Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0128 Transporter Info
Gene Name	SLC19A3
Transporter Name	Thiamine transporter 2
Gene ID	80704
UniProt ID	Q9BZV2

Epigenetic Regulations of This DT (EGR)
Methylation
Gastric cancer	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Hypermethylation of SLC19A3 in gastric cancer			[ 1 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	Bisulfite sequencing
Related Molecular Changes	Down regulation ofSLC19A3	Experiment Method	RT-qPCR
Studied Phenotype	Gastric cancer[ ICD-11:2B72]
Frequency	52 (51%) out of the 101 studied tumor samples
Experimental Material	Multiple cell lines of human
Additional Notes	Hypermethylation within the SLC19A3 promoter is responsible for the down-regulation of SLC19A3 in gastric cancer.
Breast cancer	13 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Hypermethylation of SLC19A3 in breast cancer			[ 2 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	Methylation-specific PCR
Related Molecular Changes	Down regulation ofSLC19A3	Experiment Method	RT-qPCR
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Additional Notes	SLC19A3 promoter Hypermethylation in plasma may be a novel biomarker for breast and gastric cancer diagnosis.
Epigenetic Phenomenon2	Methylation of SLC19A3 in breast cancer			[ 5 ]
Location	5'UTR (cg07417745)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.83E+00	Statistic Test	p-value:1.41E-17; Z-score:3.38E+00
Methylation in Case	3.65E-01 (Median)	Methylation in Control	1.99E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC19A3 in breast cancer			[ 5 ]
Location	5'UTR (cg25713185)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.31E+00	Statistic Test	p-value:3.06E-13; Z-score:3.12E+00
Methylation in Case	2.24E-01 (Median)	Methylation in Control	9.70E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC19A3 in breast cancer			[ 5 ]
Location	TSS200 (cg19850080)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.52E+00	Statistic Test	p-value:1.33E-07; Z-score:1.91E+00
Methylation in Case	9.47E-02 (Median)	Methylation in Control	6.21E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC19A3 in breast cancer			[ 5 ]
Location	TSS200 (cg01142776)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.45E+00	Statistic Test	p-value:1.57E-07; Z-score:1.69E+00
Methylation in Case	1.23E-01 (Median)	Methylation in Control	8.46E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC19A3 in breast cancer			[ 5 ]
Location	TSS200 (cg02562740)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.51E+00	Statistic Test	p-value:6.64E-04; Z-score:9.88E-01
Methylation in Case	2.37E-02 (Median)	Methylation in Control	1.57E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC19A3 in breast cancer			[ 5 ]
Location	TSS200 (cg20440901)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.86E+00	Statistic Test	p-value:4.18E-03; Z-score:7.50E-01
Methylation in Case	2.96E-02 (Median)	Methylation in Control	1.59E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC19A3 in breast cancer			[ 5 ]
Location	TSS200 (cg05844583)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.21E+00	Statistic Test	p-value:2.89E-02; Z-score:1.21E-01
Methylation in Case	6.61E-03 (Median)	Methylation in Control	5.45E-03 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC19A3 in breast cancer			[ 5 ]
Location	Body (cg11543686)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:8.55E-07; Z-score:-9.97E-01
Methylation in Case	8.47E-01 (Median)	Methylation in Control	8.77E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC19A3 in breast cancer			[ 5 ]
Location	Body (cg19863633)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:7.72E-06; Z-score:-1.27E+00
Methylation in Case	8.59E-01 (Median)	Methylation in Control	8.91E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC19A3 in breast cancer			[ 5 ]
Location	Body (cg04529897)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:2.95E-05; Z-score:-1.14E+00
Methylation in Case	8.50E-01 (Median)	Methylation in Control	8.90E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of SLC19A3 in breast cancer			[ 5 ]
Location	Body (cg21194765)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:1.09E-02; Z-score:-6.86E-01
Methylation in Case	8.27E-01 (Median)	Methylation in Control	8.60E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon13	Methylation of SLC19A3 in breast cancer			[ 5 ]
Location	3'UTR (cg04091914)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.11E+00	Statistic Test	p-value:3.81E-05; Z-score:-1.11E+00
Methylation in Case	7.22E-01 (Median)	Methylation in Control	8.02E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Atypical teratoid rhabdoid tumor	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC19A3 in atypical teratoid rhabdoid tumor			[ 3 ]
Location	5'UTR (cg03894284)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.44E+00	Statistic Test	p-value:2.15E-08; Z-score:-1.18E+00
Methylation in Case	3.75E-01 (Median)	Methylation in Control	5.40E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC19A3 in atypical teratoid rhabdoid tumor			[ 3 ]
Location	5'UTR (cg07417745)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.09E+00	Statistic Test	p-value:1.16E-07; Z-score:-1.32E+00
Methylation in Case	8.28E-01 (Median)	Methylation in Control	9.06E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC19A3 in atypical teratoid rhabdoid tumor			[ 3 ]
Location	5'UTR (cg13774987)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.16E+00	Statistic Test	p-value:6.50E-07; Z-score:9.90E-01
Methylation in Case	8.20E-01 (Median)	Methylation in Control	7.10E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC19A3 in atypical teratoid rhabdoid tumor			[ 3 ]
Location	5'UTR (cg25713185)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:1.07E-05; Z-score:-1.22E+00
Methylation in Case	8.59E-01 (Median)	Methylation in Control	8.96E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC19A3 in atypical teratoid rhabdoid tumor			[ 3 ]
Location	Body (cg04529897)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-2.07E+00	Statistic Test	p-value:8.56E-04; Z-score:-1.27E+00
Methylation in Case	2.37E-01 (Median)	Methylation in Control	4.90E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC19A3 in atypical teratoid rhabdoid tumor			[ 3 ]
Location	Body (cg11543686)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.08E+00	Statistic Test	p-value:2.29E-02; Z-score:4.44E-01
Methylation in Case	9.08E-01 (Median)	Methylation in Control	8.38E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC19A3 in atypical teratoid rhabdoid tumor			[ 3 ]
Location	3'UTR (cg04091914)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.06E+00	Statistic Test	p-value:2.40E-14; Z-score:2.26E+00
