Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0101 Transporter Info
Gene Name	SLC16A10
Transporter Name	Monocarboxylate transporter 10
Gene ID	117247
UniProt ID	Q8TF71

Epigenetic Regulations of This DT (EGR)
Methylation
Pancretic ductal adenocarcinoma	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC16A10 in pancretic ductal adenocarcinoma			[ 1 ]
Location	5'UTR (cg14794191)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:6.04E-03; Z-score:-3.82E-01
Methylation in Case	8.55E-01 (Median)	Methylation in Control	8.66E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC16A10 in pancretic ductal adenocarcinoma			[ 1 ]
Location	TSS1500 (cg09454187)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.26E+00	Statistic Test	p-value:6.04E-05; Z-score:1.46E+00
Methylation in Case	8.08E-01 (Median)	Methylation in Control	6.39E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC16A10 in pancretic ductal adenocarcinoma			[ 1 ]
Location	Body (cg16782807)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.99E+00	Statistic Test	p-value:3.46E-12; Z-score:1.92E+00
Methylation in Case	3.68E-01 (Median)	Methylation in Control	1.85E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC16A10 in pancretic ductal adenocarcinoma			[ 1 ]
Location	Body (cg23250019)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.33E+00	Statistic Test	p-value:3.69E-08; Z-score:-1.79E+00
Methylation in Case	5.47E-01 (Median)	Methylation in Control	7.30E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC16A10 in pancretic ductal adenocarcinoma			[ 1 ]
Location	Body (cg14047153)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.29E+00	Statistic Test	p-value:1.16E-04; Z-score:-1.50E+00
Methylation in Case	7.09E-01 (Median)	Methylation in Control	9.17E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC16A10 in pancretic ductal adenocarcinoma			[ 1 ]
Location	Body (cg01551177)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.07E+00	Statistic Test	p-value:2.11E-03; Z-score:7.32E-01
Methylation in Case	7.33E-01 (Median)	Methylation in Control	6.83E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC16A10 in pancretic ductal adenocarcinoma			[ 1 ]
Location	Body (cg00378292)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.07E+00	Statistic Test	p-value:1.14E-02; Z-score:-7.36E-01
Methylation in Case	3.66E-01 (Median)	Methylation in Control	3.91E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Renal cell carcinoma	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC16A10 in clear cell renal cell carcinoma			[ 2 ]
Location	TSS1500 (cg14849782)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.22E+00	Statistic Test	p-value:5.58E-03; Z-score:9.07E-01
Methylation in Case	2.08E-02 (Median)	Methylation in Control	1.71E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC16A10 in clear cell renal cell carcinoma			[ 2 ]
Location	TSS1500 (cg15721981)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.09E+00	Statistic Test	p-value:2.29E-02; Z-score:3.51E-01
Methylation in Case	4.80E-02 (Median)	Methylation in Control	4.39E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC16A10 in clear cell renal cell carcinoma			[ 2 ]
Location	TSS200 (cg15822346)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.40E+00	Statistic Test	p-value:7.31E-05; Z-score:-1.16E+00
Methylation in Case	4.10E-02 (Median)	Methylation in Control	5.76E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC16A10 in clear cell renal cell carcinoma			[ 2 ]
Location	TSS200 (cg18588052)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.22E+00	Statistic Test	p-value:3.25E-03; Z-score:-7.08E-01
Methylation in Case	2.47E-02 (Median)	Methylation in Control	3.01E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC16A10 in clear cell renal cell carcinoma			[ 2 ]
Location	TSS200 (cg25357155)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.01E+00	Statistic Test	p-value:3.40E-02; Z-score:9.71E-02
Methylation in Case	1.24E-02 (Median)	Methylation in Control	1.22E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC16A10 in clear cell renal cell carcinoma			[ 2 ]
Location	1stExon (cg07940485)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.07E+00	Statistic Test	p-value:1.62E-06; Z-score:7.58E-01
Methylation in Case	1.45E-02 (Median)	Methylation in Control	1.36E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Colon cancer	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC16A10 in colon adenocarcinoma			[ 3 ]
Location	TSS1500 (cg07104116)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.21E+00	Statistic Test	p-value:2.71E-05; Z-score:-1.80E+00
Methylation in Case	4.84E-01 (Median)	Methylation in Control	5.85E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC16A10 in colon adenocarcinoma			[ 3 ]
