General Information of Drug Transporter (DT)
DT ID DTD0127 Transporter Info
Gene Name SLC19A2
Transporter Name Thiamine transporter 1
Gene ID
10560
UniProt ID
O60779
Epigenetic Regulations of This DT (EGR)

Methylation

  Renal cell carcinoma

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC19A2 in clear cell renal cell carcinoma [ 1 ]

Location

TSS1500 (cg13912204)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.26E+00 Statistic Test p-value:6.71E-05; Z-score:9.43E-01

Methylation in Case

2.62E-02 (Median) Methylation in Control 2.08E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC19A2 in clear cell renal cell carcinoma [ 1 ]

Location

TSS1500 (cg20248356)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.18E+00 Statistic Test p-value:1.89E-04; Z-score:9.11E-01

Methylation in Case

1.19E-02 (Median) Methylation in Control 1.01E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC19A2 in clear cell renal cell carcinoma [ 1 ]

Location

TSS200 (cg00874641)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.15E+00 Statistic Test p-value:6.00E-04; Z-score:6.40E-01

Methylation in Case

2.72E-02 (Median) Methylation in Control 2.36E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC19A2 in clear cell renal cell carcinoma [ 1 ]

Location

Body (cg01433556)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.25E+00 Statistic Test p-value:9.75E-06; Z-score:1.34E+00

Methylation in Case

3.09E-02 (Median) Methylation in Control 2.47E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Colon cancer

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC19A2 in colon adenocarcinoma [ 2 ]

Location

TSS1500 (cg11735997)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.41E+00 Statistic Test p-value:1.34E-04; Z-score:2.64E+00

Methylation in Case

5.37E-01 (Median) Methylation in Control 3.80E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC19A2 in colon adenocarcinoma [ 2 ]

Location

Body (cg26048101)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.50E+00 Statistic Test p-value:7.02E-06; Z-score:-1.69E+00

Methylation in Case

1.21E-01 (Median) Methylation in Control 1.81E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC19A2 in colon adenocarcinoma [ 2 ]

Location

Body (cg01829829)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.17E+00 Statistic Test p-value:2.54E-05; Z-score:-3.25E+00

Methylation in Case

6.67E-01 (Median) Methylation in Control 7.83E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC19A2 in colon adenocarcinoma [ 2 ]

Location

Body (cg26579073)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:5.49E-05; Z-score:1.20E+00

Methylation in Case

8.65E-01 (Median) Methylation in Control 8.35E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Colorectal cancer

           8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC19A2 in colorectal cancer [ 3 ]

Location

TSS1500 (cg20248356)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.16E+00 Statistic Test p-value:1.14E-02; Z-score:9.20E-01

Methylation in Case

7.45E-02 (Median) Methylation in Control 6.40E-02 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC19A2 in colorectal cancer [ 3 ]

Location

TSS1500 (cg00691125)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.19E+00 Statistic Test p-value:4.27E-02; Z-score:-7.08E-01

Methylation in Case

2.31E-02 (Median) Methylation in Control 2.75E-02 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC19A2 in colorectal cancer [ 3 ]

Location

TSS200 (cg05969530)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.16E+00 Statistic Test p-value:5.36E-04; Z-score:-8.56E-01

Methylation in Case

2.90E-02 (Median) Methylation in Control 3.38E-02 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC19A2 in colorectal cancer [ 3 ]

Location

TSS200 (cg20816261)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.19E+00 Statistic Test p-value:2.01E-03; Z-score:-7.15E-01

Methylation in Case

1.78E-02 (Median) Methylation in Control 2.13E-02 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC19A2 in colorectal cancer [ 3 ]

Location

TSS200 (cg00874641)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.15E+00 Statistic Test p-value:2.58E-02; Z-score:-4.01E-01

Methylation in Case

8.86E-02 (Median) Methylation in Control 1.01E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC19A2 in colorectal cancer [ 3 ]

Location

Body (cg16548605)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.12E+00 Statistic Test p-value:6.97E-03; Z-score:-7.97E-01

