Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0113 Transporter Info | ||||
| Gene Name | SLC16A9 | ||||
| Transporter Name | Monocarboxylate transporter 9 | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
Methylation |
|||||
|
Atypical teratoid rhabdoid tumor |
11 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC16A9 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
5'UTR (cg02164452) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-2.41E+00 | Statistic Test | p-value:1.23E-08; Z-score:-1.82E+00 | ||
|
Methylation in Case |
1.24E-01 (Median) | Methylation in Control | 2.98E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC16A9 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
5'UTR (cg03462556) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.60E+00 | Statistic Test | p-value:1.79E-08; Z-score:1.57E+00 | ||
|
Methylation in Case |
8.35E-01 (Median) | Methylation in Control | 5.22E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC16A9 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
5'UTR (cg04215870) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.33E+00 | Statistic Test | p-value:2.77E-08; Z-score:1.62E+00 | ||
|
Methylation in Case |
8.26E-01 (Median) | Methylation in Control | 6.23E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC16A9 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
5'UTR (cg04605148) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:3.50E-08; Z-score:-1.37E+00 | ||
|
Methylation in Case |
6.71E-01 (Median) | Methylation in Control | 7.36E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC16A9 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
5'UTR (cg04882188) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.22E+00 | Statistic Test | p-value:4.06E-08; Z-score:-8.82E-01 | ||
|
Methylation in Case |
4.38E-01 (Median) | Methylation in Control | 5.36E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC16A9 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
5'UTR (cg06578117) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.33E+00 | Statistic Test | p-value:6.34E-08; Z-score:-1.12E+00 | ||
|
Methylation in Case |
4.01E-01 (Median) | Methylation in Control | 5.31E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC16A9 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
5'UTR (cg19880462) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.12E+00 | Statistic Test | p-value:3.61E-06; Z-score:1.23E+00 | ||
|
Methylation in Case |
8.58E-01 (Median) | Methylation in Control | 7.69E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC16A9 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
5'UTR (cg22544571) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.16E+00 | Statistic Test | p-value:6.07E-06; Z-score:1.65E+00 | ||
|
Methylation in Case |
8.48E-01 (Median) | Methylation in Control | 7.32E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC16A9 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
5'UTR (cg24969942) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.11E+00 | Statistic Test | p-value:8.67E-06; Z-score:-1.03E+00 | ||
|
Methylation in Case |
6.49E-01 (Median) | Methylation in Control | 7.21E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC16A9 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg08535112) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.09E+00 | Statistic Test | p-value:7.26E-03; Z-score:4.22E-01 | ||
|
Methylation in Case |
1.39E-01 (Median) | Methylation in Control | 1.27E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC16A9 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
3'UTR (cg03227481) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.20E+00 | Statistic Test | p-value:7.61E-15; Z-score:-2.69E+00 | ||
|
Methylation in Case |
7.57E-01 (Median) | Methylation in Control | 9.08E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Bladder cancer |
8 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC16A9 in bladder cancer | [ 2 ] | |||
|
Location |
5'UTR (cg19880462) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-2.03E+00 | Statistic Test | p-value:5.93E-09; Z-score:-7.25E+00 | ||
|
Methylation in Case |
1.47E-01 (Median) | Methylation in Control | 2.99E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC16A9 in bladder cancer | [ 2 ] | |||
|
Location |
5'UTR (cg04605148) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.39E+00 | Statistic Test | p-value:3.30E-07; Z-score:-6.74E+00 | ||
|
Methylation in Case |
5.65E-01 (Median) | Methylation in Control | 7.85E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC16A9 in bladder cancer | [ 2 ] | |||
|
Location |
5'UTR (cg22544571) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.38E+00 | Statistic Test | p-value:2.56E-05; Z-score:-4.25E+00 | ||
|
Methylation in Case |
5.59E-01 (Median) | Methylation in Control | 7.70E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC16A9 in bladder cancer | [ 2 ] | |||
|
Location |
5'UTR (cg04882188) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-2.03E+00 | Statistic Test | p-value:3.19E-03; Z-score:-3.08E+00 | ||
|
Methylation in Case |
8.01E-02 (Median) | Methylation in Control | 1.62E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC16A9 in bladder cancer | [ 2 ] | |||
|
Location |
5'UTR (cg24969942) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-2.13E+00 | Statistic Test | p-value:2.90E-02; Z-score:-1.74E+00 | ||
|
Methylation in Case |
1.77E-02 (Median) | Methylation in Control | 3.77E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC16A9 in bladder cancer | [ 2 ] | |||
|
Location |
TSS1500 (cg00219151) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.11E+00 | Statistic Test | p-value:2.25E-03; Z-score:2.76E+00 | ||
|
Methylation in Case |
9.01E-01 (Median) | Methylation in Control | 8.11E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC16A9 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg08535112) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.29E+00 | Statistic Test | p-value:3.77E-06; Z-score:-5.35E+00 | ||
|
Methylation in Case |
6.17E-01 (Median) | Methylation in Control | 7.96E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC16A9 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg24603972) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.30E+00 | Statistic Test | p-value:2.27E-04; Z-score:-5.22E+00 | ||
|
Methylation in Case |
6.07E-01 (Median) | Methylation in Control | 7.87E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Breast cancer |
13 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC16A9 in breast cancer | [ 3 ] | |||
|
Location |