Methylation in Case	6.06E-01 (Median)	Methylation in Control	2.94E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Bladder cancer	15 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC19A3 in bladder cancer			[ 4 ]
Location	5'UTR (cg03894284)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.22E+00	Statistic Test	p-value:1.79E-04; Z-score:-2.74E+00
Methylation in Case	5.99E-01 (Median)	Methylation in Control	7.30E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC19A3 in bladder cancer			[ 4 ]
Location	5'UTR (cg25713185)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.94E+00	Statistic Test	p-value:3.30E-04; Z-score:1.61E+01
Methylation in Case	3.22E-01 (Median)	Methylation in Control	1.10E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC19A3 in bladder cancer			[ 4 ]
Location	5'UTR (cg07417745)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.10E+00	Statistic Test	p-value:6.97E-04; Z-score:1.64E+01
Methylation in Case	4.59E-01 (Median)	Methylation in Control	2.19E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC19A3 in bladder cancer			[ 4 ]
Location	5'UTR (cg13774987)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.15E+00	Statistic Test	p-value:2.77E-02; Z-score:2.71E+00
Methylation in Case	7.82E-01 (Median)	Methylation in Control	6.82E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC19A3 in bladder cancer			[ 4 ]
Location	TSS1500 (cg09726804)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:4.10E-02; Z-score:-1.25E+00
Methylation in Case	7.69E-01 (Median)	Methylation in Control	7.97E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC19A3 in bladder cancer			[ 4 ]
Location	TSS200 (cg19850080)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.76E+00	Statistic Test	p-value:4.35E-03; Z-score:7.61E+00
Methylation in Case	9.53E-02 (Median)	Methylation in Control	5.41E-02 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC19A3 in bladder cancer			[ 4 ]
Location	TSS200 (cg01142776)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.26E+00	Statistic Test	p-value:1.03E-02; Z-score:3.00E+00
Methylation in Case	1.03E-01 (Median)	Methylation in Control	8.22E-02 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC19A3 in bladder cancer			[ 4 ]
Location	TSS200 (cg20440901)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.85E+00	Statistic Test	p-value:1.11E-02; Z-score:1.32E+00
Methylation in Case	2.38E-02 (Median)	Methylation in Control	1.29E-02 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC19A3 in bladder cancer			[ 4 ]
Location	TSS200 (cg02562740)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.50E+00	Statistic Test	p-value:2.10E-02; Z-score:1.90E+00
Methylation in Case	2.35E-02 (Median)	Methylation in Control	1.57E-02 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC19A3 in bladder cancer			[ 4 ]
Location	TSS200 (cg05844583)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.59E+00	Statistic Test	p-value:4.53E-02; Z-score:1.68E+00
Methylation in Case	6.15E-03 (Median)	Methylation in Control	2.37E-03 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC19A3 in bladder cancer			[ 4 ]
Location	Body (cg11543686)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.10E+00	Statistic Test	p-value:1.19E-04; Z-score:-9.66E+00
Methylation in Case	8.08E-01 (Median)	Methylation in Control	8.92E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of SLC19A3 in bladder cancer			[ 4 ]
Location	Body (cg21194765)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:2.86E-03; Z-score:-4.95E+00
Methylation in Case	8.65E-01 (Median)	Methylation in Control	9.08E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon13	Methylation of SLC19A3 in bladder cancer			[ 4 ]
Location	Body (cg19863633)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:3.80E-03; Z-score:-2.47E+00
Methylation in Case	8.80E-01 (Median)	Methylation in Control	8.99E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon14	Methylation of SLC19A3 in bladder cancer			[ 4 ]
Location	Body (cg04529897)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:4.35E-03; Z-score:-1.19E+00
Methylation in Case	8.88E-01 (Median)	Methylation in Control	9.00E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon15	Methylation of SLC19A3 in bladder cancer			[ 4 ]
Location	3'UTR (cg04091914)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.20E+00	Statistic Test	p-value:1.42E-04; Z-score:-6.85E+00
Methylation in Case	6.79E-01 (Median)	Methylation in Control	8.14E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Renal cell carcinoma	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC19A3 in clear cell renal cell carcinoma			[ 6 ]
Location	5'UTR (cg07417745)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.65E+00	Statistic Test	p-value:1.16E-04; Z-score:1.22E+00
Methylation in Case	2.03E-01 (Median)	Methylation in Control	1.23E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC19A3 in clear cell renal cell carcinoma			[ 6 ]
Location	5'UTR (cg25713185)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.08E+00	Statistic Test	p-value:3.47E-04; Z-score:1.19E+00
Methylation in Case	7.53E-02 (Median)	Methylation in Control	3.62E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC19A3 in clear cell renal cell carcinoma			[ 6 ]
Location	TSS200 (cg02562740)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.17E+00	Statistic Test	p-value:2.16E-07; Z-score:1.51E+00
Methylation in Case	2.38E-02 (Median)	Methylation in Control	2.02E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC19A3 in clear cell renal cell carcinoma			[ 6 ]
Location	TSS200 (cg20440901)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.12E+00	Statistic Test	p-value:5.92E-06; Z-score:1.08E+00
Methylation in Case	2.89E-02 (Median)	Methylation in Control	2.57E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC19A3 in clear cell renal cell carcinoma			[ 6 ]
Location	TSS200 (cg05844583)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.14E+00	Statistic Test	p-value:1.23E-05; Z-score:1.21E+00
Methylation in Case	2.53E-02 (Median)	Methylation in Control	2.23E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC19A3 in clear cell renal cell carcinoma			[ 6 ]
Location	TSS200 (cg01142776)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.35E+00	Statistic Test	p-value:1.15E-03; Z-score:8.58E-01
Methylation in Case	4.99E-02 (Median)	Methylation in Control	3.70E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC19A3 in clear cell renal cell carcinoma			[ 6 ]
Location	TSS200 (cg19850080)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.18E+00	Statistic Test	p-value:1.73E-03; Z-score:3.37E-01
Methylation in Case	2.51E-02 (Median)	Methylation in Control	2.14E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Colon cancer	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC19A3 in colon adenocarcinoma			[ 7 ]