Location	TSS1500 (cg06746492)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.19E+00	Statistic Test	p-value:5.29E-04; Z-score:-2.41E+00
Methylation in Case	6.44E-01 (Median)	Methylation in Control	7.65E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC16A10 in colon adenocarcinoma			[ 3 ]
Location	TSS1500 (cg10528482)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.10E+00	Statistic Test	p-value:4.98E-03; Z-score:1.46E+00
Methylation in Case	7.33E-01 (Median)	Methylation in Control	6.64E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC16A10 in colon adenocarcinoma			[ 3 ]
Location	Body (cg14495732)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.30E+00	Statistic Test	p-value:2.00E-06; Z-score:-4.80E+00
Methylation in Case	5.70E-01 (Median)	Methylation in Control	7.40E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC16A10 in colon adenocarcinoma			[ 3 ]
Location	Body (cg20438663)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.06E+00	Statistic Test	p-value:9.02E-04; Z-score:1.28E+00
Methylation in Case	7.27E-01 (Median)	Methylation in Control	6.83E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC16A10 in colon adenocarcinoma			[ 3 ]
Location	Body (cg01704999)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.13E+00	Statistic Test	p-value:3.40E-03; Z-score:1.05E+00
Methylation in Case	1.41E-01 (Median)	Methylation in Control	1.24E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC16A10 in hepatocellular carcinoma			[ 4 ]
Location	TSS1500 (cg14074641)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.38E+00	Statistic Test	p-value:7.16E-16; Z-score:-6.28E+00
Methylation in Case	5.56E-01 (Median)	Methylation in Control	7.66E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC16A10 in hepatocellular carcinoma			[ 4 ]
Location	Body (cg13463516)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.45E+00	Statistic Test	p-value:6.87E-16; Z-score:-3.47E+00
Methylation in Case	3.75E-01 (Median)	Methylation in Control	5.43E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC16A10 in hepatocellular carcinoma			[ 4 ]
Location	Body (cg05218653)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.31E+00	Statistic Test	p-value:2.41E-11; Z-score:-5.89E+00
Methylation in Case	7.42E-01 (Median)	Methylation in Control	9.69E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC16A10 in hepatocellular carcinoma			[ 4 ]
Location	Body (cg21276197)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.01E+00	Statistic Test	p-value:3.80E-02; Z-score:6.28E-02
Methylation in Case	4.67E-02 (Median)	Methylation in Control	4.62E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Panic disorder	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC16A10 in panic disorder			[ 5 ]
Location	TSS1500 (cg14849782)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:9.78E-01	Statistic Test	p-value:2.35E-02; Z-score:4.52E-01
Methylation in Case	-5.18E+00 (Median)	Methylation in Control	-5.29E+00 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC16A10 in systemic lupus erythematosus			[ 6 ]
Location	TSS1500 (cg15721981)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:9.13E-03; Z-score:-1.28E-01
Methylation in Case	1.24E-01 (Median)	Methylation in Control	1.30E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC16A10 in systemic lupus erythematosus			[ 6 ]
Location	TSS200 (cg26912984)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:3.89E-03; Z-score:-2.16E-01
Methylation in Case	1.25E-01 (Median)	Methylation in Control	1.31E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC16A10 in systemic lupus erythematosus			[ 6 ]
Location	TSS200 (cg24499517)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.05E+00	Statistic Test	p-value:4.02E-02; Z-score:1.65E-01
Methylation in Case	1.57E-02 (Median)	Methylation in Control	1.49E-02 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC16A10 in systemic lupus erythematosus			[ 6 ]
Location	Body (cg18485596)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.09E+00	Statistic Test	p-value:2.05E-04; Z-score:3.35E-01
Methylation in Case	2.42E-01 (Median)	Methylation in Control	2.22E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Bladder cancer	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC16A10 in bladder cancer			[ 7 ]
Location	TSS200 (cg26912984)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.16E+00	Statistic Test	p-value:1.46E-02; Z-score:-1.48E+00
Methylation in Case	1.10E-01 (Median)	Methylation in Control	1.27E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC16A10 in bladder cancer			[ 7 ]
Location	TSS200 (cg18588052)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.48E+00	Statistic Test	p-value:1.60E-02; Z-score:-1.87E+00