5'UTR (cg04605148) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:2.01E-07; Z-score:-1.21E+00 | ||
|
Methylation in Case |
8.01E-01 (Median) | Methylation in Control | 8.49E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC16A9 in breast cancer | [ 3 ] | |||
|
Location |
5'UTR (cg19880462) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.29E+00 | Statistic Test | p-value:5.37E-07; Z-score:-1.54E+00 | ||
|
Methylation in Case |
2.34E-01 (Median) | Methylation in Control | 3.03E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC16A9 in breast cancer | [ 3 ] | |||
|
Location |
5'UTR (cg04882188) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.44E+00 | Statistic Test | p-value:9.91E-06; Z-score:-1.81E+00 | ||
|
Methylation in Case |
1.21E-01 (Median) | Methylation in Control | 1.74E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC16A9 in breast cancer | [ 3 ] | |||
|
Location |
5'UTR (cg03462556) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.39E-04; Z-score:-6.57E-01 | ||
|
Methylation in Case |
9.02E-01 (Median) | Methylation in Control | 9.14E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC16A9 in breast cancer | [ 3 ] | |||
|
Location |
5'UTR (cg22544571) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.09E+00 | Statistic Test | p-value:1.79E-03; Z-score:6.94E-01 | ||
|
Methylation in Case |
7.21E-01 (Median) | Methylation in Control | 6.61E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC16A9 in breast cancer | [ 3 ] | |||
|
Location |
5'UTR (cg24969942) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.21E+00 | Statistic Test | p-value:6.07E-03; Z-score:3.01E-01 | ||
|
Methylation in Case |
2.42E-02 (Median) | Methylation in Control | 2.00E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC16A9 in breast cancer | [ 3 ] | |||
|
Location |
5'UTR (cg06578117) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.11E+00 | Statistic Test | p-value:1.60E-02; Z-score:-6.68E-01 | ||
|
Methylation in Case |
7.04E-01 (Median) | Methylation in Control | 7.84E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC16A9 in breast cancer | [ 3 ] | |||
|
Location |
TSS1500 (cg00219151) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:5.53E-04; Z-score:9.50E-01 | ||
|
Methylation in Case |
8.90E-01 (Median) | Methylation in Control | 8.63E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC16A9 in breast cancer | [ 3 ] | |||
|
Location |
TSS1500 (cg20156450) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.02E+00 | Statistic Test | p-value:3.90E-02; Z-score:5.74E-01 | ||
|
Methylation in Case |
3.51E-02 (Median) | Methylation in Control | 1.74E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC16A9 in breast cancer | [ 3 ] | |||
|
Location |
TSS200 (cg16430909) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.19E+00 | Statistic Test | p-value:1.23E-02; Z-score:5.24E-01 | ||
|
Methylation in Case |
3.16E-02 (Median) | Methylation in Control | 2.65E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC16A9 in breast cancer | [ 3 ] | |||
|
Location |
TSS200 (cg06373764) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.15E+00 | Statistic Test | p-value:1.37E-02; Z-score:3.40E-01 | ||
|
Methylation in Case |
1.62E-02 (Median) | Methylation in Control | 1.41E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC16A9 in breast cancer | [ 3 ] | |||
|
Location |
TSS200 (cg20627835) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.33E+00 | Statistic Test | p-value:4.71E-02; Z-score:6.77E-01 | ||
|
Methylation in Case |
3.59E-02 (Median) | Methylation in Control | 2.70E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC16A9 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg08535112) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.07E+00 | Statistic Test | p-value:4.18E-02; Z-score:-3.64E-01 | ||
|
Methylation in Case |
7.07E-01 (Median) | Methylation in Control | 7.55E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Renal cell carcinoma |
10 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC16A9 in clear cell renal cell carcinoma | [ 4 ] | |||
|
Location |
5'UTR (cg22544571) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.11E+00 | Statistic Test | p-value:5.49E-05; Z-score:-1.98E+00 | ||
|
Methylation in Case |
7.47E-01 (Median) | Methylation in Control | 8.27E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC16A9 in clear cell renal cell carcinoma | [ 4 ] | |||
|
Location |
5'UTR (cg02164452) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.18E+00 | Statistic Test | p-value:4.09E-03; Z-score:5.47E-01 | ||
|
Methylation in Case |
4.03E-02 (Median) | Methylation in Control | 3.41E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC16A9 in clear cell renal cell carcinoma | [ 4 ] | |||
|
Location |
5'UTR (cg04215870) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.12E+00 | Statistic Test | p-value:5.52E-03; Z-score:6.16E-01 | ||
|
Methylation in Case |
4.05E-02 (Median) | Methylation in Control | 3.63E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC16A9 in clear cell renal cell carcinoma | [ 4 ] | |||
|
Location |
5'UTR (cg24969942) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.19E+00 | Statistic Test | p-value:2.11E-02; Z-score:4.13E-01 | ||
|
Methylation in Case |
2.11E-02 (Median) | Methylation in Control | 1.77E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC16A9 in clear cell renal cell carcinoma | [ 4 ] | |||
|
Location |
TSS1500 (cg00219151) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.23E+00 | Statistic Test | p-value:3.64E-14; Z-score:3.15E+00 | ||
|
Methylation in Case |
9.70E-01 (Median) | Methylation in Control | 7.88E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC16A9 in clear cell renal cell carcinoma | [ 4 ] | |||
|
Location |
TSS1500 (cg20156450) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.13E+00 | Statistic Test | p-value:3.05E-03; Z-score:9.76E-01 | ||
|
Methylation in Case |
2.68E-02 (Median) | Methylation in Control | 2.38E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC16A9 in clear cell renal cell carcinoma | [ 4 ] | |||
|
Location |
TSS200 (cg06373764) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.06E+00 | Statistic Test | p-value:3.29E-04; Z-score:4.59E-01 | ||
|
Methylation in Case |
1.67E-02 (Median) | Methylation in Control | 1.58E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC16A9 in clear cell renal cell carcinoma | [ 4 ] | |||
|
Location |
TSS200 (cg16430909) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.12E+00 | Statistic Test | p-value:4.33E-03; Z-score:7.18E-01 | ||
|
Methylation in Case |