Location	5'UTR (cg01330016)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.25E+00	Statistic Test	p-value:8.38E-05; Z-score:-4.62E+00
Methylation in Case	6.26E-01 (Median)	Methylation in Control	7.85E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC19A3 in colon adenocarcinoma			[ 7 ]
Location	TSS1500 (cg01532168)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.32E+00	Statistic Test	p-value:6.12E-07; Z-score:1.73E+00
Methylation in Case	5.64E-01 (Median)	Methylation in Control	4.26E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC19A3 in colon adenocarcinoma			[ 7 ]
Location	TSS200 (cg10150176)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.16E+00	Statistic Test	p-value:2.15E-04; Z-score:-5.00E+00
Methylation in Case	7.10E-01 (Median)	Methylation in Control	8.25E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC19A3 in colon adenocarcinoma			[ 7 ]
Location	TSS200 (cg04309194)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.16E+00	Statistic Test	p-value:3.07E-04; Z-score:-2.60E+00
Methylation in Case	5.22E-01 (Median)	Methylation in Control	6.08E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC19A3 in colon adenocarcinoma			[ 7 ]
Location	Body (cg16163535)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.21E+00	Statistic Test	p-value:4.43E-06; Z-score:-3.68E+00
Methylation in Case	6.96E-01 (Median)	Methylation in Control	8.45E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC19A3 in colon adenocarcinoma			[ 7 ]
Location	Body (cg24642933)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.34E+00	Statistic Test	p-value:8.55E-06; Z-score:-2.87E+00
Methylation in Case	4.46E-01 (Median)	Methylation in Control	5.98E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC19A3 in colon adenocarcinoma			[ 7 ]
Location	Body (cg08830588)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.16E+00	Statistic Test	p-value:3.47E-05; Z-score:-1.14E+00
Methylation in Case	4.21E-01 (Median)	Methylation in Control	4.87E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Colorectal cancer	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC19A3 in colorectal cancer			[ 8 ]
Location	5'UTR (cg13774987)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.10E+00	Statistic Test	p-value:3.42E-05; Z-score:1.19E+00
Methylation in Case	9.13E-01 (Median)	Methylation in Control	8.27E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC19A3 in colorectal cancer			[ 8 ]
Location	5'UTR (cg03894284)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.29E+00	Statistic Test	p-value:4.47E-05; Z-score:1.38E+00
Methylation in Case	8.19E-01 (Median)	Methylation in Control	6.35E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC19A3 in colorectal cancer			[ 8 ]
Location	5'UTR (cg07417745)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.10E+00	Statistic Test	p-value:1.70E-02; Z-score:3.85E-01
Methylation in Case	3.42E-01 (Median)	Methylation in Control	3.11E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC19A3 in colorectal cancer			[ 8 ]
Location	5'UTR (cg25713185)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.04E+00	Statistic Test	p-value:2.08E-02; Z-score:1.26E-01
Methylation in Case	1.78E-01 (Median)	Methylation in Control	1.70E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC19A3 in colorectal cancer			[ 8 ]
Location	TSS1500 (cg09726804)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.03E+00	Statistic Test	p-value:1.34E-02; Z-score:7.24E-01
Methylation in Case	8.98E-01 (Median)	Methylation in Control	8.76E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC19A3 in colorectal cancer			[ 8 ]
Location	3'UTR (cg04091914)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.05E+00	Statistic Test	p-value:1.07E-02; Z-score:1.47E+00
Methylation in Case	8.59E-01 (Median)	Methylation in Control	8.20E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	11 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC19A3 in hepatocellular carcinoma			[ 9 ]
Location	5'UTR (cg03894284)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.38E+00	Statistic Test	p-value:1.80E-06; Z-score:-1.20E+00
Methylation in Case	3.59E-01 (Median)	Methylation in Control	4.95E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC19A3 in hepatocellular carcinoma			[ 9 ]
Location	5'UTR (cg25713185)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.42E+00	Statistic Test	p-value:1.94E-06; Z-score:-1.03E+00
Methylation in Case	9.17E-02 (Median)	Methylation in Control	1.31E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC19A3 in hepatocellular carcinoma			[ 9 ]
Location	5'UTR (cg07417745)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.32E+00	Statistic Test	p-value:2.25E-06; Z-score:-1.04E+00
Methylation in Case	1.82E-01 (Median)	Methylation in Control	2.41E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC19A3 in hepatocellular carcinoma			[ 9 ]
Location	TSS1500 (cg04981611)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:5.23E+00	Statistic Test	p-value:3.54E-16; Z-score:1.50E+01
Methylation in Case	3.46E-01 (Median)	Methylation in Control	6.61E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC19A3 in hepatocellular carcinoma			[ 9 ]
Location	TSS200 (cg01142776)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.35E+00	Statistic Test	p-value:1.25E-06; Z-score:-1.16E+00
Methylation in Case	7.82E-02 (Median)	Methylation in Control	1.06E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC19A3 in hepatocellular carcinoma			[ 9 ]
Location	TSS200 (cg19850080)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.31E+00	Statistic Test	p-value:3.41E-06; Z-score:-8.16E-01
Methylation in Case	6.86E-02 (Median)	Methylation in Control	8.95E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC19A3 in hepatocellular carcinoma			[ 9 ]
Location	Body (cg12303470)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.76E+00	Statistic Test	p-value:2.68E-24; Z-score:-1.74E+01
Methylation in Case	4.66E-01 (Median)	Methylation in Control	8.20E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC19A3 in hepatocellular carcinoma			[ 9 ]
Location	Body (cg18869815)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.62E+00	Statistic Test	p-value:1.58E-17; Z-score:-4.17E+00
Methylation in Case	4.52E-01 (Median)	Methylation in Control	7.33E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC19A3 in hepatocellular carcinoma			[ 9 ]
Location	Body (cg05118455)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.53E+00	Statistic Test	p-value:5.12E-16; Z-score:-1.20E+01
Methylation in Case	5.35E-01 (Median)	Methylation in Control	8.17E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC19A3 in hepatocellular carcinoma			[ 9 ]
Location	Body (cg19863633)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:1.16E-02; Z-score:-5.83E-01
Methylation in Case	8.78E-01 (Median)	Methylation in Control	8.89E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC19A3 in hepatocellular carcinoma			[ 9 ]
