Detail Information of Epigenetic Regulations
General Information of Drug Transporter (DT) | |||||
---|---|---|---|---|---|
DT ID | DTD0125 Transporter Info | ||||
Gene Name | SLC18B1 | ||||
Transporter Name | MFS-type transporter SLC18B1 | ||||
Gene ID | |||||
UniProt ID | |||||
Epigenetic Regulations of This DT (EGR) | |||||
---|---|---|---|---|---|
microRNA |
|||||
Unclear Phenotype |
9 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
miR-1207 directly targets SLC18B1 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-1207 | miRNA Mature ID | miR-1207-5p | ||
miRNA Sequence |
UGGCAGGGAGGCUGGGAGGGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon2 |
miR-183 directly targets SLC18B1 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-183 | miRNA Mature ID | miR-183-5p | ||
miRNA Sequence |
UAUGGCACUGGUAGAAUUCACU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon3 |
miR-193b directly targets SLC18B1 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
miRNA Stemloop ID |
miR-193b | miRNA Mature ID | miR-193b-3p | ||
miRNA Sequence |
AACUGGCCCUCAAAGUCCCGCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon4 |
miR-31 directly targets SLC18B1 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-31 | miRNA Mature ID | miR-31-5p | ||
miRNA Sequence |
AGGCAAGAUGCUGGCAUAGCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon5 |
miR-4736 directly targets SLC18B1 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4736 | miRNA Mature ID | miR-4736 | ||
miRNA Sequence |
AGGCAGGUUAUCUGGGCUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon6 |
miR-4742 directly targets SLC18B1 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4742 | miRNA Mature ID | miR-4742-5p | ||
miRNA Sequence |
UCAGGCAAAGGGAUAUUUACAGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon7 |
miR-4763 directly targets SLC18B1 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4763 | miRNA Mature ID | miR-4763-3p | ||
miRNA Sequence |
AGGCAGGGGCUGGUGCUGGGCGGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon8 |
miR-6875 directly targets SLC18B1 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6875 | miRNA Mature ID | miR-6875-3p | ||
miRNA Sequence |
AUUCUUCCUGCCCUGGCUCCAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon9 |
miR-7150 directly targets SLC18B1 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-7150 | miRNA Mature ID | miR-7150 | ||
miRNA Sequence |
CUGGCAGGGGGAGAGGUA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.