1.99E-02 (Median) | Methylation in Control | 1.78E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC16A9 in clear cell renal cell carcinoma | [ 4 ] | |||
|
Location |
TSS200 (cg20627835) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:4.38E-03; Z-score:1.45E-01 | ||
|
Methylation in Case |
2.35E-02 (Median) | Methylation in Control | 2.31E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC16A9 in clear cell renal cell carcinoma | [ 4 ] | |||
|
Location |
TSS200 (cg27346088) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.08E+00 | Statistic Test | p-value:2.76E-02; Z-score:3.14E-01 | ||
|
Methylation in Case |
7.05E-02 (Median) | Methylation in Control | 6.55E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colorectal cancer |
11 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC16A9 in colorectal cancer | [ 5 ] | |||
|
Location |
5'UTR (cg06578117) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:9.24E-03; Z-score:-4.01E-01 | ||
|
Methylation in Case |
8.74E-01 (Median) | Methylation in Control | 8.86E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC16A9 in colorectal cancer | [ 5 ] | |||
|
Location |
5'UTR (cg02164452) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.09E+00 | Statistic Test | p-value:1.67E-02; Z-score:1.78E-01 | ||
|
Methylation in Case |
4.88E-02 (Median) | Methylation in Control | 4.47E-02 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC16A9 in colorectal cancer | [ 5 ] | |||
|
Location |
5'UTR (cg24969942) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:2.02E-02; Z-score:-1.27E-03 | ||
|
Methylation in Case |
2.14E-02 (Median) | Methylation in Control | 2.15E-02 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC16A9 in colorectal cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg20156450) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.06E+00 | Statistic Test | p-value:4.32E-02; Z-score:9.64E-02 | ||
|
Methylation in Case |
2.32E-02 (Median) | Methylation in Control | 2.19E-02 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC16A9 in colorectal cancer | [ 5 ] | |||
|
Location |
TSS200 (cg27346088) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.29E+00 | Statistic Test | p-value:3.94E-05; Z-score:1.37E+00 | ||
|
Methylation in Case |
7.54E-02 (Median) | Methylation in Control | 5.83E-02 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC16A9 in colorectal cancer | [ 5 ] | |||
|
Location |
TSS200 (cg20627835) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.30E+00 | Statistic Test | p-value:1.49E-02; Z-score:7.04E-01 | ||
|
Methylation in Case |
2.19E-02 (Median) | Methylation in Control | 1.69E-02 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC16A9 in colorectal cancer | [ 5 ] | |||
|
Location |
TSS200 (cg06373764) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.11E+00 | Statistic Test | p-value:1.81E-02; Z-score:3.05E-01 | ||
|
Methylation in Case |
1.61E-02 (Median) | Methylation in Control | 1.44E-02 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC16A9 in colorectal cancer | [ 5 ] | |||
|
Location |
TSS200 (cg20193173) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:2.76E-02; Z-score:3.71E-01 | ||
|
Methylation in Case |
8.42E-02 (Median) | Methylation in Control | 7.98E-02 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC16A9 in colorectal cancer | [ 5 ] | |||
|
Location |
TSS200 (cg12583927) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.18E+00 | Statistic Test | p-value:4.42E-02; Z-score:5.23E-01 | ||
|
Methylation in Case |
3.91E-02 (Median) | Methylation in Control | 3.32E-02 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC16A9 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg08535112) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:1.32E-06; Z-score:-2.31E+00 | ||
|
Methylation in Case |
7.99E-01 (Median) | Methylation in Control | 8.66E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Hepatocellular carcinoma |
15 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC16A9 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
5'UTR (cg24969942) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:3.31E+00 | Statistic Test | p-value:2.12E-08; Z-score:4.63E+00 | ||
|
Methylation in Case |
2.40E-01 (Median) | Methylation in Control | 7.26E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC16A9 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
5'UTR (cg04605148) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.07E+00 | Statistic Test | p-value:2.93E-08; Z-score:-9.40E-01 | ||
|
Methylation in Case |
7.28E-01 (Median) | Methylation in Control | 7.81E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC16A9 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
5'UTR (cg02164452) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.20E+00 | Statistic Test | p-value:1.10E-07; Z-score:3.49E+00 | ||
|
Methylation in Case |
2.33E-01 (Median) | Methylation in Control | 1.06E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC16A9 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
5'UTR (cg03462556) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:1.39E-06; Z-score:-2.20E+00 | ||
|
Methylation in Case |
8.44E-01 (Median) | Methylation in Control | 8.86E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC16A9 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
5'UTR (cg04215870) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:2.56E-02; Z-score:1.65E-01 | ||
|
Methylation in Case |
7.76E-02 (Median) | Methylation in Control | 7.55E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC16A9 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
TSS1500 (cg20156450) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.07E+00 | Statistic Test | p-value:6.10E-04; Z-score:-1.23E-01 | ||
|
Methylation in Case |
3.69E-02 (Median) | Methylation in Control | 3.94E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC16A9 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
TSS1500 (cg00219151) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:8.81E-03; Z-score:-2.36E-01 | ||
|
Methylation in Case |
8.79E-01 (Median) | Methylation in Control | 8.83E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC16A9 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
TSS200 (cg16430909) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.09E+00 | Statistic Test | p-value:4.05E-04; Z-score:1.89E-01 | ||
|
Methylation in Case |
4.28E-02 (Median) | Methylation in Control | 3.91E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC16A9 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
TSS200 (cg06373764) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:1.64E-03; Z-score:3.78E-02 | ||
