCGGCGACCCCUCACU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon134 |
miR-6791 directly targets SLC1A5 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6791 | miRNA Mature ID | miR-6791-5p | ||
miRNA Sequence |
CCCCUGGGGCUGGGCAGGCGGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon135 |
miR-6799 directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6799 | miRNA Mature ID | miR-6799-5p | ||
miRNA Sequence |
GGGGAGGUGUGCAGGGCUGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon136 |
miR-6807 directly targets SLC1A5 | [ 21 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6807 | miRNA Mature ID | miR-6807-5p | ||
miRNA Sequence |
GUGAGCCAGUGGAAUGGAGAGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon137 |
miR-6811 directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6811 | miRNA Mature ID | miR-6811-3p | ||
miRNA Sequence |
AGCCUGUGCUUGUCCCUGCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon138 |
miR-6814 directly targets SLC1A5 | [ 19 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6814 | miRNA Mature ID | miR-6814-5p | ||
miRNA Sequence |
UCCCAAGGGUGAGAUGCUGCCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon139 |
miR-6821 directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6821 | miRNA Mature ID | miR-6821-3p | ||
miRNA Sequence |
UGACCUCUCCGCUCCGCACAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon140 |
miR-6821 directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6821 | miRNA Mature ID | miR-6821-5p | ||
miRNA Sequence |
GUGCGUGGUGGCUCGAGGCGGGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon141 |
miR-6839 directly targets SLC1A5 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6839 | miRNA Mature ID | miR-6839-3p | ||
miRNA Sequence |
UUGGGUUUUCUCUUCAAUCCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon142 |
miR-6847 directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6847 | miRNA Mature ID | miR-6847-3p | ||
miRNA Sequence |
GGCUCAUGUGUCUGUCCUCUUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon143 |
miR-6849 directly targets SLC1A5 | [ 21 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6849 | miRNA Mature ID | miR-6849-3p | ||
miRNA Sequence |
ACCAGCCUGUGUCCACCUCCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon144 |
miR-6852 directly targets SLC1A5 | [ 23 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6852 | miRNA Mature ID | miR-6852-3p | ||
miRNA Sequence |
UGUCCUCUGUUCCUCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon145 |
miR-6856 directly targets SLC1A5 | [ 16 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6856 | miRNA Mature ID | miR-6856-3p | ||
miRNA Sequence |
UACAGCCCUGUGAUCUUUCCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon146 |
miR-6883 directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6883 | miRNA Mature ID | miR-6883-5p | ||
miRNA Sequence |
AGGGAGGGUGUGGUAUGGAUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon147 |
miR-6890 directly targets SLC1A5 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6890 | miRNA Mature ID | miR-6890-3p | ||
miRNA Sequence |
CCACUGCCUAUGCCCCACAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon148 |
miR-7106 directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-7106 | miRNA Mature ID | miR-7106-5p | ||
miRNA Sequence |
UGGGAGGAGGGGAUCUUGGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon149 |
miR-7107 directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-7107 | miRNA Mature ID | miR-7107-5p | ||
miRNA Sequence |
UCGGCCUGGGGAGGAGGAAGGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon150 |
miR-7151 directly targets SLC1A5 | [ 19 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-7151 | miRNA Mature ID | miR-7151-3p | ||
miRNA Sequence |
CUACAGGCUGGAAUGGGCUCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon151 |
miR-744 directly targets SLC1A5 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-744 | miRNA Mature ID | miR-744-3p | ||
miRNA Sequence |
CUGUUGCCACUAACCUCAACCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon152 |
miR-764 directly targets SLC1A5 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-764 | miRNA Mature ID | miR-764 | ||
miRNA Sequence |
GCAGGUGCUCACUUGUCCUCCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon153 |
miR-7977 directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-7977 | miRNA Mature ID | miR-7977 | ||
miRNA Sequence |
UUCCCAGCCAACGCACCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon154 |
miR-8052 directly targets SLC1A5 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-8052 | miRNA Mature ID | miR-8052 | ||
miRNA Sequence |
CGGGACUGUAGAGGGCAUGAGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Left ventricular cardiac tissues of human | ||||
Epigenetic Phenomenon155 |
miR-8057 directly targets SLC1A5 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-8057 | miRNA Mature ID | miR-8057 | ||
miRNA Sequence |
GUGGCUCUGUAGUAAGAUGGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon156 |
miR-8064 directly targets SLC1A5 | [ 24 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-8064 | miRNA Mature ID | miR-8064 | ||
miRNA Sequence |
AGCACACUGAGCGAGCGGAC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon157 |
miR-8485 directly targets SLC1A5 | [ 24 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-8485 | miRNA Mature ID | miR-8485 | ||
miRNA Sequence |
CACACACACACACACACGUAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon158 |
miR-887 directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-887 | miRNA Mature ID | miR-887-5p | ||
miRNA Sequence |
CUUGGGAGCCCUGUUAGACUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon159 |
miR-891a directly targets SLC1A5 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-891a | miRNA Mature ID | miR-891a-3p | ||
miRNA Sequence |
AGUGGCACAUGUUUGUUGUGAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon160 |
miR-93 directly targets SLC1A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-93 | miRNA Mature ID | miR-93-5p | ||
miRNA Sequence |
CAAAGUGCUGUUCGUGCAGGUAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.