Location	Body (cg21194765)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.00E+00	Statistic Test	p-value:3.97E-02; Z-score:-6.88E-02
Methylation in Case	8.80E-01 (Median)	Methylation in Control	8.81E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
HIV infection	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC19A3 in HIV infection			[ 10 ]
Location	5'UTR (cg25713185)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.28E+00	Statistic Test	p-value:3.04E-06; Z-score:1.56E+00
Methylation in Case	2.63E-01 (Median)	Methylation in Control	2.05E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC19A3 in HIV infection			[ 10 ]
Location	5'UTR (cg13774987)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.02E+00	Statistic Test	p-value:1.11E-03; Z-score:9.42E-01
Methylation in Case	9.06E-01 (Median)	Methylation in Control	8.87E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC19A3 in HIV infection			[ 10 ]
Location	5'UTR (cg07417745)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.03E+00	Statistic Test	p-value:2.91E-02; Z-score:2.99E-01
Methylation in Case	4.75E-01 (Median)	Methylation in Control	4.60E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC19A3 in HIV infection			[ 10 ]
Location	TSS200 (cg01142776)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.37E+00	Statistic Test	p-value:3.94E-05; Z-score:1.53E+00
Methylation in Case	1.60E-01 (Median)	Methylation in Control	1.17E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC19A3 in HIV infection			[ 10 ]
Location	TSS200 (cg19850080)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.40E+00	Statistic Test	p-value:1.02E-04; Z-score:1.57E+00
Methylation in Case	1.46E-01 (Median)	Methylation in Control	1.04E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC19A3 in HIV infection			[ 10 ]
Location	TSS200 (cg02562740)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.49E+00	Statistic Test	p-value:2.27E-03; Z-score:1.07E+00
Methylation in Case	3.66E-02 (Median)	Methylation in Control	2.45E-02 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC19A3 in HIV infection			[ 10 ]
Location	TSS200 (cg20440901)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.31E+00	Statistic Test	p-value:2.77E-02; Z-score:7.38E-01
Methylation in Case	4.34E-02 (Median)	Methylation in Control	3.32E-02 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC19A3 in HIV infection			[ 10 ]
Location	3'UTR (cg04091914)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:5.76E-03; Z-score:-8.46E-01
Methylation in Case	8.23E-01 (Median)	Methylation in Control	8.62E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC19A3 in lung adenocarcinoma			[ 11 ]
Location	5'UTR (cg03894284)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.20E+00	Statistic Test	p-value:1.40E-04; Z-score:2.36E+00
Methylation in Case	8.39E-01 (Median)	Methylation in Control	7.02E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC19A3 in lung adenocarcinoma			[ 11 ]
Location	5'UTR (cg25713185)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.62E+00	Statistic Test	p-value:6.22E-04; Z-score:3.35E+00
Methylation in Case	2.88E-01 (Median)	Methylation in Control	1.77E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC19A3 in lung adenocarcinoma			[ 11 ]
Location	5'UTR (cg07417745)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.50E+00	Statistic Test	p-value:1.28E-03; Z-score:3.40E+00
Methylation in Case	4.23E-01 (Median)	Methylation in Control	2.81E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC19A3 in lung adenocarcinoma			[ 11 ]
Location	5'UTR (cg13774987)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.08E+00	Statistic Test	p-value:7.73E-03; Z-score:1.83E+00
Methylation in Case	8.41E-01 (Median)	Methylation in Control	7.79E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC19A3 in lung adenocarcinoma			[ 11 ]
Location	TSS200 (cg19850080)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.53E+00	Statistic Test	p-value:5.21E-03; Z-score:3.09E+00
Methylation in Case	1.59E-01 (Median)	Methylation in Control	1.03E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC19A3 in lung adenocarcinoma			[ 11 ]
Location	TSS200 (cg01142776)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.45E+00	Statistic Test	p-value:7.40E-03; Z-score:4.20E+00
Methylation in Case	1.71E-01 (Median)	Methylation in Control	1.18E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	12 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC19A3 in pancretic ductal adenocarcinoma			[ 12 ]
Location	5'UTR (cg20632143)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.18E+00	Statistic Test	p-value:4.47E-08; Z-score:9.47E-01
Methylation in Case	4.55E-01 (Median)	Methylation in Control	3.85E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC19A3 in pancretic ductal adenocarcinoma			[ 12 ]
Location	TSS1500 (cg07845390)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.96E+00	Statistic Test	p-value:1.76E-23; Z-score:4.95E+00
Methylation in Case	2.43E-01 (Median)	Methylation in Control	8.22E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC19A3 in pancretic ductal adenocarcinoma			[ 12 ]
Location	TSS1500 (cg22935149)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.31E+00	Statistic Test	p-value:4.98E-14; Z-score:8.68E-01
Methylation in Case	6.65E-02 (Median)	Methylation in Control	5.09E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC19A3 in pancretic ductal adenocarcinoma			[ 12 ]
Location	1stExon (cg26923490)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.35E+00	Statistic Test	p-value:8.88E-23; Z-score:3.94E+00
Methylation in Case	4.72E-01 (Median)	Methylation in Control	2.01E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC19A3 in pancretic ductal adenocarcinoma			[ 12 ]
Location	1stExon (cg01135800)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.06E+00	Statistic Test	p-value:4.05E-02; Z-score:-5.56E-01
Methylation in Case	7.87E-01 (Median)	Methylation in Control	8.32E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC19A3 in pancretic ductal adenocarcinoma			[ 12 ]
Location	Body (cg09565111)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.10E+00	Statistic Test	p-value:8.80E-10; Z-score:-1.44E+00
Methylation in Case	6.73E-01 (Median)	Methylation in Control	7.42E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC19A3 in pancretic ductal adenocarcinoma			[ 12 ]
Location	Body (cg26504422)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.17E+00	Statistic Test	p-value:9.10E-08; Z-score:1.92E+00
Methylation in Case	8.24E-01 (Median)	Methylation in Control	7.07E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC19A3 in pancretic ductal adenocarcinoma			[ 12 ]
Location	Body (cg09606015)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.28E+00	Statistic Test	p-value:3.00E-05; Z-score:-9.61E-01