|
Methylation in Case |
3.37E-02 (Median) | Methylation in Control | 3.30E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC16A9 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
TSS200 (cg27346088) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.09E+00 | Statistic Test | p-value:2.45E-03; Z-score:2.66E-01 | ||
|
Methylation in Case |
8.95E-02 (Median) | Methylation in Control | 8.21E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC16A9 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg12570419) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.49E+00 | Statistic Test | p-value:1.70E-18; Z-score:-3.87E+00 | ||
|
Methylation in Case |
4.81E-01 (Median) | Methylation in Control | 7.17E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC16A9 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg01272393) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.52E+00 | Statistic Test | p-value:6.36E-16; Z-score:-4.95E+00 | ||
|
Methylation in Case |
5.13E-01 (Median) | Methylation in Control | 7.81E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC16A9 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg23603573) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.16E+00 | Statistic Test | p-value:3.11E-10; Z-score:-3.22E+00 | ||
|
Methylation in Case |
7.31E-01 (Median) | Methylation in Control | 8.47E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of SLC16A9 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg24603972) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:5.54E-04; Z-score:-3.51E-01 | ||
|
Methylation in Case |
8.18E-01 (Median) | Methylation in Control | 8.57E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of SLC16A9 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
3'UTR (cg03227481) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:3.30E-08; Z-score:-1.17E+00 | ||
|
Methylation in Case |
8.22E-01 (Median) | Methylation in Control | 8.72E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
HIV infection |
12 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC16A9 in HIV infection | [ 7 ] | |||
|
Location |
5'UTR (cg24969942) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:3.37E+00 | Statistic Test | p-value:1.25E-04; Z-score:1.91E+00 | ||
|
Methylation in Case |
4.36E-02 (Median) | Methylation in Control | 1.29E-02 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC16A9 in HIV infection | [ 7 ] | |||
|
Location |
5'UTR (cg02164452) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.55E+00 | Statistic Test | p-value:2.55E-04; Z-score:1.84E+00 | ||
|
Methylation in Case |
7.69E-02 (Median) | Methylation in Control | 4.97E-02 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC16A9 in HIV infection | [ 7 ] | |||
|
Location |
5'UTR (cg04882188) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.21E+00 | Statistic Test | p-value:9.30E-04; Z-score:1.06E+00 | ||
|
Methylation in Case |
9.10E-02 (Median) | Methylation in Control | 7.49E-02 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC16A9 in HIV infection | [ 7 ] | |||
|
Location |
5'UTR (cg06578117) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:1.87E-03; Z-score:-1.31E+00 | ||
|
Methylation in Case |
8.20E-01 (Median) | Methylation in Control | 8.61E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC16A9 in HIV infection | [ 7 ] | |||
|
Location |
5'UTR (cg04215870) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.19E+00 | Statistic Test | p-value:7.21E-03; Z-score:9.78E-01 | ||
|
Methylation in Case |
9.43E-02 (Median) | Methylation in Control | 7.94E-02 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC16A9 in HIV infection | [ 7 ] | |||
|
Location |
5'UTR (cg19880462) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.12E+00 | Statistic Test | p-value:1.34E-02; Z-score:7.64E-01 | ||
|
Methylation in Case |
1.96E-01 (Median) | Methylation in Control | 1.75E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC16A9 in HIV infection | [ 7 ] | |||
|
Location |
TSS1500 (cg10845249) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.16E+00 | Statistic Test | p-value:1.23E-02; Z-score:6.83E-01 | ||
|
Methylation in Case |
1.35E-01 (Median) | Methylation in Control | 1.16E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC16A9 in HIV infection | [ 7 ] | |||
|
Location |
TSS1500 (cg20156450) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.29E+00 | Statistic Test | p-value:1.37E-02; Z-score:7.40E-01 | ||
|
Methylation in Case |
5.98E-02 (Median) | Methylation in Control | 4.64E-02 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC16A9 in HIV infection | [ 7 ] | |||
|
Location |
TSS200 (cg16430909) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.43E+00 | Statistic Test | p-value:2.34E-02; Z-score:4.93E-01 | ||
|
Methylation in Case |
1.92E-02 (Median) | Methylation in Control | 1.35E-02 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC16A9 in HIV infection | [ 7 ] | |||
|
Location |
TSS200 (cg06373764) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.81E+00 | Statistic Test | p-value:2.58E-02; Z-score:5.60E-01 | ||
|
Methylation in Case |
2.18E-02 (Median) | Methylation in Control | 1.20E-02 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC16A9 in HIV infection | [ 7 ] | |||
|
Location |
TSS200 (cg27346088) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.10E+00 | Statistic Test | p-value:4.93E-02; Z-score:4.79E-01 | ||
|
Methylation in Case |
1.08E-01 (Median) | Methylation in Control | 9.80E-02 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC16A9 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg08535112) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.12E+00 | Statistic Test | p-value:1.83E-06; Z-score:-1.94E+00 | ||
|
Methylation in Case |
7.26E-01 (Median) | Methylation in Control | 8.11E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Lung adenocarcinoma |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC16A9 in lung adenocarcinoma | [ 8 ] | |||
|
Location |
5'UTR (cg22544571) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.07E+00 | Statistic Test | p-value:4.18E-02; Z-score:1.07E+00 | ||
|
Methylation in Case |
7.61E-01 (Median) | Methylation in Control | 7.08E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC16A9 in lung adenocarcinoma | [ 8 ] | |||
|
Location |
TSS1500 (cg10845249) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.23E+00 | Statistic Test | p-value:3.60E-03; Z-score:2.14E+00 | ||
|
Methylation in Case |
1.84E-01 (Median) | Methylation in Control | 1.50E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC16A9 in lung adenocarcinoma | [ 8 ] | |||
|
Location |
3'UTR (cg03227481) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:7.93E-03; Z-score:1.40E+00 | ||
|
Methylation in Case |
8.87E-01 (Median) | Methylation in Control | 8.46E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Pancretic ductal adenocarcinoma |
13 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC16A9 in pancretic ductal adenocarcinoma | [ 9 ] | |||
|
Location |
5'UTR (cg01393327) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.11E+00 | Statistic Test | p-value:1.73E-02; Z-score:-1.66E-01 | ||
|
Methylation in Case |
1.52E-01 (Median) | Methylation in Control | 1.68E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC16A9 in pancretic ductal adenocarcinoma | [ 9 ] | |||
|
Location |
TSS1500 (cg11735997) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.46E+00 | Statistic Test | p-value:7.09E-21; Z-score:3.38E+00 | ||
|
Methylation in Case |
4.65E-01 (Median) | Methylation in Control | 3.19E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC16A9 in pancretic ductal adenocarcinoma | [ 9 ] | |||
|
Location |
TSS1500 (cg04675747) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.37E+00 | Statistic Test | p-value:1.92E-09; Z-score:-1.63E+00 | ||
|
Methylation in Case |
3.77E-01 (Median) | Methylation in Control | 5.17E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC16A9 in pancretic ductal adenocarcinoma | [ 9 ] | |||
|
Location |
TSS1500 (cg08731720) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:2.81E-03; Z-score:-5.28E-01 | ||
|
Methylation in Case |
4.04E-02 (Median) | Methylation in Control | 4.45E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC16A9 in pancretic ductal adenocarcinoma | [ 9 ] | |||
|
Location |
TSS1500 (cg22995232) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.17E+00 | Statistic Test | p-value:1.94E-02; Z-score:6.50E-01 | ||
|
Methylation in Case |
5.03E-01 (Median) | Methylation in Control | 4.29E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC16A9 in pancretic ductal adenocarcinoma | [ 9 ] | |||
|
Location |
TSS200 (cg03940556) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.32E+00 | Statistic Test | p-value:1.19E-06; Z-score:-1.28E+00 | ||
|
Methylation in Case |
1.16E-01 (Median) | Methylation in Control | 1.53E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC16A9 in pancretic ductal adenocarcinoma | [ 9 ] | |||
|
Location |
TSS200 (cg04670913) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.27E+00 | Statistic Test | p-value:1.60E-04; Z-score:-6.69E-01 | ||
|
Methylation in Case |
9.42E-02 (Median) | Methylation in Control | 1.20E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC16A9 in pancretic ductal adenocarcinoma | [ 9 ] | |||
|
Location |
TSS200 (cg11264635) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.09E+00 | Statistic Test | p-value:1.09E-03; Z-score:1.05E+00 | ||
|
Methylation in Case |
7.33E-01 (Median) | Methylation in Control | 6.73E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC16A9 in pancretic ductal adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg08758174) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.12E+00 | Statistic Test | p-value:1.90E-05; Z-score:1.35E+00 | ||
|
Methylation in Case |
8.42E-01 (Median) | Methylation in Control | 7.53E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC16A9 in pancretic ductal adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg25518170) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.16E+00 | Statistic Test | p-value:3.33E-03; Z-score:1.08E+00 | ||
|
Methylation in Case |
7.14E-01 (Median) | Methylation in Control | 6.15E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC16A9 in pancretic ductal adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg07489029) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.11E+00 | Statistic Test | p-value:4.61E-03; Z-score:7.01E-01 | ||
|
Methylation in Case |
8.14E-01 (Median) | Methylation in Control | 7.36E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC16A9 in pancretic ductal adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg17451688) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:2.31E-02; Z-score:8.10E-01 | ||
|
Methylation in Case |
8.84E-01 (Median) | Methylation in Control | 8.56E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC16A9 in pancretic ductal adenocarcinoma | [ 9 ] | |||
|
Location |
3'UTR (cg10277956) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:1.80E-15; Z-score:-2.09E+00 | ||
|
Methylation in Case |
7.38E-01 (Median) | Methylation in Control | 8.12E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Panic disorder |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC16A9 in panic disorder | [ 10 ] | |||
|
Location |
5'UTR (cg04605148) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-6.90E-01 | Statistic Test | p-value:2.83E-02; Z-score:-5.31E-01 | ||
|
Methylation in Case |
-5.11E-01 (Median) | Methylation in Control | -3.52E-01 (Median) | ||
|
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC16A9 in panic disorder | [ 10 ] | |||
|
Location |
5'UTR (cg02164452) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:9.78E-01 | Statistic Test | p-value:3.92E-02; Z-score:3.78E-01 | ||
|
Methylation in Case |
-5.10E+00 (Median) | Methylation in Control | -5.22E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Papillary thyroid cancer |
6 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC16A9 in papillary thyroid cancer | [ 11 ] | |||
|
Location |
5'UTR (cg04882188) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.09E+00 | Statistic Test | p-value:3.64E-03; Z-score:4.61E-01 | ||
|
Methylation in Case |
9.45E-02 (Median) | Methylation in Control | 8.69E-02 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC16A9 in papillary thyroid cancer | [ 11 ] | |||
|
Location |
5'UTR (cg24969942) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.09E+00 | Statistic Test | p-value:7.01E-03; Z-score:4.14E-01 | ||
|
Methylation in Case |
5.96E-02 (Median) | Methylation in Control | 5.46E-02 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC16A9 in papillary thyroid cancer | [ 11 ] | |||
|
Location |
TSS1500 (cg00219151) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:1.93E-03; Z-score:6.51E-01 | ||
|
Methylation in Case |
9.44E-01 (Median) | Methylation in Control | 9.36E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC16A9 in papillary thyroid cancer | [ 11 ] | |||
|
Location |
TSS200 (cg20627835) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.12E+00 | Statistic Test | p-value:3.84E-06; Z-score:1.19E+00 | ||
|
Methylation in Case |
6.86E-02 (Median) | Methylation in Control | 6.14E-02 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC16A9 in papillary thyroid cancer | [ 11 ] | |||
|
Location |
Body (cg24603972) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:1.52E-10; Z-score:-1.98E+00 | ||
|
Methylation in Case |
8.70E-01 (Median) | Methylation in Control | 9.19E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC16A9 in papillary thyroid cancer | [ 11 ] | |||
|
Location |
Body (cg08535112) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:2.38E-02; Z-score:-1.54E-01 | ||
|
Methylation in Case |
8.71E-01 (Median) | Methylation in Control | 8.77E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colon cancer |
10 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC16A9 in colon adenocarcinoma | [ 12 ] | |||
|
Location |
TSS1500 (cg22434409) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.13E+00 | Statistic Test | p-value:1.99E-09; Z-score:4.37E+00 | ||
|
Methylation in Case |
7.32E-01 (Median) | Methylation in Control | 3.44E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC16A9 in colon adenocarcinoma | [ 12 ] | |||
|
Location |
TSS1500 (cg22505977) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.41E+00 | Statistic Test | p-value:2.27E-05; Z-score:-2.38E+00 | ||
|
Methylation in Case |
4.02E-01 (Median) | Methylation in Control | 5.68E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC16A9 in colon adenocarcinoma | [ 12 ] | |||
|
Location |
TSS1500 (cg08390254) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.17E+00 | Statistic Test | p-value:8.07E-05; Z-score:-2.43E+00 | ||
|
Methylation in Case |
5.47E-01 (Median) | Methylation in Control | 6.39E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC16A9 in colon adenocarcinoma | [ 12 ] | |||
|
Location |
TSS1500 (cg07041488) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.26E+00 | Statistic Test | p-value:8.64E-04; Z-score:-2.12E+00 | ||
|
Methylation in Case |
5.42E-01 (Median) | Methylation in Control | 6.83E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC16A9 in colon adenocarcinoma | [ 12 ] | |||
|
Location |
TSS1500 (cg14830815) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:4.06E-03; Z-score:-1.03E+00 | ||
|
Methylation in Case |
3.73E-01 (Median) | Methylation in Control | 4.02E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC16A9 in colon adenocarcinoma | [ 12 ] | |||
|
Location |
1stExon (cg13958974) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.22E+00 | Statistic Test | p-value:4.94E-04; Z-score:1.78E+00 | ||
|
Methylation in Case |
4.56E-01 (Median) | Methylation in Control | 3.75E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC16A9 in colon adenocarcinoma | [ 12 ] | |||
|
Location |
Body (cg05554939) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.06E+00 | Statistic Test | p-value:6.62E-04; Z-score:1.23E+00 | ||
|
Methylation in Case |
8.21E-01 (Median) | Methylation in Control | 7.77E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC16A9 in colon adenocarcinoma | [ 12 ] | |||
|
Location |
Body (cg26929806) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.11E+00 | Statistic Test | p-value:6.84E-04; Z-score:-2.51E+00 | ||
|
Methylation in Case |
7.13E-01 (Median) | Methylation in Control | 7.89E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC16A9 in colon adenocarcinoma | [ 12 ] | |||
|
Location |
Body (cg00244747) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.12E+00 | Statistic Test | p-value:6.90E-04; Z-score:-2.23E+00 | ||
|
Methylation in Case |
6.47E-01 (Median) | Methylation in Control | 7.23E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC16A9 in colon adenocarcinoma | [ 12 ] | |||
|
Location |
Body (cg06577241) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.28E+00 | Statistic Test | p-value:3.15E-03; Z-score:1.60E+00 | ||
|
Methylation in Case |
2.20E-01 (Median) | Methylation in Control | 1.72E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Depression |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC16A9 in depression | [ 13 ] | |||
|
Location |
TSS200 (cg20627835) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.10E+00 | Statistic Test | p-value:3.62E-04; Z-score:7.30E-01 | ||
|
Methylation in Case |
6.89E-02 (Median) | Methylation in Control | 6.25E-02 (Median) | ||
|
Studied Phenotype |
Depression[ ICD-11:6A8Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
microRNA |
|||||
|
Unclear Phenotype |
65 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
let-7a directly targets SLC16A9 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
let-7a | miRNA Mature ID | let-7a-5p | ||
|
miRNA Sequence |
UGAGGUAGUAGGUUGUAUAGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon2 |
let-7b directly targets SLC16A9 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
let-7b | miRNA Mature ID | let-7b-5p | ||
|
miRNA Sequence |
UGAGGUAGUAGGUUGUGUGGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon3 |
let-7c directly targets SLC16A9 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
let-7c | miRNA Mature ID | let-7c-5p | ||
|
miRNA Sequence |
UGAGGUAGUAGGUUGUAUGGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon4 |
let-7d directly targets SLC16A9 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
let-7d | miRNA Mature ID | let-7d-5p | ||
|
miRNA Sequence |
AGAGGUAGUAGGUUGCAUAGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon5 |
let-7e directly targets SLC16A9 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
let-7e | miRNA Mature ID | let-7e-5p | ||
|
miRNA Sequence |
UGAGGUAGGAGGUUGUAUAGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon6 |
let-7f directly targets SLC16A9 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
let-7f | miRNA Mature ID | let-7f-5p | ||
|
miRNA Sequence |
UGAGGUAGUAGAUUGUAUAGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon7 |
let-7g directly targets SLC16A9 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
let-7g | miRNA Mature ID | let-7g-5p | ||
|
miRNA Sequence |
UGAGGUAGUAGUUUGUACAGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon8 |
let-7i directly targets SLC16A9 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
let-7i | miRNA Mature ID | let-7i-5p | ||
|
miRNA Sequence |
UGAGGUAGUAGUUUGUGCUGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon9 |
miR-1-3p directly targets SLC16A9 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
|
miRNA Stemloop ID |
miR-1-3p | miRNA Mature ID | miR-1-3p | ||
|
miRNA Sequence |
UGGAAUGUAAAGAAGUAUGUAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
|
Epigenetic Phenomenon10 |
miR-106b directly targets SLC16A9 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-106b | miRNA Mature ID | miR-106b-5p | ||
|
miRNA Sequence |
UAAAGUGCUGACAGUGCAGAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon11 |
miR-1294 directly targets SLC16A9 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1294 | miRNA Mature ID | miR-1294 | ||
|
miRNA Sequence |
UGUGAGGUUGGCAUUGUUGUCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon12 |
miR-153 directly targets SLC16A9 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-153 | miRNA Mature ID | miR-153-3p | ||
|
miRNA Sequence |
UUGCAUAGUCACAAAAGUGAUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Left ventricular cardiac tissues of human | ||||
|
Epigenetic Phenomenon13 |
miR-17 directly targets SLC16A9 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-17 | miRNA Mature ID | miR-17-5p | ||
|
miRNA Sequence |
CAAAGUGCUUACAGUGCAGGUAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon14 |
miR-18a directly targets SLC16A9 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-18a | miRNA Mature ID | miR-18a-3p | ||
|
miRNA Sequence |
ACUGCCCUAAGUGCUCCUUCUGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon15 |
miR-1913 directly targets SLC16A9 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-1913 | miRNA Mature ID | miR-1913 | ||
|
miRNA Sequence |
UCUGCCCCCUCCGCUGCUGCCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon16 |
miR-194 directly targets SLC16A9 | [ 19 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
|
miRNA Stemloop ID |
miR-194 | miRNA Mature ID | miR-194-5p | ||
|
miRNA Sequence |
UGUAACAGCAACUCCAUGUGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon17 |
miR-202 directly targets SLC16A9 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-202 | miRNA Mature ID | miR-202-3p | ||
|
miRNA Sequence |
AGAGGUAUAGGGCAUGGGAA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon18 |
miR-20a directly targets SLC16A9 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-20a | miRNA Mature ID | miR-20a-5p | ||
|
miRNA Sequence |
UAAAGUGCUUAUAGUGCAGGUAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon19 |
miR-20b directly targets SLC16A9 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-20b | miRNA Mature ID | miR-20b-5p | ||
|
miRNA Sequence |
CAAAGUGCUCAUAGUGCAGGUAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon20 |
miR-2114 directly targets SLC16A9 | [ 20 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-2114 | miRNA Mature ID | miR-2114-5p | ||
|
miRNA Sequence |
UAGUCCCUUCCUUGAAGCGGUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon21 |
miR-31 directly targets SLC16A9 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-31 | miRNA Mature ID | miR-31-3p | ||
|
miRNA Sequence |
UGCUAUGCCAACAUAUUGCCAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon22 |
miR-3120 directly targets SLC16A9 | [ 20 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3120 | miRNA Mature ID | miR-3120-3p | ||
|
miRNA Sequence |
CACAGCAAGUGUAGACAGGCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon23 |
miR-3121 directly targets SLC16A9 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3121 | miRNA Mature ID | miR-3121-3p | ||
|
miRNA Sequence |
UAAAUAGAGUAGGCAAAGGACA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon24 |
miR-3166 directly targets SLC16A9 | [ 20 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3166 | miRNA Mature ID | miR-3166 | ||
|
miRNA Sequence |
CGCAGACAAUGCCUACUGGCCUA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon25 |
miR-324 directly targets SLC16A9 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-324 | miRNA Mature ID | miR-324-3p | ||
|
miRNA Sequence |
CCCACUGCCCCAGGUGCUGCUGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon26 |
miR-3606 directly targets SLC16A9 | [ 20 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3606 | miRNA Mature ID | miR-3606-5p | ||
|
miRNA Sequence |
UUAGUGAAGGCUAUUUUAAUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon27 |
miR-3658 directly targets SLC16A9 | [ 20 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3658 | miRNA Mature ID | miR-3658 | ||
|
miRNA Sequence |
UUUAAGAAAACACCAUGGAGAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon28 |
miR-374b directly targets SLC16A9 | [ 20 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-374b | miRNA Mature ID | miR-374b-3p | ||
|
miRNA Sequence |
CUUAGCAGGUUGUAUUAUCAUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon29 |
miR-378a directly targets SLC16A9 | [ 19 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
|
miRNA Stemloop ID |
miR-378a | miRNA Mature ID | miR-378a-5p | ||
|
miRNA Sequence |
CUCCUGACUCCAGGUCCUGUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon30 |
miR-4276 directly targets SLC16A9 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4276 | miRNA Mature ID | miR-4276 | ||
|
miRNA Sequence |
CUCAGUGACUCAUGUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon31 |
miR-4458 directly targets SLC16A9 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4458 | miRNA Mature ID | miR-4458 | ||
|
miRNA Sequence |
AGAGGUAGGUGUGGAAGAA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon32 |
miR-4500 directly targets SLC16A9 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4500 | miRNA Mature ID | miR-4500 | ||
|
miRNA Sequence |
UGAGGUAGUAGUUUCUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon33 |
miR-4511 directly targets SLC16A9 | [ 20 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4511 | miRNA Mature ID | miR-4511 | ||
|
miRNA Sequence |
GAAGAACUGUUGCAUUUGCCCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon34 |
miR-4522 directly targets SLC16A9 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4522 | miRNA Mature ID | miR-4522 | ||
|
miRNA Sequence |
UGACUCUGCCUGUAGGCCGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon35 |
miR-4712 directly targets SLC16A9 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4712 | miRNA Mature ID | miR-4712-3p | ||
|
miRNA Sequence |
AAUGAGAGACCUGUACUGUAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon36 |
miR-4727 directly targets SLC16A9 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4727 | miRNA Mature ID | miR-4727-5p | ||
|
miRNA Sequence |
AUCUGCCAGCUUCCACAGUGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon37 |
miR-4764 directly targets SLC16A9 | [ 20 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4764 | miRNA Mature ID | miR-4764-5p | ||
|
miRNA Sequence |
UGGAUGUGGAAGGAGUUAUCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon38 |
miR-4780 directly targets SLC16A9 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4780 | miRNA Mature ID | miR-4780 | ||
|
miRNA Sequence |
ACCCUUGAGCCUGAUCCCUAGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon39 |
miR-4798 directly targets SLC16A9 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4798 | miRNA Mature ID | miR-4798-3p | ||
|
miRNA Sequence |
AACUCACGAAGUAUACCGAAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Left ventricular cardiac tissues of human | ||||
|
Epigenetic Phenomenon40 |
miR-5001 directly targets SLC16A9 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-5001 | miRNA Mature ID | miR-5001-3p | ||
|
miRNA Sequence |
UUCUGCCUCUGUCCAGGUCCUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon41 |
miR-5190 directly targets SLC16A9 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-5190 | miRNA Mature ID | miR-5190 | ||
|
miRNA Sequence |
CCAGUGACUGAGCUGGAGCCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon42 |
miR-519d directly targets SLC16A9 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-519d | miRNA Mature ID | miR-519d-3p | ||
|
miRNA Sequence |
CAAAGUGCCUCCCUUUAGAGUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon43 |
miR-539 directly targets SLC16A9 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-539 | miRNA Mature ID | miR-539-5p | ||
|
miRNA Sequence |
GGAGAAAUUAUCCUUGGUGUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon44 |
miR-545 directly targets SLC16A9 | [ 20 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-545 | miRNA Mature ID | miR-545-3p | ||
|
miRNA Sequence |
UCAGCAAACAUUUAUUGUGUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon45 |
miR-548a directly targets SLC16A9 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-548a | miRNA Mature ID | miR-548a-3p | ||
|
miRNA Sequence |
CAAAACUGGCAAUUACUUUUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon46 |
miR-548ar directly targets SLC16A9 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-548ar | miRNA Mature ID | miR-548ar-3p | ||
|
miRNA Sequence |
UAAAACUGCAGUUAUUUUUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon47 |
miR-548az directly targets SLC16A9 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-548az | miRNA Mature ID | miR-548az-3p | ||
|
miRNA Sequence |
AAAAACUGCAAUCACUUUUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon48 |
miR-548b directly targets SLC16A9 | [ 20 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-548b | miRNA Mature ID | miR-548b-3p | ||
|
miRNA Sequence |
CAAGAACCUCAGUUGCUUUUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon49 |
miR-548e directly targets SLC16A9 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-548e | miRNA Mature ID | miR-548e-3p | ||
|
miRNA Sequence |
AAAAACUGAGACUACUUUUGCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon50 |
miR-548f directly targets SLC16A9 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-548f | miRNA Mature ID | miR-548f-3p | ||
|
miRNA Sequence |
AAAAACUGUAAUUACUUUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon51 |
miR-548p directly targets SLC16A9 | [ 20 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-548p | miRNA Mature ID | miR-548p | ||
|
miRNA Sequence |
UAGCAAAAACUGCAGUUACUUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon52 |
miR-548v directly targets SLC16A9 | [ 19 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
|
miRNA Stemloop ID |
miR-548v | miRNA Mature ID | miR-548v | ||
|
miRNA Sequence |
AGCUACAGUUACUUUUGCACCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon53 |
miR-5571 directly targets SLC16A9 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-5571 | miRNA Mature ID | miR-5571-5p | ||
|
miRNA Sequence |
CAAUUCUCAAAGGAGCCUCCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Left ventricular cardiac tissues of human | ||||
|
Epigenetic Phenomenon54 |
miR-5588 directly targets SLC16A9 | [ 20 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-5588 | miRNA Mature ID | miR-5588-3p | ||
|
miRNA Sequence |
AAGUCCCACUAAUGCCAGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon55 |
miR-5684 directly targets SLC16A9 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-5684 | miRNA Mature ID | miR-5684 | ||
|
miRNA Sequence |
AACUCUAGCCUGAGCAACAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon56 |
miR-570 directly targets SLC16A9 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-570 | miRNA Mature ID | miR-570-3p | ||
|
miRNA Sequence |
CGAAAACAGCAAUUACCUUUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon57 |
miR-582 directly targets SLC16A9 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-582 | miRNA Mature ID | miR-582-3p | ||
|
miRNA Sequence |
UAACUGGUUGAACAACUGAACC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon58 |
miR-585 directly targets SLC16A9 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-585 | miRNA Mature ID | miR-585-5p | ||
|
miRNA Sequence |
CUAGCACACAGAUACGCCCAGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Left ventricular cardiac tissues of human | ||||
|
Epigenetic Phenomenon59 |
miR-603 directly targets SLC16A9 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-603 | miRNA Mature ID | miR-603 | ||
|
miRNA Sequence |
CACACACUGCAAUUACUUUUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Left ventricular cardiac tissues of human | ||||
|
Epigenetic Phenomenon60 |
miR-6738 directly targets SLC16A9 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6738 | miRNA Mature ID | miR-6738-3p | ||
|
miRNA Sequence |
CUUCUGCCUGCAUUCUACUCCCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon61 |
miR-6886 directly targets SLC16A9 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6886 | miRNA Mature ID | miR-6886-3p | ||
|
miRNA Sequence |
UGCCCUUCUCUCCUCCUGCCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon62 |
miR-8069 directly targets SLC16A9 | [ 20 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-8069 | miRNA Mature ID | miR-8069 | ||
|
miRNA Sequence |
GGAUGGUUGGGGGCGGUCGGCGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon63 |
miR-8485 directly targets SLC16A9 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-8485 | miRNA Mature ID | miR-8485 | ||
|
miRNA Sequence |
CACACACACACACACACGUAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Left ventricular cardiac tissues of human | ||||
|
Epigenetic Phenomenon64 |
miR-938 directly targets SLC16A9 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-938 | miRNA Mature ID | miR-938 | ||
|
miRNA Sequence |
UGCCCUUAAAGGUGAACCCAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon65 |
miR-98 directly targets SLC16A9 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-98 | miRNA Mature ID | miR-98-5p | ||
|
miRNA Sequence |
UGAGGUAGUAAGUUGUAUUGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.