Methylation in Case

7.61E-01 (Median) Methylation in Control 8.50E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC19A2 in colorectal cancer [ 3 ]

Location

3'UTR (cg24541193)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:4.94E-02; Z-score:-4.33E-01

Methylation in Case

8.34E-01 (Median) Methylation in Control 8.56E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  HIV infection

           7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC19A2 in HIV infection [ 4 ]

Location

TSS1500 (cg20248356)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.16E+00 Statistic Test p-value:1.69E-02; Z-score:5.66E-01

Methylation in Case

4.91E-02 (Median) Methylation in Control 4.24E-02 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC19A2 in HIV infection [ 4 ]

Location

TSS1500 (cg13912204)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:3.78E-02; Z-score:-4.82E-01

Methylation in Case

5.50E-02 (Median) Methylation in Control 6.07E-02 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC19A2 in HIV infection [ 4 ]

Location

TSS200 (cg05969530)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.19E+00 Statistic Test p-value:5.62E-03; Z-score:7.30E-01

Methylation in Case

3.45E-02 (Median) Methylation in Control 2.91E-02 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC19A2 in HIV infection [ 4 ]

Location

TSS200 (cg00874641)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:3.61E-02; Z-score:-6.41E-01

Methylation in Case

6.29E-02 (Median) Methylation in Control 6.84E-02 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC19A2 in HIV infection [ 4 ]

Location

Body (cg04083076)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.16E+00 Statistic Test p-value:3.30E-11; Z-score:1.84E+00

Methylation in Case

6.84E-01 (Median) Methylation in Control 5.91E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC19A2 in HIV infection [ 4 ]

Location

Body (cg01433556)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.13E+00 Statistic Test p-value:3.35E-03; Z-score:9.02E-01

Methylation in Case

7.03E-02 (Median) Methylation in Control 6.22E-02 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC19A2 in HIV infection [ 4 ]

Location

3'UTR (cg24541193)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.12E+00 Statistic Test p-value:1.54E-05; Z-score:1.10E+00

Methylation in Case

6.97E-01 (Median) Methylation in Control 6.22E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Pancretic ductal adenocarcinoma

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC19A2 in pancretic ductal adenocarcinoma [ 5 ]

Location

TSS1500 (cg00664682)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.08E+00 Statistic Test p-value:1.04E-02; Z-score:-3.92E-01

Methylation in Case

4.14E-02 (Median) Methylation in Control 4.47E-02 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC19A2 in pancretic ductal adenocarcinoma [ 5 ]

Location

Body (cg14004271)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.11E+00 Statistic Test p-value:3.92E-05; Z-score:1.01E+00

Methylation in Case

8.48E-01 (Median) Methylation in Control 7.68E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC19A2 in pancretic ductal adenocarcinoma [ 5 ]

Location

Body (cg15128778)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.11E+00 Statistic Test p-value:1.06E-03; Z-score:1.12E+00

Methylation in Case

7.42E-01 (Median) Methylation in Control 6.70E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

           5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC19A2 in papillary thyroid cancer [ 6 ]

Location

TSS1500 (cg20248356)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:1.28E-03; Z-score:-5.16E-01

Methylation in Case

4.02E-02 (Median) Methylation in Control 4.39E-02 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC19A2 in papillary thyroid cancer [ 6 ]

Location

TSS200 (cg26681912)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:9.88E-04; Z-score:-3.36E-01

Methylation in Case

3.38E-02 (Median) Methylation in Control 3.62E-02 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC19A2 in papillary thyroid cancer [ 6 ]

Location

TSS200 (cg00874641)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:1.30E-02; Z-score:-3.40E-01

Methylation in Case

5.18E-02 (Median) Methylation in Control 5.41E-02 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC19A2 in papillary thyroid cancer [ 6 ]

Location

Body (cg16548605)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.46E+00 Statistic Test p-value:2.20E-12; Z-score:-3.07E+00

Methylation in Case

4.96E-01 (Median) Methylation in Control 7.26E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC19A2 in papillary thyroid cancer [ 6 ]

Location

Body (cg04083076)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:5.53E-03; Z-score:-2.92E-01

Methylation in Case

7.50E-01 (Median) Methylation in Control 7.61E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Bladder cancer

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC19A2 in bladder cancer [ 7 ]

Location

TSS200 (cg26681912)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.43E+00 Statistic Test p-value:2.95E-02; Z-score:-2.00E+00

Methylation in Case

2.40E-02 (Median) Methylation in Control 5.85E-02 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC19A2 in bladder cancer [ 7 ]

Location

Body (cg16548605)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.84E+00 Statistic Test p-value:1.92E-13; Z-score:-2.08E+01

Methylation in Case

2.56E-01 (Median) Methylation in Control 7.27E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC19A2 in bladder cancer [ 7 ]

Location

Body (cg04083076)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.37E+00 Statistic Test p-value:3.10E-06; Z-score:-5.54E+00

Methylation in Case

4.73E-01 (Median) Methylation in Control 6.48E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC19A2 in bladder cancer [ 7 ]

Location

3'UTR (cg24541193)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.45E+00 Statistic Test p-value:4.96E-07; Z-score:6.09E+00

Methylation in Case

6.74E-01 (Median) Methylation in Control 4.65E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Breast cancer

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC19A2 in breast cancer [ 8 ]

Location

TSS200 (cg00874641)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.17E+00 Statistic Test p-value:5.97E-03; Z-score:-7.20E-01

Methylation in Case

6.11E-02 (Median) Methylation in Control 7.16E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC19A2 in breast cancer [ 8 ]

Location

TSS200 (cg26681912)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.76E+00 Statistic Test p-value:2.69E-02; Z-score:-4.07E-01

Methylation in Case

1.33E-02 (Median) Methylation in Control 2.34E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC19A2 in breast cancer [ 8 ]

Location

Body (cg16548605)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.22E+00 Statistic Test p-value:1.16E-09; Z-score:-2.03E+00

Methylation in Case

5.91E-01 (Median) Methylation in Control 7.21E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC19A2 in breast cancer [ 8 ]

Location

Body (cg04083076)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:7.49E-04; Z-score:-3.98E-01

Methylation in Case

5.67E-01 (Median) Methylation in Control 6.01E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Hepatocellular carcinoma

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC19A2 in hepatocellular carcinoma [ 9 ]

Location

TSS200 (cg05969530)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:4.54E-02; Z-score:1.46E-01

Methylation in Case

3.27E-02 (Median) Methylation in Control 3.13E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC19A2 in hepatocellular carcinoma [ 9 ]

Location

Body (cg17669365)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.21E+00 Statistic Test p-value:5.07E-10; Z-score:-4.69E+00

Methylation in Case

6.28E-01 (Median) Methylation in Control 7.58E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Systemic lupus erythematosus

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC19A2 in systemic lupus erythematosus [ 10 ]

Location

TSS200 (cg00874641)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:2.04E-02; Z-score:-1.19E-01

Methylation in Case

7.98E-02 (Median) Methylation in Control 8.14E-02 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC19A2 in systemic lupus erythematosus [ 10 ]

Location

3'UTR (cg24541193)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:2.11E-02; Z-score:2.43E-01

Methylation in Case

7.39E-01 (Median) Methylation in Control 7.23E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Atypical teratoid rhabdoid tumor

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC19A2 in atypical teratoid rhabdoid tumor [ 11 ]

Location

Body (cg01433556)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.26E+00 Statistic Test p-value:6.54E-05; Z-score:-8.53E-01

Methylation in Case

2.57E-01 (Median) Methylation in Control 3.24E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC19A2 in atypical teratoid rhabdoid tumor [ 11 ]

Location

Body (cg02625942)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-5.24E+00 Statistic Test p-value:1.97E-04; Z-score:-7.27E-01

Methylation in Case

2.99E-02 (Median) Methylation in Control 1.57E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC19A2 in atypical teratoid rhabdoid tumor [ 11 ]

Location

Body (cg04083076)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:5.52E-04; Z-score:-1.01E+00

Methylation in Case

7.34E-01 (Median) Methylation in Control 7.88E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC19A2 in atypical teratoid rhabdoid tumor [ 11 ]

Location

3'UTR (cg24541193)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.18E+00 Statistic Test p-value:1.48E-09; Z-score:-1.60E+00

Methylation in Case

6.16E-01 (Median) Methylation in Control 7.26E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Lung adenocarcinoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC19A2 in lung adenocarcinoma [ 12 ]

Location

3'UTR (cg24541193)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:4.42E-02; Z-score:1.42E+00

Methylation in Case

7.53E-01 (Median) Methylation in Control 7.07E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Panic disorder

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC19A2 in panic disorder [ 13 ]

Location

3'UTR (cg24541193)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-3.28E-01 Statistic Test p-value:2.95E-05; Z-score:-7.53E-01

Methylation in Case

-4.97E-01 (Median) Methylation in Control -1.63E-01 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Prostate cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC19A2 in prostate cancer [ 14 ]

Location

3'UTR (cg18377941)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:3.01E-02; Z-score:2.60E+00

Methylation in Case

9.59E-01 (Median) Methylation in Control 9.19E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

microRNA

  Unclear Phenotype

           9 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-122 directly targets SLC19A2 [ 15 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-122 miRNA Mature ID miR-122-5p

miRNA Sequence

UGGAGUGUGACAAUGGUGUUUG

miRNA Target Type

Direct

Experimental Material

Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon2

miR-181a directly targets SLC19A2 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-181a miRNA Mature ID miR-181a-5p

miRNA Sequence

AACAUUCAACGCUGUCGGUGAGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon3

miR-181b directly targets SLC19A2 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-181b miRNA Mature ID miR-181b-5p

miRNA Sequence

AACAUUCAUUGCUGUCGGUGGGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon4

miR-181c directly targets SLC19A2 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-181c miRNA Mature ID miR-181c-5p

miRNA Sequence

AACAUUCAACCUGUCGGUGAGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon5

miR-181d directly targets SLC19A2 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-181d miRNA Mature ID miR-181d-5p

miRNA Sequence

AACAUUCAUUGUUGUCGGUGGGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon6

miR-192 directly targets SLC19A2 [ 17 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-192 miRNA Mature ID miR-192-5p

miRNA Sequence

CUGACCUAUGAAUUGACAGCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon7

miR-215 directly targets SLC19A2 [ 17 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-215 miRNA Mature ID miR-215-5p

miRNA Sequence

AUGACCUAUGAAUUGACAGAC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon8

miR-26b directly targets SLC19A2 [ 18 ]

Epigenetic Type

microRNA Experiment Method Sequencing

miRNA Stemloop ID

miR-26b miRNA Mature ID miR-26b-5p

miRNA Sequence

UUCAAGUAAUUCAGGAUAGGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon9

miR-98 directly targets SLC19A2 [ 19 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-98 miRNA Mature ID miR-98-5p

miRNA Sequence

UGAGGUAGUAAGUUGUAUUGUU

miRNA Target Type

Direct

Experimental Material

Human cervical cancer cell line (Hela)
References
1 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
2 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
3 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
4 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
5 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
6 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
7 DNA Methylation Dynamics in Urological Tumors.
8 Genome-wide Scan for Methylation Profiles in Breast Cancer
9 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
10 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
11 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
12 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
13 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
14 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
15 MicroRNA targeting specificity in mammals: determinants beyond seed pairing. Mol Cell. 2007 Jul 6;27(1):91-105.
16 EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21.
17 Coordinated regulation of cell cycle transcripts by p53-Inducible microRNAs, miR-192 and miR-215. Cancer Res. 2008 Dec 15;68(24):10105-12.
18 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
19 MicroRNA target prediction by expression analysis of host genes. Genome Res. 2009 Mar;19(3):481-90.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.