Methylation in Case	1.37E-01 (Median)	Methylation in Control	1.75E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC19A3 in pancretic ductal adenocarcinoma			[ 12 ]
Location	Body (cg13971265)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.10E+00	Statistic Test	p-value:7.56E-04; Z-score:1.21E+00
Methylation in Case	7.79E-01 (Median)	Methylation in Control	7.07E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC19A3 in pancretic ductal adenocarcinoma			[ 12 ]
Location	Body (cg21627218)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.01E+00	Statistic Test	p-value:2.40E-03; Z-score:7.83E-01
Methylation in Case	9.25E-01 (Median)	Methylation in Control	9.17E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC19A3 in pancretic ductal adenocarcinoma			[ 12 ]
Location	Body (cg23761815)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:1.16E-02; Z-score:-3.74E-01
Methylation in Case	8.81E-01 (Median)	Methylation in Control	8.88E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of SLC19A3 in pancretic ductal adenocarcinoma			[ 12 ]
Location	Body (cg18196463)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.00E+00	Statistic Test	p-value:3.09E-02; Z-score:-4.14E-01
Methylation in Case	9.30E-01 (Median)	Methylation in Control	9.35E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC19A3 in papillary thyroid cancer			[ 13 ]
Location	5'UTR (cg13774987)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.10E+00	Statistic Test	p-value:2.55E-03; Z-score:1.07E+00
Methylation in Case	8.36E-01 (Median)	Methylation in Control	7.58E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC19A3 in papillary thyroid cancer			[ 13 ]
Location	TSS200 (cg19850080)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.11E+00	Statistic Test	p-value:3.83E-03; Z-score:5.24E-01
Methylation in Case	7.54E-02 (Median)	Methylation in Control	6.80E-02 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC19A3 in papillary thyroid cancer			[ 13 ]
Location	TSS200 (cg01142776)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.09E+00	Statistic Test	p-value:2.02E-02; Z-score:3.51E-01
Methylation in Case	7.75E-02 (Median)	Methylation in Control	7.15E-02 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC19A3 in papillary thyroid cancer			[ 13 ]
Location	TSS200 (cg05844583)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.07E+00	Statistic Test	p-value:2.18E-02; Z-score:6.20E-01
Methylation in Case	5.31E-02 (Median)	Methylation in Control	4.97E-02 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC19A3 in papillary thyroid cancer			[ 13 ]
Location	Body (cg11543686)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:1.20E-03; Z-score:-5.21E-01
Methylation in Case	8.91E-01 (Median)	Methylation in Control	9.02E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC19A3 in papillary thyroid cancer			[ 13 ]
Location	3'UTR (cg04091914)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:4.29E-03; Z-score:-1.84E-01
Methylation in Case	8.59E-01 (Median)	Methylation in Control	8.64E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Prostate cancer	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC19A3 in prostate cancer			[ 14 ]
Location	TSS200 (cg02772823)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.97E+00	Statistic Test	p-value:1.24E-02; Z-score:-2.78E+00
Methylation in Case	2.86E-01 (Median)	Methylation in Control	5.64E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC19A3 in prostate cancer			[ 14 ]
Location	Body (cg07986907)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.15E+00	Statistic Test	p-value:5.84E-03; Z-score:2.70E+00
Methylation in Case	9.38E-01 (Median)	Methylation in Control	8.16E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Moderate hypermethylation of SLC19A3 in prostate cancer than that in healthy individual
Studied Phenotype	Prostate cancer [ICD-11:2C82]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:1.22E-34; Fold-change:0.233589324; Z-score:11.29860515
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Systemic lupus erythematosus	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC19A3 in systemic lupus erythematosus			[ 15 ]
Location	TSS200 (cg02562740)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.03E+00	Statistic Test	p-value:1.71E-02; Z-score:1.00E-01
Methylation in Case	3.45E-02 (Median)	Methylation in Control	3.35E-02 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC19A3 in systemic lupus erythematosus			[ 15 ]
Location	Body (cg21194765)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.00E+00	Statistic Test	p-value:6.12E-03; Z-score:-1.02E-01
Methylation in Case	9.15E-01 (Median)	Methylation in Control	9.17E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC19A3 in systemic lupus erythematosus			[ 15 ]
Location	Body (cg04529897)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.00E+00	Statistic Test	p-value:3.70E-02; Z-score:-9.31E-02
Methylation in Case	9.20E-01 (Median)	Methylation in Control	9.22E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Depression	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC19A3 in depression			[ 16 ]
Location	3'UTR (cg04091914)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.02E+00	Statistic Test	p-value:2.28E-02; Z-score:6.59E-01
Methylation in Case	7.71E-01 (Median)	Methylation in Control	7.53E-01 (Median)
Studied Phenotype	Depression[ ICD-11:6A8Z]
Experimental Material	Patient tissue samples
Lymphoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypermethylation of SLC19A3 in lymphoma than that in healthy individual
Studied Phenotype	Lymphoma [ICD-11:2B30]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:1.63E-28; Fold-change:0.618985571; Z-score:29.85128227
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Prostate cancer metastasis	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypermethylation of SLC19A3 in prostate cancer metastasis than that in healthy individual
Studied Phenotype	Prostate cancer metastasis [ICD-11:2.00E+06]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:1.96E-06; Fold-change:0.574690231; Z-score:26.50513269
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Histone acetylation
Colon cancer	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Hypoacetylation of SLC19A3 in colon cancer (compare with trichostatin A-treatment counterpart cells)			[ 17 ]
Location	Promoter
Epigenetic Type	Histone acetylation	Experiment Method	Chromatin immunoprecipitation
Related Molecular Changes	Down regulation ofSLC19A3	Experiment Method	RT-qPCR
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Multiple cell lines of human
Additional Notes	TSA treatment increased histone H3 acetylation of SLC19A3 promoter region in all 4 colon cancer cell lines examined.