Methylation in Case	6.30E-02 (Median)	Methylation in Control	9.32E-02 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC16A10 in bladder cancer			[ 7 ]
Location	TSS200 (cg15822346)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.25E+00	Statistic Test	p-value:4.57E-02; Z-score:-1.56E+00
Methylation in Case	9.83E-02 (Median)	Methylation in Control	1.23E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Breast cancer	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC16A10 in breast cancer			[ 8 ]
Location	TSS200 (cg24499517)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.06E+00	Statistic Test	p-value:1.04E-02; Z-score:7.21E-02
Methylation in Case	1.47E-02 (Median)	Methylation in Control	1.39E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC16A10 in breast cancer			[ 8 ]
Location	TSS200 (cg18588052)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.25E+00	Statistic Test	p-value:1.94E-02; Z-score:-3.85E-01
Methylation in Case	3.59E-02 (Median)	Methylation in Control	4.49E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC16A10 in breast cancer			[ 8 ]
Location	TSS200 (cg25357155)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:2.86E-02; Z-score:-2.93E-02
Methylation in Case	1.04E-02 (Median)	Methylation in Control	1.07E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC16A10 in breast cancer			[ 8 ]
Location	1stExon (cg07940485)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.33E+00	Statistic Test	p-value:9.77E-04; Z-score:3.55E-01
Methylation in Case	9.38E-03 (Median)	Methylation in Control	7.06E-03 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC16A10 in breast cancer			[ 8 ]
Location	Body (cg03181943)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.18E+00	Statistic Test	p-value:2.14E-06; Z-score:2.14E+00
Methylation in Case	7.65E-01 (Median)	Methylation in Control	6.48E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC16A10 in breast cancer			[ 8 ]
Location	Body (cg21276197)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.05E+00	Statistic Test	p-value:2.81E-05; Z-score:1.50E-01
Methylation in Case	8.24E-02 (Median)	Methylation in Control	7.82E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC16A10 in breast cancer			[ 8 ]
Location	Body (cg16300317)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.00E+00	Statistic Test	p-value:1.53E-03; Z-score:7.76E-03
Methylation in Case	7.10E-02 (Median)	Methylation in Control	7.08E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
HIV infection	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC16A10 in HIV infection			[ 9 ]
Location	TSS200 (cg18588052)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.17E+00	Statistic Test	p-value:1.26E-02; Z-score:4.67E-01
Methylation in Case	3.65E-02 (Median)	Methylation in Control	3.12E-02 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC16A10 in HIV infection			[ 9 ]
Location	1stExon (cg07940485)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.88E+00	Statistic Test	p-value:2.89E-02; Z-score:5.81E-01
Methylation in Case	5.02E-03 (Median)	Methylation in Control	2.66E-03 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC16A10 in HIV infection			[ 9 ]
Location	Body (cg18485596)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.41E+00	Statistic Test	p-value:1.77E-08; Z-score:2.33E+00
Methylation in Case	1.98E-01 (Median)	Methylation in Control	1.41E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC16A10 in lung adenocarcinoma			[ 10 ]
Location	TSS200 (cg15822346)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.25E+00	Statistic Test	p-value:8.13E-03; Z-score:-1.47E+00
Methylation in Case	1.11E-01 (Median)	Methylation in Control	1.39E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC16A10 in lung adenocarcinoma			[ 10 ]
Location	TSS200 (cg24499517)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.36E+00	Statistic Test	p-value:3.11E-02; Z-score:-1.03E+00
Methylation in Case	2.28E-02 (Median)	Methylation in Control	3.09E-02 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC16A10 in lung adenocarcinoma			[ 10 ]
Location	Body (cg16300317)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.17E+00	Statistic Test	p-value:8.23E-03; Z-score:1.31E+00
Methylation in Case	1.11E-01 (Median)	Methylation in Control	9.53E-02 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Atypical teratoid rhabdoid tumor	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC16A10 in atypical teratoid rhabdoid tumor			[ 11 ]
Location	1stExon (cg07940485)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.24E+00	Statistic Test	p-value:2.96E-21; Z-score:-3.32E+00
Methylation in Case	6.90E-01 (Median)	Methylation in Control	8.55E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC16A10 in atypical teratoid rhabdoid tumor			[ 11 ]
