Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0129 Transporter Info
Gene Name SLC1A1
Transporter Name Excitatory amino acid transporter 3
Gene ID
6505
UniProt ID
P43005
Epigenetic Regulations of This DT (EGR)

Methylation

  Colon cancer

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC1A1 in colon adenocarcinoma [ 1 ]

Location

 5'UTR (cg18703983)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.19E+00 Statistic Test p-value:1.55E-03; Z-score:-2.76E+00

Methylation in Case

 5.83E-01 (Median) Methylation in Control 6.93E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC1A1 in colon adenocarcinoma [ 1 ]

Location

 TSS1500 (cg25493658)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.08E+00 Statistic Test p-value:4.53E-03; Z-score:-1.89E+00

Methylation in Case

 6.98E-01 (Median) Methylation in Control 7.52E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC1A1 in colon adenocarcinoma [ 1 ]

Location

 Body (cg15531450)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.21E+00 Statistic Test p-value:1.01E-05; Z-score:-3.37E+00

Methylation in Case

 4.66E-01 (Median) Methylation in Control 5.64E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC1A1 in colon adenocarcinoma [ 1 ]

Location

 Body (cg10420578)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.12E+00 Statistic Test p-value:1.18E-05; Z-score:-3.92E+00

Methylation in Case

 7.89E-01 (Median) Methylation in Control 8.83E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC1A1 in colon adenocarcinoma [ 1 ]

Location

 Body (cg06046344)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.04E+00 Statistic Test p-value:1.12E-03; Z-score:-1.67E+00

Methylation in Case

 8.15E-01 (Median) Methylation in Control 8.48E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC1A1 in colon adenocarcinoma [ 1 ]

Location

 3'UTR (cg06535968)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.18E+00 Statistic Test p-value:4.48E-05; Z-score:-2.84E+00

Methylation in Case

 6.56E-01 (Median) Methylation in Control 7.76E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Prostate cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC1A1 in prostate cancer [ 2 ]

Location

 5'UTR (cg18047353)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.57E+00 Statistic Test p-value:1.47E-02; Z-score:-2.91E+00

Methylation in Case

 1.62E-01 (Median) Methylation in Control 2.55E-01 (Median)

Studied Phenotype

 Prostate cancer[ ICD-11:2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC1A1 in prostate cancer [ 2 ]

Location

 Body (cg16726201)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:2.97E+00 Statistic Test p-value:3.89E-04; Z-score:7.66E+00

Methylation in Case

 6.74E-01 (Median) Methylation in Control 2.27E-01 (Median)

Studied Phenotype

 Prostate cancer[ ICD-11:2C82]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC1A1 in hepatocellular carcinoma [ 3 ]

Location

 TSS1500 (cg14452299)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.46E+00 Statistic Test p-value:8.93E-16; Z-score:-7.10E+00

Methylation in Case

 4.93E-01 (Median) Methylation in Control 7.18E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC1A1 in hepatocellular carcinoma [ 3 ]

Location

 TSS200 (cg24611631)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.08E+00 Statistic Test p-value:2.51E-02; Z-score:-3.09E-01

Methylation in Case

 6.31E-02 (Median) Methylation in Control 6.82E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC1A1 in hepatocellular carcinoma [ 3 ]

Location

 1stExon (cg13555101)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.11E+00 Statistic Test p-value:9.36E-07; Z-score:-7.68E-01

Methylation in Case

 7.49E-02 (Median) Methylation in Control 8.33E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC1A1 in hepatocellular carcinoma [ 3 ]

Location

 1stExon (cg04711050)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.09E+00 Statistic Test p-value:6.27E-03; Z-score:-5.55E-01

Methylation in Case

 6.54E-02 (Median) Methylation in Control 7.10E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC1A1 in hepatocellular carcinoma [ 3 ]

Location

 Body (cg13802605)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.02E+00 Statistic Test p-value:7.64E-04; Z-score:-2.92E-01

Methylation in Case

 7.78E-01 (Median) Methylation in Control 7.90E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC1A1 in hepatocellular carcinoma [ 3 ]

Location

 Body (cg21156276)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.13E+00 Statistic Test p-value:8.80E-04; Z-score:1.16E+00

Methylation in Case

 6.03E-01 (Median) Methylation in Control 5.33E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC1A1 in pancretic ductal adenocarcinoma [ 4 ]

Location

 TSS1500 (cg00315391)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.09E+00 Statistic Test p-value:4.47E-07; Z-score:3.82E-01

Methylation in Case

 9.48E-02 (Median) Methylation in Control 8.68E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC1A1 in pancretic ductal adenocarcinoma [ 4 ]

Location

 TSS1500 (cg17415721)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.12E+00 Statistic Test p-value:2.77E-04; Z-score:-6.32E-01

Methylation in Case

 7.27E-02 (Median) Methylation in Control 8.14E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC1A1 in pancretic ductal adenocarcinoma [ 4 ]

Location

 Body (cg16854533)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.55E+00 Statistic Test p-value:5.97E-36; Z-score:-5.73E+00

Methylation in Case

 5.18E-01 (Median) Methylation in Control 8.01E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC1A1 in pancretic ductal adenocarcinoma [ 4 ]

Location

 Body (cg13406085)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.06E+00 Statistic Test p-value:3.45E-05; Z-score:-6.37E-01

Methylation in Case

 6.92E-01 (Median) Methylation in Control 7.34E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC1A1 in pancretic ductal adenocarcinoma [ 4 ]

Location

 Body (cg00767977)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.04E+00 Statistic Test p-value:2.22E-02; Z-score:9.29E-01

Methylation in Case

 7.74E-01 (Median) Methylation in Control 7.47E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Bladder cancer

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC1A1 in bladder cancer [ 5 ]

Location

 TSS200 (cg24611631)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.17E+00 Statistic Test p-value:7.03E-04; Z-score:-2.19E+00

Methylation in Case

 6.23E-02 (Median) Methylation in Control 7.30E-02 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC1A1 in bladder cancer [ 5 ]

Location

 1stExon (cg04711050)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.13E+00 Statistic Test p-value:7.59E-03; Z-score:-1.34E+00

Methylation in Case

 6.65E-02 (Median) Methylation in Control 7.53E-02 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC1A1 in bladder cancer [ 5 ]

Location

 1stExon (cg13555101)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.12E+00 Statistic Test p-value:3.70E-02; Z-score:-1.54E+00

Methylation in Case

 8.11E-02 (Median) Methylation in Control 9.08E-02 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC1A1 in bladder cancer [ 5 ]

Location

 Body (cg13599596)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.22E+00 Statistic Test p-value:5.21E-07; Z-score:-9.95E+00

Methylation in Case

 7.26E-01 (Median) Methylation in Control 8.85E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC1A1 in bladder cancer [ 5 ]

Location

 Body (cg21156276)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.37E+00 Statistic Test p-value:1.77E-06; Z-score:-4.46E+00

Methylation in Case

 4.29E-01 (Median) Methylation in Control 5.88E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC1A1 in bladder cancer [ 5 ]

Location

 Body (cg13802605)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.10E+00 Statistic Test p-value:2.03E-05; Z-score:-4.50E+00

Methylation in Case

 7.39E-01 (Median) Methylation in Control 8.14E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon7

 Methylation of SLC1A1 in bladder cancer [ 5 ]

Location

 Body (cg14276488)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.29E+00 Statistic Test p-value:1.20E-03; Z-score:-3.90E+00

Methylation in Case

 3.54E-02 (Median) Methylation in Control 4.56E-02 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC1A1 in clear cell renal cell carcinoma [ 6 ]

Location

 TSS200 (cg24611631)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.32E+00 Statistic Test p-value:1.58E-05; Z-score:1.05E+00

Methylation in Case

 3.15E-02 (Median) Methylation in Control 2.39E-02 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC1A1 in clear cell renal cell carcinoma [ 6 ]

Location

 TSS200 (cg14583606)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.05E+00 Statistic Test p-value:1.90E-05; Z-score:5.57E-01

Methylation in Case

 1.53E-02 (Median) Methylation in Control 1.46E-02 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC1A1 in clear cell renal cell carcinoma [ 6 ]

Location

 1stExon (cg04711050)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.24E+00 Statistic Test p-value:3.14E-02; Z-score:7.58E-01

Methylation in Case

 3.06E-02 (Median) Methylation in Control 2.48E-02 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC1A1 in clear cell renal cell carcinoma [ 6 ]

Location

 1stExon (cg13555101)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.13E+00 Statistic Test p-value:3.95E-02; Z-score:5.07E-01

Methylation in Case

 4.31E-02 (Median) Methylation in Control 3.82E-02 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC1A1 in clear cell renal cell carcinoma [ 6 ]

Location

 Body (cg14276488)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.13E+00 Statistic Test p-value:1.58E-04; Z-score:6.29E-01

Methylation in Case

 2.58E-02 (Median) Methylation in Control 2.28E-02 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC1A1 in clear cell renal cell carcinoma [ 6 ]

Location

 Body (cg21156276)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.11E+00 Statistic Test p-value:7.23E-03; Z-score:-1.30E+00

Methylation in Case

 5.72E-01 (Median) Methylation in Control 6.36E-01 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon7

 Methylation of SLC1A1 in clear cell renal cell carcinoma [ 6 ]

Location

 Body (cg07196069)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.21E+00 Statistic Test p-value:9.99E-03; Z-score:6.39E-01

Methylation in Case

 8.73E-02 (Median) Methylation in Control 7.22E-02 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC1A1 in colorectal cancer [ 7 ]

Location

 TSS200 (cg24611631)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.19E+00 Statistic Test p-value:1.37E-02; Z-score:9.33E-01

Methylation in Case

 1.01E-01 (Median) Methylation in Control 8.45E-02 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC1A1 in colorectal cancer [ 7 ]

Location

 1stExon (cg04711050)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.10E+00 Statistic Test p-value:4.35E-02; Z-score:8.31E-01

Methylation in Case

 9.58E-02 (Median) Methylation in Control 8.70E-02 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC1A1 in colorectal cancer [ 7 ]

Location

 Body (cg13802605)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.05E+00 Statistic Test p-value:8.58E-08; Z-score:-1.93E+00

Methylation in Case

 8.66E-01 (Median) Methylation in Control 9.13E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC1A1 in colorectal cancer [ 7 ]

Location

 Body (cg13599596)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.15E+00 Statistic Test p-value:7.37E-05; Z-score:1.44E+00

Methylation in Case

 8.98E-01 (Median) Methylation in Control 7.79E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  HIV infection

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC1A1 in HIV infection [ 8 ]

Location

 TSS200 (cg24611631)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.14E+00 Statistic Test p-value:1.67E-02; Z-score:6.96E-01

Methylation in Case

 8.52E-02 (Median) Methylation in Control 7.49E-02 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC1A1 in HIV infection [ 8 ]

Location

 TSS200 (cg14583606)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.37E+00 Statistic Test p-value:2.75E-02; Z-score:7.36E-01

Methylation in Case

 1.38E-02 (Median) Methylation in Control 1.01E-02 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC1A1 in HIV infection [ 8 ]

Location

 1stExon (cg13555101)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.20E+00 Statistic Test p-value:4.24E-03; Z-score:8.89E-01

Methylation in Case

 9.67E-02 (Median) Methylation in Control 8.04E-02 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC1A1 in HIV infection [ 8 ]

Location

 1stExon (cg04711050)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.16E+00 Statistic Test p-value:1.02E-02; Z-score:5.23E-01

Methylation in Case

 7.85E-02 (Median) Methylation in Control 6.78E-02 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC1A1 in HIV infection [ 8 ]

Location

 Body (cg14276488)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.30E+00 Statistic Test p-value:1.06E-03; Z-score:7.33E-01

Methylation in Case

 4.85E-02 (Median) Methylation in Control 3.73E-02 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC1A1 in HIV infection [ 8 ]

Location

 Body (cg07196069)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.10E+00 Statistic Test p-value:5.79E-03; Z-score:6.73E-01

Methylation in Case

 1.70E-01 (Median) Methylation in Control 1.55E-01 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon7

 Methylation of SLC1A1 in HIV infection [ 8 ]

Location

 Body (cg13802605)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.02E+00 Statistic Test p-value:3.61E-02; Z-score:-6.06E-01

Methylation in Case

 8.28E-01 (Median) Methylation in Control 8.43E-01 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC1A1 in systemic lupus erythematosus [ 9 ]

Location

 TSS200 (cg24611631)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.00E+00 Statistic Test p-value:3.38E-02; Z-score:2.34E-02

Methylation in Case

 1.02E-01 (Median) Methylation in Control 1.01E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

 Patient tissue samples

  Atypical teratoid rhabdoid tumor

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC1A1 in atypical teratoid rhabdoid tumor [ 10 ]

Location

 1stExon (cg04711050)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.70E+00 Statistic Test p-value:3.10E-24; Z-score:-3.72E+00

Methylation in Case

 4.53E-01 (Median) Methylation in Control 7.69E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC1A1 in atypical teratoid rhabdoid tumor [ 10 ]

Location

 1stExon (cg13555101)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-2.38E+00 Statistic Test p-value:2.36E-19; Z-score:-2.92E+00

Methylation in Case

 2.71E-01 (Median) Methylation in Control 6.46E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC1A1 in atypical teratoid rhabdoid tumor [ 10 ]

Location

 Body (cg07196069)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.17E+00 Statistic Test p-value:3.51E-03; Z-score:-6.29E-01

Methylation in Case

 3.93E-01 (Median) Methylation in Control 4.60E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC1A1 in atypical teratoid rhabdoid tumor [ 10 ]

Location

 Body (cg13599596)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.08E+00 Statistic Test p-value:3.74E-02; Z-score:-5.51E-01

Methylation in Case

 8.22E-01 (Median) Methylation in Control 8.89E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC1A1 in atypical teratoid rhabdoid tumor [ 10 ]

Location

 Body (cg13802605)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.02E+00 Statistic Test p-value:3.90E-02; Z-score:2.04E-01

Methylation in Case

 8.80E-01 (Median) Methylation in Control 8.62E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC1A1 in atypical teratoid rhabdoid tumor [ 10 ]

Location

 Body (cg14276488)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.07E+00 Statistic Test p-value:4.40E-02; Z-score:-6.53E-01

Methylation in Case

 7.76E-01 (Median) Methylation in Control 8.34E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  Breast cancer

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC1A1 in breast cancer [ 11 ]

Location

 1stExon (cg04711050)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.11E+00 Statistic Test p-value:4.57E-02; Z-score:3.96E-01

Methylation in Case

 6.93E-02 (Median) Methylation in Control 6.23E-02 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC1A1 in breast cancer [ 11 ]

Location

 Body (cg13802605)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.10E+00 Statistic Test p-value:1.84E-12; Z-score:-2.34E+00

Methylation in Case

 7.53E-01 (Median) Methylation in Control 8.25E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC1A1 in breast cancer [ 11 ]

Location

 Body (cg21156276)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.19E+00 Statistic Test p-value:6.91E-08; Z-score:-1.70E+00

Methylation in Case

 5.78E-01 (Median) Methylation in Control 6.86E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC1A1 in breast cancer [ 11 ]

Location

 Body (cg13599596)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.05E+00 Statistic Test p-value:7.98E-05; Z-score:-8.35E-01

Methylation in Case

 8.51E-01 (Median) Methylation in Control 8.95E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC1A1 in breast cancer [ 11 ]

Location

 Body (cg07196069)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.16E+00 Statistic Test p-value:7.11E-04; Z-score:6.62E-01

Methylation in Case

 1.38E-01 (Median) Methylation in Control 1.18E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC1A1 in breast cancer [ 11 ]

Location

 Body (cg14276488)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.12E+00 Statistic Test p-value:2.45E-03; Z-score:3.04E-01

Methylation in Case

 4.25E-02 (Median) Methylation in Control 3.81E-02 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC1A1 in lung adenocarcinoma [ 12 ]

Location

 Body (cg13802605)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.06E+00 Statistic Test p-value:8.47E-03; Z-score:-3.29E+00

Methylation in Case

 8.03E-01 (Median) Methylation in Control 8.52E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

 Patient tissue samples

  Panic disorder

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC1A1 in panic disorder [ 13 ]

Location

 Body (cg13802605)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.06E+00 Statistic Test p-value:3.38E-02; Z-score:3.03E-01

Methylation in Case

 2.71E+00 (Median) Methylation in Control 2.56E+00 (Median)

Studied Phenotype

 Panic disorder[ ICD-11:6B01]

Experimental Material

 Patient tissue samples

microRNA

  Multiple system atrophy

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Higher expression of miR-124 in multiple system atrophy [ 14 ]

Epigenetic Type

 microRNA Experiment Method Luciferase reporter assay

Related Molecular Changes

 Down regulation ofSLC1A1 Experiment Method Immunohistochemical staining

miRNA Stemloop ID

 miR-96 miRNA Mature ID Unclear

miRNA Target Type

 Direct

Studied Phenotype

 Multiple system atrophy[ ICD-11:8D87.0]

Experimental Material

 Patient tissue samples

Additional Notes

 miR-96 downregulates SLC1A1 in multiple system atrophy, and its dysregulation may play a role in MSA.

  Unclear Phenotype

          33 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 miR-1237 directly targets SLC1A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1237 miRNA Mature ID miR-1237-3p

miRNA Sequence

 UCCUUCUGCUCCGUCCCCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon2

 miR-1248 directly targets SLC1A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1248 miRNA Mature ID miR-1248

miRNA Sequence

 ACCUUCUUGUAUAAGCACUGUGCUAAA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon3

 miR-1255a directly targets SLC1A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1255a miRNA Mature ID miR-1255a

miRNA Sequence

 AGGAUGAGCAAAGAAAGUAGAUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon4

 miR-1255b directly targets SLC1A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1255b miRNA Mature ID miR-1255b-5p

miRNA Sequence

 CGGAUGAGCAAAGAAAGUGGUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon5

 miR-186 directly targets SLC1A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-186 miRNA Mature ID miR-186-5p

miRNA Sequence

 CAAAGAAUUCUCCUUUUGGGCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon6

 miR-204 directly targets SLC1A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-204 miRNA Mature ID miR-204-5p

miRNA Sequence

 UUCCCUUUGUCAUCCUAUGCCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon7

 miR-211 directly targets SLC1A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-211 miRNA Mature ID miR-211-5p

miRNA Sequence

 UUCCCUUUGUCAUCCUUCGCCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon8

 miR-2113 directly targets SLC1A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-2113 miRNA Mature ID miR-2113

miRNA Sequence

 AUUUGUGCUUGGCUCUGUCAC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon9

 miR-335 directly targets SLC1A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-335 miRNA Mature ID miR-335-5p

miRNA Sequence

 UCAAGAGCAAUAACGAAAAAUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon10

 miR-4287 directly targets SLC1A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4287 miRNA Mature ID miR-4287

miRNA Sequence

 UCUCCCUUGAGGGCACUUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon11

 miR-4469 directly targets SLC1A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4469 miRNA Mature ID miR-4469

miRNA Sequence

 GCUCCCUCUAGGGUCGCUCGGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon12

 miR-4641 directly targets SLC1A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4641 miRNA Mature ID miR-4641

miRNA Sequence

 UGCCCAUGCCAUACUUUUGCCUCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon13

 miR-4659a directly targets SLC1A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4659a miRNA Mature ID miR-4659a-3p

miRNA Sequence

 UUUCUUCUUAGACAUGGCAACG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon14

 miR-4659b directly targets SLC1A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4659b miRNA Mature ID miR-4659b-3p

miRNA Sequence

 UUUCUUCUUAGACAUGGCAGCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon15

 miR-4685 directly targets SLC1A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4685 miRNA Mature ID miR-4685-3p

miRNA Sequence

 UCUCCCUUCCUGCCCUGGCUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon16

 miR-4713 directly targets SLC1A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4713 miRNA Mature ID miR-4713-5p

miRNA Sequence

 UUCUCCCACUACCAGGCUCCCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon17

 miR-500a directly targets SLC1A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-500a miRNA Mature ID miR-500a-5p

miRNA Sequence

 UAAUCCUUGCUACCUGGGUGAGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon18

 miR-5010 directly targets SLC1A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-5010 miRNA Mature ID miR-5010-3p

miRNA Sequence

 UUUUGUGUCUCCCAUUCCCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon19

 miR-5586 directly targets SLC1A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-5586 miRNA Mature ID miR-5586-5p

miRNA Sequence

 UAUCCAGCUUGUUACUAUAUGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon20

 miR-629 directly targets SLC1A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-629 miRNA Mature ID miR-629-3p

miRNA Sequence

 GUUCUCCCAACGUAAGCCCAGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon21

 miR-6512 directly targets SLC1A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6512 miRNA Mature ID miR-6512-3p

miRNA Sequence

 UUCCAGCCCUUCUAAUGGUAGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon22

 miR-652 directly targets SLC1A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-652 miRNA Mature ID miR-652-5p

miRNA Sequence

 CAACCCUAGGAGAGGGUGCCAUUCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon23

 miR-6720 directly targets SLC1A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6720 miRNA Mature ID miR-6720-5p

miRNA Sequence

 UUCCAGCCCUGGUAGGCGCCGCG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon24

 miR-6744 directly targets SLC1A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6744 miRNA Mature ID miR-6744-5p

miRNA Sequence

 UGGAUGACAGUGGAGGCCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon25

 miR-6832 directly targets SLC1A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6832 miRNA Mature ID miR-6832-3p

miRNA Sequence

 ACCCUUUUUCUCUUUCCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon26

 miR-6835 directly targets SLC1A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6835 miRNA Mature ID miR-6835-3p

miRNA Sequence

 AAAAGCACUUUUCUGUCUCCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon27

 miR-6849 directly targets SLC1A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6849 miRNA Mature ID miR-6849-3p

miRNA Sequence

 ACCAGCCUGUGUCCACCUCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon28

 miR-6867 directly targets SLC1A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6867 miRNA Mature ID miR-6867-3p

miRNA Sequence

 CUCUCCCUCUUUACCCACUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon29

 miR-6868 directly targets SLC1A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6868 miRNA Mature ID miR-6868-3p

miRNA Sequence

 UUCCUUCUGUUGUCUGUGCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon30

 miR-6875 directly targets SLC1A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6875 miRNA Mature ID miR-6875-3p

miRNA Sequence

 AUUCUUCCUGCCCUGGCUCCAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon31

 miR-7113 directly targets SLC1A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-7113 miRNA Mature ID miR-7113-3p

miRNA Sequence

 CCUCCCUGCCCGCCUCUCUGCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon32

 miR-758 directly targets SLC1A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-758 miRNA Mature ID miR-758-3p

miRNA Sequence

 UUUGUGACCUGGUCCACUAACC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon33

 miR-96 directly targets SLC1A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method Immunohistochemistry//Luciferase reporter assay//qRT-PCR

miRNA Stemloop ID

 miR-96 miRNA Mature ID miR-96-5p

miRNA Sequence

 UUUGGCACUAGCACAUUUUUGCU

miRNA Target Type

 Direct

Experimental Material

 Patient tissue samples
References
1 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
2 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
3 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
4 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
5 DNA Methylation Dynamics in Urological Tumors.
6 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
7 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
8 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
9 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
10 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
11 Genome-wide Scan for Methylation Profiles in Breast Cancer
12 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
13 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
14 Widespread microRNA dysregulation in multiple system atrophy - disease-related alteration in miR-96. Eur J Neurosci. 2014 Mar;39(6):1026-41.
15 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
16 Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.