Epigenetic Phenomenon2	Hypoacetylation of SLC19A3 in colon cancer (compare with TSA-treatment counterpart cells)			[ 17 ]
Location	Promoter
Epigenetic Type	Histone acetylation	Experiment Method	Chromatin immunoprecipitation
Related Molecular Changes	Down regulation ofSLC19A3	Experiment Method	RT-qPCR
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Multiple cell lines of human
Additional Notes	In the 4 colon cancer cells examined, SLC19A3 mRNA expression is down-regulated by histone deacetylation.
microRNA
Unclear Phenotype	83 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	let-7a directly targets SLC19A3			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	let-7a	miRNA Mature ID	let-7a-5p
miRNA Sequence	UGAGGUAGUAGGUUGUAUAGUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon2	let-7b directly targets SLC19A3			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	let-7b	miRNA Mature ID	let-7b-5p
miRNA Sequence	UGAGGUAGUAGGUUGUGUGGUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon3	let-7c directly targets SLC19A3			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	let-7c	miRNA Mature ID	let-7c-5p
miRNA Sequence	UGAGGUAGUAGGUUGUAUGGUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon4	let-7d directly targets SLC19A3			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	let-7d	miRNA Mature ID	let-7d-5p
miRNA Sequence	AGAGGUAGUAGGUUGCAUAGUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon5	let-7e directly targets SLC19A3			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	let-7e	miRNA Mature ID	let-7e-5p
miRNA Sequence	UGAGGUAGGAGGUUGUAUAGUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon6	let-7f directly targets SLC19A3			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	let-7f	miRNA Mature ID	let-7f-5p
miRNA Sequence	UGAGGUAGUAGAUUGUAUAGUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon7	let-7g directly targets SLC19A3			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	let-7g	miRNA Mature ID	let-7g-5p
miRNA Sequence	UGAGGUAGUAGUUUGUACAGUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon8	let-7i directly targets SLC19A3			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	let-7i	miRNA Mature ID	let-7i-5p
miRNA Sequence	UGAGGUAGUAGUUUGUGCUGUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon9	miR-1273h directly targets SLC19A3			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1273h	miRNA Mature ID	miR-1273h-5p
miRNA Sequence	CUGGGAGGUCAAGGCUGCAGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon10	miR-1296 directly targets SLC19A3			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1296	miRNA Mature ID	miR-1296-3p
miRNA Sequence	GAGUGGGGCUUCGACCCUAACC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon11	miR-1343 directly targets SLC19A3			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1343	miRNA Mature ID	miR-1343-5p
miRNA Sequence	UGGGGAGCGGCCCCCGGGUGGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon12	miR-135a directly targets SLC19A3			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-135a	miRNA Mature ID	miR-135a-5p
miRNA Sequence	UAUGGCUUUUUAUUCCUAUGUGA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon13	miR-135b directly targets SLC19A3			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-135b	miRNA Mature ID	miR-135b-5p
miRNA Sequence	UAUGGCUUUUCAUUCCUAUGUGA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon14	miR-149 directly targets SLC19A3			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-149	miRNA Mature ID	miR-149-3p
miRNA Sequence	AGGGAGGGACGGGGGCUGUGC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon15	miR-187 directly targets SLC19A3			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-187	miRNA Mature ID	miR-187-5p
miRNA Sequence	GGCUACAACACAGGACCCGGGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon16	miR-202 directly targets SLC19A3			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-202	miRNA Mature ID	miR-202-3p
miRNA Sequence	AGAGGUAUAGGGCAUGGGAA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon17	miR-203b directly targets SLC19A3			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-203b	miRNA Mature ID	miR-203b-3p
miRNA Sequence	UUGAACUGUUAAGAACCACUGGA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon18	miR-216a directly targets SLC19A3			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-216a	miRNA Mature ID	miR-216a-5p
miRNA Sequence	UAAUCUCAGCUGGCAACUGUGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon19	miR-216b directly targets SLC19A3			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-216b	miRNA Mature ID	miR-216b-5p
miRNA Sequence	AAAUCUCUGCAGGCAAAUGUGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon20	miR-221 directly targets SLC19A3			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-221	miRNA Mature ID	miR-221-3p
miRNA Sequence	AGCUACAUUGUCUGCUGGGUUUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon21	miR-222 directly targets SLC19A3			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-222	miRNA Mature ID	miR-222-3p
miRNA Sequence	AGCUACAUCUGGCUACUGGGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon22	miR-24 directly targets SLC19A3			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-24	miRNA Mature ID	miR-24-3p
miRNA Sequence	UGGCUCAGUUCAGCAGGAACAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon23	miR-30b directly targets SLC19A3			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-30b	miRNA Mature ID	miR-30b-3p
miRNA Sequence	CUGGGAGGUGGAUGUUUACUUC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon24	miR-30c-1 directly targets SLC19A3			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-30c-1	miRNA Mature ID	miR-30c-1-3p
miRNA Sequence	CUGGGAGAGGGUUGUUUACUCC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon25	miR-30c-2 directly targets SLC19A3			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-30c-2	miRNA Mature ID	miR-30c-2-3p
miRNA Sequence	CUGGGAGAAGGCUGUUUACUCU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon26	miR-3122 directly targets SLC19A3			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3122	miRNA Mature ID	miR-3122
miRNA Sequence	GUUGGGACAAGAGGACGGUCUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon27	miR-3124 directly targets SLC19A3			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3124	miRNA Mature ID	miR-3124-3p
miRNA Sequence	ACUUUCCUCACUCCCGUGAAGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon28	miR-3150a directly targets SLC19A3			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3150a	miRNA Mature ID	miR-3150a-3p
miRNA Sequence	CUGGGGAGAUCCUCGAGGUUGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon29	miR-3175 directly targets SLC19A3			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3175	miRNA Mature ID	miR-3175
miRNA Sequence	CGGGGAGAGAACGCAGUGACGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon30	miR-330 directly targets SLC19A3			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-330	miRNA Mature ID	miR-330-3p
miRNA Sequence	GCAAAGCACACGGCCUGCAGAGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon31	miR-3689a directly targets SLC19A3			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3689a	miRNA Mature ID	miR-3689a-3p
miRNA Sequence	CUGGGAGGUGUGAUAUCGUGGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon32	miR-3689b directly targets SLC19A3			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3689b	miRNA Mature ID	miR-3689b-3p
miRNA Sequence	CUGGGAGGUGUGAUAUUGUGGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon33	miR-3689c directly targets SLC19A3			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3689c	miRNA Mature ID	miR-3689c
miRNA Sequence	CUGGGAGGUGUGAUAUUGUGGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon34	miR-3689d directly targets SLC19A3			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3689d	miRNA Mature ID	miR-3689d
miRNA Sequence	GGGAGGUGUGAUCUCACACUCG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon35	miR-371a directly targets SLC19A3			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-371a	miRNA Mature ID	miR-371a-5p
miRNA Sequence	ACUCAAACUGUGGGGGCACU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon36	miR-371b directly targets SLC19A3			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-371b	miRNA Mature ID	miR-371b-5p
miRNA Sequence	ACUCAAAAGAUGGCGGCACUUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon37	miR-372 directly targets SLC19A3			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-372	miRNA Mature ID	miR-372-5p
miRNA Sequence	CCUCAAAUGUGGAGCACUAUUCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon38	miR-373 directly targets SLC19A3			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-373	miRNA Mature ID	miR-373-5p
miRNA Sequence	ACUCAAAAUGGGGGCGCUUUCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon39	miR-3913 directly targets SLC19A3			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3913	miRNA Mature ID	miR-3913-5p
miRNA Sequence	UUUGGGACUGAUCUUGAUGUCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon40	miR-3929 directly targets SLC19A3			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3929	miRNA Mature ID	miR-3929
miRNA Sequence	GAGGCUGAUGUGAGUAGACCACU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon41	miR-4284 directly targets SLC19A3			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4284	miRNA Mature ID	miR-4284
miRNA Sequence	GGGCUCACAUCACCCCAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon42	miR-4311 directly targets SLC19A3			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4311	miRNA Mature ID	miR-4311
miRNA Sequence	GAAAGAGAGCUGAGUGUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon43	miR-4458 directly targets SLC19A3			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4458	miRNA Mature ID	miR-4458
miRNA Sequence	AGAGGUAGGUGUGGAAGAA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon44	miR-4478 directly targets SLC19A3			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4478	miRNA Mature ID	miR-4478
miRNA Sequence	GAGGCUGAGCUGAGGAG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon45	miR-4481 directly targets SLC19A3			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4481	miRNA Mature ID	miR-4481
miRNA Sequence	GGAGUGGGCUGGUGGUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon46	miR-4500 directly targets SLC19A3			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4500	miRNA Mature ID	miR-4500
miRNA Sequence	UGAGGUAGUAGUUUCUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon47	miR-4680 directly targets SLC19A3			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4680	miRNA Mature ID	miR-4680-5p
miRNA Sequence	AGAACUCUUGCAGUCUUAGAUGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon48	miR-4693 directly targets SLC19A3			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4693	miRNA Mature ID	miR-4693-3p
miRNA Sequence	UGAGAGUGGAAUUCACAGUAUUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon49	miR-4698 directly targets SLC19A3			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4698	miRNA Mature ID	miR-4698
miRNA Sequence	UCAAAAUGUAGAGGAAGACCCCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon50	miR-4722 directly targets SLC19A3			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4722	miRNA Mature ID	miR-4722-5p
miRNA Sequence	GGCAGGAGGGCUGUGCCAGGUUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon51	miR-4728 directly targets SLC19A3			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4728	miRNA Mature ID	miR-4728-5p
miRNA Sequence	UGGGAGGGGAGAGGCAGCAAGCA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon52	miR-4745 directly targets SLC19A3			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4745	miRNA Mature ID	miR-4745-5p
miRNA Sequence	UGAGUGGGGCUCCCGGGACGGCG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon53	miR-4768 directly targets SLC19A3			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4768	miRNA Mature ID	miR-4768-3p
miRNA Sequence	CCAGGAGAUCCAGAGAGAAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon54	miR-485 directly targets SLC19A3			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-485	miRNA Mature ID	miR-485-5p
miRNA Sequence	AGAGGCUGGCCGUGAUGAAUUC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon55	miR-491 directly targets SLC19A3			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-491	miRNA Mature ID	miR-491-5p
miRNA Sequence	AGUGGGGAACCCUUCCAUGAGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon56	miR-548v directly targets SLC19A3			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-548v	miRNA Mature ID	miR-548v
miRNA Sequence	AGCUACAGUUACUUUUGCACCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon57	miR-616 directly targets SLC19A3			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-616	miRNA Mature ID	miR-616-5p
miRNA Sequence	ACUCAAAACCCUUCAGUGACUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon58	miR-6165 directly targets SLC19A3			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6165	miRNA Mature ID	miR-6165
miRNA Sequence	CAGCAGGAGGUGAGGGGAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon59	miR-6513 directly targets SLC19A3			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6513	miRNA Mature ID	miR-6513-5p
miRNA Sequence	UUUGGGAUUGACGCCACAUGUCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon60	miR-665 directly targets SLC19A3			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-665	miRNA Mature ID	miR-665
miRNA Sequence	ACCAGGAGGCUGAGGCCCCU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon61	miR-6736 directly targets SLC19A3			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6736	miRNA Mature ID	miR-6736-3p
miRNA Sequence	UCAGCUCCUCUCUACCCACAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon62	miR-6763 directly targets SLC19A3			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6763	miRNA Mature ID	miR-6763-5p
miRNA Sequence	CUGGGGAGUGGCUGGGGAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon63	miR-6779 directly targets SLC19A3			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6779	miRNA Mature ID	miR-6779-5p
miRNA Sequence	CUGGGAGGGGCUGGGUUUGGC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon64	miR-6780a directly targets SLC19A3			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6780a	miRNA Mature ID	miR-6780a-5p
miRNA Sequence	UUGGGAGGGAAGACAGCUGGAGA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon65	miR-6785 directly targets SLC19A3			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6785	miRNA Mature ID	miR-6785-5p
miRNA Sequence	UGGGAGGGCGUGGAUGAUGGUG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon66	miR-6787 directly targets SLC19A3			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6787	miRNA Mature ID	miR-6787-3p
miRNA Sequence	UCUCAGCUGCUGCCCUCUCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon67	miR-6788 directly targets SLC19A3			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6788	miRNA Mature ID	miR-6788-5p
miRNA Sequence	CUGGGAGAAGAGUGGUGAAGA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon68	miR-6799 directly targets SLC19A3			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6799	miRNA Mature ID	miR-6799-5p
miRNA Sequence	GGGGAGGUGUGCAGGGCUGG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon69	miR-6825 directly targets SLC19A3			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6825	miRNA Mature ID	miR-6825-5p
miRNA Sequence	UGGGGAGGUGUGGAGUCAGCAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon70	miR-6851 directly targets SLC19A3			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6851	miRNA Mature ID	miR-6851-5p
miRNA Sequence	AGGAGGUGGUACUAGGGGCCAGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon71	miR-6883 directly targets SLC19A3			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6883	miRNA Mature ID	miR-6883-5p
miRNA Sequence	AGGGAGGGUGUGGUAUGGAUGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon72	miR-6884 directly targets SLC19A3			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6884	miRNA Mature ID	miR-6884-5p
miRNA Sequence	AGAGGCUGAGAAGGUGAUGUUG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon73	miR-6888 directly targets SLC19A3			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6888	miRNA Mature ID	miR-6888-5p
miRNA Sequence	AAGGAGAUGCUCAGGCAGAU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon74	miR-7106 directly targets SLC19A3			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-7106	miRNA Mature ID	miR-7106-5p
miRNA Sequence	UGGGAGGAGGGGAUCUUGGG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon75	miR-7158 directly targets SLC19A3			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-7158	miRNA Mature ID	miR-7158-3p
miRNA Sequence	CUGAACUAGAGAUUGGGCCCA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon76	miR-7160 directly targets SLC19A3			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-7160	miRNA Mature ID	miR-7160-5p
miRNA Sequence	UGCUGAGGUCCGGGCUGUGCC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon77	miR-7162 directly targets SLC19A3			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-7162	miRNA Mature ID	miR-7162-3p
miRNA Sequence	UCUGAGGUGGAACAGCAGC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon78	miR-8063 directly targets SLC19A3			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-8063	miRNA Mature ID	miR-8063
miRNA Sequence	UCAAAAUCAGGAGUCGGGGCUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon79	miR-887 directly targets SLC19A3			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-887	miRNA Mature ID	miR-887-5p
miRNA Sequence	CUUGGGAGCCCUGUUAGACUC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon80	miR-890 directly targets SLC19A3			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-890	miRNA Mature ID	miR-890
miRNA Sequence	UACUUGGAAAGGCAUCAGUUG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon81	miR-9 directly targets SLC19A3			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-9	miRNA Mature ID	miR-9-5p
miRNA Sequence	UCUUUGGUUAUCUAGCUGUAUGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon82	miR-939 directly targets SLC19A3			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-939	miRNA Mature ID	miR-939-5p
miRNA Sequence	UGGGGAGCUGAGGCUCUGGGGGUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon83	miR-98 directly targets SLC19A3			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-98	miRNA Mature ID	miR-98-5p
miRNA Sequence	UGAGGUAGUAAGUUGUAUUGUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)

References
1	Promoter hypermethylation mediates downregulation of thiamine receptor SLC19A3 in gastric cancer. Tumour Biol. 2009;30(5-6):242-8.
2	Quantitative analysis and diagnostic significance of methylated SLC19A3 DNA in the plasma of breast and gastric cancer patients. PLoS One. 2011;6(7):e22233.
3	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
4	DNA Methylation Dynamics in Urological Tumors.
5	Genome-wide Scan for Methylation Profiles in Breast Cancer
6	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
7	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
8	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
9	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
10	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
11	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
12	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
13	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
14	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
15	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
16	DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
17	Different involvement of DNA methylation and histone deacetylation in the expression of solute-carrier transporters in 4 colon cancer cell lines. Biol Pharm Bull. 2012;35(3):301-7.
18	Insights into snoRNA biogenesis and processing from PAR-CLIP of snoRNA core proteins and small RNA sequencing. Genome Biol. 2013 May 26;14(5):R45.
19	In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio. 2013 Apr 16;4(2):e000193.
20	Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence