General Information of Drug Transporter (DT)
DT ID DTD0114 Transporter Info
Gene Name SLC17A1
Transporter Name Sodium-dependent phosphate transport protein 1
Gene ID
6568
UniProt ID
Q14916
Epigenetic Regulations of This DT (EGR)

Methylation

  Atypical teratoid rhabdoid tumor

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC17A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

5'UTR (cg03835296)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.14E+00 Statistic Test p-value:2.03E-08; Z-score:1.69E+00

Methylation in Case

9.30E-01 (Median) Methylation in Control 8.13E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC17A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

5'UTR (cg22101098)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:5.69E-06; Z-score:-6.23E-01

Methylation in Case

8.72E-01 (Median) Methylation in Control 9.09E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC17A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

5'UTR (cg24766398)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.35E+00 Statistic Test p-value:8.18E-06; Z-score:-1.13E+00

Methylation in Case

3.24E-01 (Median) Methylation in Control 4.38E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC17A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

3'UTR (cg06885175)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:1.98E-13; Z-score:-2.85E+00

Methylation in Case

8.19E-01 (Median) Methylation in Control 9.03E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Bladder cancer

           5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC17A1 in bladder cancer [ 2 ]

Location

5'UTR (cg24766398)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.40E+00 Statistic Test p-value:7.32E-11; Z-score:-1.04E+01

Methylation in Case

2.41E-01 (Median) Methylation in Control 5.77E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC17A1 in bladder cancer [ 2 ]

Location

5'UTR (cg03835296)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.73E+00 Statistic Test p-value:1.24E-10; Z-score:-2.91E+01

Methylation in Case

4.76E-01 (Median) Methylation in Control 8.23E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC17A1 in bladder cancer [ 2 ]

Location

5'UTR (cg22101098)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.38E+00 Statistic Test p-value:1.25E-07; Z-score:-1.48E+01

Methylation in Case

5.78E-01 (Median) Methylation in Control 7.97E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC17A1 in bladder cancer [ 2 ]

Location

TSS200 (cg22988581)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.39E+00 Statistic Test p-value:8.47E-06; Z-score:-5.22E+00

Methylation in Case

1.53E-01 (Median) Methylation in Control 3.64E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC17A1 in bladder cancer [ 2 ]

Location

3'UTR (cg06885175)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-4.03E+00 Statistic Test p-value:3.19E-05; Z-score:-5.52E+00

Methylation in Case

8.50E-02 (Median) Methylation in Control 3.42E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Breast cancer

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC17A1 in breast cancer [ 3 ]

Location

5'UTR (cg22101098)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.15E+00 Statistic Test p-value:1.06E-05; Z-score:1.77E+00

Methylation in Case

7.74E-01 (Median) Methylation in Control 6.71E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC17A1 in breast cancer [ 3 ]

Location

5'UTR (cg24766398)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.15E+00 Statistic Test p-value:2.37E-02; Z-score:8.86E-01

Methylation in Case

4.63E-01 (Median) Methylation in Control 4.03E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC17A1 in breast cancer [ 3 ]

Location

TSS200 (cg22988581)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:2.17E-03; Z-score:-9.72E-01

Methylation in Case

4.65E-01 (Median) Methylation in Control 5.08E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC17A1 in breast cancer [ 3 ]

Location

Body (cg19490609)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.29E+00 Statistic Test p-value:7.45E-07; Z-score:1.83E+00

Methylation in Case

4.59E-01 (Median) Methylation in Control 3.56E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Colorectal cancer

           6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC17A1 in colorectal cancer [ 4 ]

Location

5'UTR (cg24766398)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.23E+00 Statistic Test p-value:1.93E-07; Z-score:-1.82E+00

Methylation in Case

6.30E-01 (Median) Methylation in Control 7.74E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC17A1 in colorectal cancer [ 4 ]

Location

5'UTR (cg03835296)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:1.21E-06; Z-score:-2.15E+00

Methylation in Case

8.68E-01 (Median) Methylation in Control 9.11E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC17A1 in colorectal cancer [ 4 ]

Location

5'UTR (cg22101098)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:1.22E-04; Z-score:-9.24E-01

Methylation in Case

8.78E-01 (Median) Methylation in Control 9.06E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC17A1 in colorectal cancer [ 4 ]

Location

TSS1500 (cg26691898)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:4.41E-07; Z-score:-2.07E+00

Methylation in Case

8.86E-01 (Median) Methylation in Control 9.17E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC17A1 in colorectal cancer [ 4 ]

Location

3'UTR (cg06885175)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.35E+00 Statistic Test p-value:2.38E-04; Z-score:-1.06E+00

Methylation in Case

2.42E-01 (Median) Methylation in Control 3.27E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Significant hypermethylation of SLC17A1 in colorectal cancer than that in healthy individual

Studied Phenotype

Colorectal cancer [ICD-11:2B91]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:6.39E-08; Fold-change:0.317341629; Z-score:1.209543568
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals

  HIV infection

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC17A1 in HIV infection [ 5 ]

Location

5'UTR (cg24766398)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:2.40E-03; Z-score:-9.90E-01

Methylation in Case

7.74E-01 (Median) Methylation in Control 8.27E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC17A1 in HIV infection [ 5 ]

Location

TSS200 (cg22988581)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:1.25E-03; Z-score:-7.84E-01

Methylation in Case

7.51E-01 (Median) Methylation in Control 7.79E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC17A1 in HIV infection [ 5 ]

Location

3'UTR (cg06885175)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.51E+00 Statistic Test p-value:1.24E-04; Z-score:1.35E+00

Methylation in Case

2.52E-01 (Median) Methylation in Control 1.67E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Lung adenocarcinoma

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC17A1 in lung adenocarcinoma [ 6 ]

Location

5'UTR (cg03835296)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.08E+00 Statistic Test p-value:1.56E-02; Z-score:-1.30E+00

Methylation in Case

7.90E-01 (Median) Methylation in Control 8.52E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC17A1 in lung adenocarcinoma [ 6 ]

Location

TSS200 (cg22988581)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.20E+00 Statistic Test p-value:2.67E-02; Z-score:-1.63E+00

Methylation in Case

5.31E-01 (Median) Methylation in Control 6.35E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Pancretic ductal adenocarcinoma

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC17A1 in pancretic ductal adenocarcinoma [ 7 ]

Location

5'UTR (cg05043886)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.35E+00 Statistic Test p-value:2.23E-09; Z-score:1.71E+00

Methylation in Case

3.25E-01 (Median) Methylation in Control 2.41E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC17A1 in pancretic ductal adenocarcinoma [ 7 ]

Location

TSS1500 (cg01151699)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.36E+00 Statistic Test p-value:2.43E-14; Z-score:1.59E+00

Methylation in Case

7.54E-02 (Median) Methylation in Control 5.52E-02 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC17A1 in pancretic ductal adenocarcinoma [ 7 ]

Location

TSS1500 (cg00999623)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.19E+00 Statistic Test p-value:2.30E-04; Z-score:-8.97E-01

Methylation in Case

1.32E-01 (Median) Methylation in Control 1.58E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC17A1 in pancretic ductal adenocarcinoma [ 7 ]

Location

TSS1500 (cg08424219)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.24E+00 Statistic Test p-value:8.34E-03; Z-score:-4.52E-01

Methylation in Case

9.65E-02 (Median) Methylation in Control 1.19E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC17A1 in papillary thyroid cancer [ 8 ]

Location

5'UTR (cg22101098)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.11E+00 Statistic Test p-value:2.47E-03; Z-score:6.92E-01

Methylation in Case

5.68E-01 (Median) Methylation in Control 5.11E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC17A1 in papillary thyroid cancer [ 8 ]

Location

3'UTR (cg06885175)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.31E+00 Statistic Test p-value:5.36E-04; Z-score:-1.19E+00

Methylation in Case

2.48E-01 (Median) Methylation in Control 3.26E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Hepatocellular carcinoma

           5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC17A1 in hepatocellular carcinoma [ 9 ]

Location

TSS1500 (cg26691898)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:2.37E-04; Z-score:-6.36E-01

Methylation in Case

7.88E-01 (Median) Methylation in Control 8.09E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC17A1 in hepatocellular carcinoma [ 9 ]

Location

TSS200 (cg07888856)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:6.70E+00 Statistic Test p-value:9.38E-14; Z-score:1.31E+01

Methylation in Case

2.76E-01 (Median) Methylation in Control 4.12E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC17A1 in hepatocellular carcinoma [ 9 ]

Location

TSS200 (cg07808555)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.46E+00 Statistic Test p-value:5.08E-12; Z-score:2.49E+00

Methylation in Case

1.85E-01 (Median) Methylation in Control 7.54E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC17A1 in hepatocellular carcinoma [ 9 ]

Location

Body (cg19490609)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.11E+00 Statistic Test p-value:3.02E-02; Z-score:8.78E-01

Methylation in Case

6.86E-01 (Median) Methylation in Control 6.17E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC17A1 in hepatocellular carcinoma [ 9 ]

Location

3'UTR (cg06885175)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.25E+00 Statistic Test p-value:6.70E-05; Z-score:-7.98E-01

Methylation in Case

1.32E-01 (Median) Methylation in Control 1.66E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Liver cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate/moderate hypomethylation of SLC17A1 in liver cancer than that in healthy individual/adjacent tissue

Studied Phenotype

Liver cancer [ICD-11:2C12]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:0.000857727; Fold-change:-0.273796368; Z-score:-1.094861211

The Methylation Level of Disease Section Compare with the Adjacent Tissue

p-value:2.07E-11; Fold-change:-0.250044978; Z-score:-2.619104924
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
DT methylation level in tissue other than the diseased tissue of patients
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Cerebellar liponeurocytoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypermethylation of SLC17A1 in cerebellar liponeurocytoma than that in healthy individual

Studied Phenotype

Cerebellar liponeurocytoma [ICD-11:2A00.0Y]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:0.010171838; Fold-change:0.285047126; Z-score:1.005873949
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Oligodendroglioma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypermethylation of SLC17A1 in oligodendroglioma than that in healthy individual

Studied Phenotype

Oligodendroglioma [ICD-11:2A00.0Y]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:5.48E-12; Fold-change:0.23651157; Z-score:1.25327646
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Pituitary adenoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypermethylation of SLC17A1 in pituitary adenoma than that in healthy individual

Studied Phenotype

Pituitary adenoma [ICD-11:2F37]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:0.008230396; Fold-change:0.293560842; Z-score:5.497815096
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Chordoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of SLC17A1 in chordoma than that in healthy individual

Studied Phenotype

Chordoma [ICD-11:5A61.0]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:0.019679349; Fold-change:-0.261206131; Z-score:-1.545974161
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Craniopharyngioma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of SLC17A1 in craniopharyngioma than that in healthy individual

Studied Phenotype

Craniopharyngioma [ICD-11:2F9A]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:0.005118004; Fold-change:-0.207162332; Z-score:-0.840836639
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Diffuse midline glioma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of SLC17A1 in diffuse midline glioma than that in healthy individual

Studied Phenotype

Diffuse midline glioma [ICD-11:2A00.0Z]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:1.02E-09; Fold-change:-0.230624986; Z-score:-1.222796419
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Osteoarthritis

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of SLC17A1 in osteoarthritis than that in healthy individual

Studied Phenotype

Osteoarthritis [ICD-11:FA00]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:7.93E-11; Fold-change:-0.217409842; Z-score:-2.816531123
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Asthma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypermethylation of SLC17A1 in asthma than that in healthy individual

Studied Phenotype

Asthma [ICD-11:CA23]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:0.032594569; Fold-change:0.45039513; Z-score:1.464816356
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Prostate cancer metastasis

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypermethylation of SLC17A1 in prostate cancer metastasis than that in healthy individual

Studied Phenotype

Prostate cancer metastasis [ICD-11:2.00E+06]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:0.002507466; Fold-change:0.395182376; Z-score:9.51586899
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Prostate cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypermethylation of SLC17A1 in prostate cancer than that in healthy individual

Studied Phenotype

Prostate cancer [ICD-11:2C82]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:9.05E-08; Fold-change:0.663134939; Z-score:4.549189725
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Brain neuroblastoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of SLC17A1 in brain neuroblastoma than that in healthy individual

Studied Phenotype

Brain neuroblastoma [ICD-11:2A00.11]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:1.22E-16; Fold-change:-0.494165435; Z-score:-2.300695929
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Brain neuroepithelial tumour

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of SLC17A1 in brain neuroepithelial tumour than that in healthy individual

Studied Phenotype

Brain neuroepithelial tumour [ICD-11:2A00.2Y]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:4.48E-11; Fold-change:-0.455198117; Z-score:-2.222922786
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Lymphoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of SLC17A1 in lymphoma than that in healthy individual

Studied Phenotype

Lymphoma [ICD-11:2B30]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:2.09E-09; Fold-change:-0.409403034; Z-score:-2.172968245
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Medulloblastoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of SLC17A1 in medulloblastoma than that in healthy individual

Studied Phenotype

Medulloblastoma [ICD-11:2A00.10]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:2.80E-69; Fold-change:-0.437787629; Z-score:-3.417360823
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Myxopapillary ependymoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of SLC17A1 in myxopapillary ependymoma than that in healthy individual

Studied Phenotype

Myxopapillary ependymoma [ICD-11:2A00.5]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:1.28E-18; Fold-change:-0.534586257; Z-score:-2.414801379
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Obesity

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of SLC17A1 in obesity than that in healthy individual

Studied Phenotype

Obesity [ICD-11:5B81]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:4.11E-12; Fold-change:-0.424455702; Z-score:-2.919992715
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Peripheral neuroectodermal tumour

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of SLC17A1 in peripheral neuroectodermal tumour than that in healthy individual

Studied Phenotype

Peripheral neuroectodermal tumour [ICD-11:2B52]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:8.63E-05; Fold-change:-0.359980178; Z-score:-1.510839483
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Uterine carcinosarcoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of SLC17A1 in uterine carcinosarcoma than that in healthy individual

Studied Phenotype

Uterine carcinosarcoma [ICD-11:2B5F]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:0.002467143; Fold-change:-0.349579554; Z-score:-1.451803593
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Lung cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of SLC17A1 in lung cancer than that in adjacent tissue

Studied Phenotype

Lung cancer [ICD-11:2C25]

The Methylation Level of Disease Section Compare with the Adjacent Tissue

p-value:0.000529421; Fold-change:-0.312216056; Z-score:-2.562136049
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
DT methylation level in tissue other than the diseased tissue of patients

microRNA

  Unclear Phenotype

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-335 directly targets SLC17A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-335 miRNA Mature ID miR-335-5p

miRNA Sequence

UCAAGAGCAAUAACGAAAAAUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human
References
1 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2 DNA Methylation Dynamics in Urological Tumors.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
5 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
6 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
7 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
8 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
9 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
10 Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.