Location	Body (cg03181943)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:2.59E-04; Z-score:-8.52E-01
Methylation in Case	8.69E-01 (Median)	Methylation in Control	9.02E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Colorectal cancer	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC16A10 in colorectal cancer			[ 12 ]
Location	Body (cg03181943)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:7.87E-03; Z-score:-7.98E-01
Methylation in Case	8.91E-01 (Median)	Methylation in Control	9.11E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
microRNA
Unclear Phenotype	56 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	miR-122 directly targets SLC16A10			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-122	miRNA Mature ID	miR-122-5p
miRNA Sequence	UGGAGUGUGACAAUGGUGUUUG
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon2	miR-1250 directly targets SLC16A10			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1250	miRNA Mature ID	miR-1250-3p
miRNA Sequence	ACAUUUUCCAGCCCAUUCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon3	miR-1281 directly targets SLC16A10			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1281	miRNA Mature ID	miR-1281
miRNA Sequence	UCGCCUCCUCCUCUCCC
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon4	miR-1304 directly targets SLC16A10			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1304	miRNA Mature ID	miR-1304-3p
miRNA Sequence	UCUCACUGUAGCCUCGAACCCC
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon5	miR-140 directly targets SLC16A10			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-140	miRNA Mature ID	miR-140-3p
miRNA Sequence	UACCACAGGGUAGAACCACGG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon6	miR-143 directly targets SLC16A10			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-143	miRNA Mature ID	miR-143-5p
miRNA Sequence	GGUGCAGUGCUGCAUCUCUGGU
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon7	miR-145 directly targets SLC16A10			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-145	miRNA Mature ID	miR-145-5p
miRNA Sequence	GUCCAGUUUUCCCAGGAAUCCCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon8	miR-153 directly targets SLC16A10			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-153	miRNA Mature ID	miR-153-5p
miRNA Sequence	UCAUUUUUGUGAUGUUGCAGCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon9	miR-1825 directly targets SLC16A10			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1825	miRNA Mature ID	miR-1825
miRNA Sequence	UCCAGUGCCCUCCUCUCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon10	miR-199a directly targets SLC16A10			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-199a	miRNA Mature ID	miR-199a-5p
miRNA Sequence	CCCAGUGUUCAGACUACCUGUUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon11	miR-199b directly targets SLC16A10			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-199b	miRNA Mature ID	miR-199b-5p
miRNA Sequence	CCCAGUGUUUAGACUAUCUGUUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon12	miR-21 directly targets SLC16A10			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
miRNA Stemloop ID	miR-21	miRNA Mature ID	miR-21-5p
miRNA Sequence	UAGCUUAUCAGACUGAUGUUGA
miRNA Target Type	Direct
Experimental Material	Patient tissue samples
Epigenetic Phenomenon13	miR-2115 directly targets SLC16A10			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-2115	miRNA Mature ID	miR-2115-5p
miRNA Sequence	AGCUUCCAUGACUCCUGAUGGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon14	miR-3135b directly targets SLC16A10			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3135b	miRNA Mature ID	miR-3135b
miRNA Sequence	GGCUGGAGCGAGUGCAGUGGUG
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon15	miR-3149 directly targets SLC16A10			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3149	miRNA Mature ID	miR-3149
miRNA Sequence	UUUGUAUGGAUAUGUGUGUGUAU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon16	miR-3158 directly targets SLC16A10			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3158	miRNA Mature ID	miR-3158-5p
miRNA Sequence	CCUGCAGAGAGGAAGCCCUUC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon17	miR-3166 directly targets SLC16A10			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3166	miRNA Mature ID	miR-3166
miRNA Sequence	CGCAGACAAUGCCUACUGGCCUA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon18	miR-3190 directly targets SLC16A10			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3190	miRNA Mature ID	miR-3190-5p
miRNA Sequence	UCUGGCCAGCUACGUCCCCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon19	miR-3529 directly targets SLC16A10			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3529	miRNA Mature ID	miR-3529-5p
miRNA Sequence	AGGUAGACUGGGAUUUGUUGUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon20	miR-3652 directly targets SLC16A10			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3652	miRNA Mature ID	miR-3652
miRNA Sequence	CGGCUGGAGGUGUGAGGA
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon21	miR-3674 directly targets SLC16A10			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3674	miRNA Mature ID	miR-3674
miRNA Sequence	AUUGUAGAACCUAAGAUUGGCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon22	miR-379 directly targets SLC16A10			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-379	miRNA Mature ID	miR-379-5p
miRNA Sequence	UGGUAGACUAUGGAACGUAGG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon23	miR-3926 directly targets SLC16A10			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3926	miRNA Mature ID	miR-3926
miRNA Sequence	UGGCCAAAAAGCAGGCAGAGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon24	miR-4418 directly targets SLC16A10			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4418	miRNA Mature ID	miR-4418
miRNA Sequence	CACUGCAGGACUCAGCAG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon25	miR-4428 directly targets SLC16A10			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4428	miRNA Mature ID	miR-4428
miRNA Sequence	CAAGGAGACGGGAACAUGGAGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon26	miR-4430 directly targets SLC16A10			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4430	miRNA Mature ID	miR-4430
miRNA Sequence	AGGCUGGAGUGAGCGGAG
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon27	miR-4438 directly targets SLC16A10			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4438	miRNA Mature ID	miR-4438
miRNA Sequence	CACAGGCUUAGAAAAGACAGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon28	miR-4451 directly targets SLC16A10			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4451	miRNA Mature ID	miR-4451
miRNA Sequence	UGGUAGAGCUGAGGACA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon29	miR-4537 directly targets SLC16A10			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4537	miRNA Mature ID	miR-4537
miRNA Sequence	UGAGCCGAGCUGAGCUUAGCUG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon30	miR-4643 directly targets SLC16A10			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4643	miRNA Mature ID	miR-4643
miRNA Sequence	GACACAUGACCAUAAAUGCUAA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon31	miR-4650 directly targets SLC16A10			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4650	miRNA Mature ID	miR-4650-3p
miRNA Sequence	AGGUAGAAUGAGGCCUGACAU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon32	miR-4717 directly targets SLC16A10			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4717	miRNA Mature ID	miR-4717-3p
miRNA Sequence	ACACAUGGGUGGCUGUGGCCU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon33	miR-4771 directly targets SLC16A10			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4771	miRNA Mature ID	miR-4771
miRNA Sequence	AGCAGACUUGACCUACAAUUA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon34	miR-4772 directly targets SLC16A10			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4772	miRNA Mature ID	miR-4772-3p
miRNA Sequence	CCUGCAACUUUGCCUGAUCAGA
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon35	miR-499b directly targets SLC16A10			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-499b	miRNA Mature ID	miR-499b-5p
miRNA Sequence	ACAGACUUGCUGUGAUGUUCA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon36	miR-500b directly targets SLC16A10			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-500b	miRNA Mature ID	miR-500b-3p
miRNA Sequence	GCACCCAGGCAAGGAUUCUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon37	miR-504 directly targets SLC16A10			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-504	miRNA Mature ID	miR-504-3p
miRNA Sequence	GGGAGUGCAGGGCAGGGUUUC
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon38	miR-509 directly targets SLC16A10			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-509	miRNA Mature ID	miR-509-5p
miRNA Sequence	UACUGCAGACAGUGGCAAUCA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon39	miR-5195 directly targets SLC16A10			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-5195	miRNA Mature ID	miR-5195-3p
miRNA Sequence	AUCCAGUUCUCUGAGGGGGCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon40	miR-548s directly targets SLC16A10			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-548s	miRNA Mature ID	miR-548s
miRNA Sequence	AUGGCCAAAACUGCAGUUAUUUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon41	miR-5693 directly targets SLC16A10			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5693	miRNA Mature ID	miR-5693
miRNA Sequence	GCAGUGGCUCUGAAAUGAACUC
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon42	miR-5698 directly targets SLC16A10			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5698	miRNA Mature ID	miR-5698
miRNA Sequence	UGGGGGAGUGCAGUGAUUGUGG
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon43	miR-590 directly targets SLC16A10			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-590	miRNA Mature ID	miR-590-3p
miRNA Sequence	UAAUUUUAUGUAUAAGCUAGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon44	miR-624 directly targets SLC16A10			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-624	miRNA Mature ID	miR-624-3p
miRNA Sequence	CACAAGGUAUUGGUAUUACCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon45	miR-6499 directly targets SLC16A10			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6499	miRNA Mature ID	miR-6499-3p
miRNA Sequence	AGCAGUGUUUGUUUUGCCCACA
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon46	miR-6504 directly targets SLC16A10			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6504	miRNA Mature ID	miR-6504-3p
miRNA Sequence	CAUUACAGCACAGCCAUUCU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon47	miR-6720 directly targets SLC16A10			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6720	miRNA Mature ID	miR-6720-3p
miRNA Sequence	CGCGCCUGCAGGAACUGGUAGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon48	miR-6722 directly targets SLC16A10			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6722	miRNA Mature ID	miR-6722-5p
miRNA Sequence	AGGCGCACCCGACCACAUGC
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon49	miR-6746 directly targets SLC16A10			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6746	miRNA Mature ID	miR-6746-3p
miRNA Sequence	CAGCCGCCGCCUGUCUCCACAG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon50	miR-6758 directly targets SLC16A10			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6758	miRNA Mature ID	miR-6758-3p
miRNA Sequence	ACUCAUUCUCCUCUGUCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon51	miR-6807 directly targets SLC16A10			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6807	miRNA Mature ID	miR-6807-5p
miRNA Sequence	GUGAGCCAGUGGAAUGGAGAGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon52	miR-6832 directly targets SLC16A10			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6832	miRNA Mature ID	miR-6832-5p
miRNA Sequence	AGUAGAGAGGAAAAGUUAGGGUC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon53	miR-6879 directly targets SLC16A10			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6879	miRNA Mature ID	miR-6879-3p
miRNA Sequence	UGUCACCCGCUCCUUGCCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon54	miR-6890 directly targets SLC16A10			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6890	miRNA Mature ID	miR-6890-3p
miRNA Sequence	CCACUGCCUAUGCCCCACAG
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon55	miR-7151 directly targets SLC16A10			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-7151	miRNA Mature ID	miR-7151-3p
miRNA Sequence	CUACAGGCUGGAAUGGGCUCA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon56	miR-942 directly targets SLC16A10			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-942	miRNA Mature ID	miR-942-3p
miRNA Sequence	CACAUGGCCGAAACAGAGAAGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)

References
1	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
2	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
3	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
4	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
5	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
6	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
7	DNA Methylation Dynamics in Urological Tumors.
8	Genome-wide Scan for Methylation Profiles in Breast Cancer
9	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
10	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
11	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
12	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
13	Elucidation of transcriptome-wide microRNA binding sites in human cardiac tissues by Ago2 HITS-CLIP. Nucleic Acids Res. 2016 Sep 6;44(15):7120-31.
14	Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
15	A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
16	The viral and cellular microRNA targetome in lymphoblastoid cell lines. PLoS Pathog. 2012 Jan;8(1):e1002484.
17	MicroRNA 21 promotes glioma invasion by targeting matrix metalloproteinase regulators. Mol Cell Biol. 2008 Sep;28(17):5369-80.
18	Circular RNAs are a large class of animal RNAs with regulatory potency. Nature. 2013 Mar 21;495(7441):333-8.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence