General Information of Drug Transporter (DT)
DT ID DTD0100 Transporter Info
Gene Name SLC16A1
Transporter Name Monocarboxylate transporter 1
Gene ID
6566
UniProt ID
P53985
Epigenetic Regulations of This DT (EGR)

Methylation

  Bladder cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC16A1 in bladder cancer [ 1 ]

Location

TSS1500 (cg19645639)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.75E+00 Statistic Test p-value:2.95E-04; Z-score:-4.02E+00

Methylation in Case

1.25E-01 (Median) Methylation in Control 2.18E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Breast cancer

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC16A1 in breast cancer [ 2 ]

Location

TSS1500 (cg07176692)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.51E+00 Statistic Test p-value:2.24E-09; Z-score:1.62E+00

Methylation in Case

2.32E-01 (Median) Methylation in Control 1.53E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC16A1 in breast cancer [ 2 ]

Location

TSS1500 (cg19645639)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.55E+00 Statistic Test p-value:3.06E-08; Z-score:1.41E+00

Methylation in Case

2.25E-01 (Median) Methylation in Control 1.45E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Renal cell carcinoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC16A1 in clear cell renal cell carcinoma [ 3 ]

Location

TSS1500 (cg19645639)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.58E+00 Statistic Test p-value:4.00E-03; Z-score:-1.76E+00

Methylation in Case

1.82E-01 (Median) Methylation in Control 2.89E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Colorectal cancer

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC16A1 in colorectal cancer [ 4 ]

Location

TSS1500 (cg19645639)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.88E+00 Statistic Test p-value:2.56E-04; Z-score:-1.46E+00

Methylation in Case

1.87E-01 (Median) Methylation in Control 3.51E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC16A1 in colorectal cancer [ 4 ]

Location

TSS1500 (cg07176692)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.90E+00 Statistic Test p-value:1.14E-03; Z-score:-1.36E+00

Methylation in Case

2.77E-01 (Median) Methylation in Control 5.27E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Hepatocellular carcinoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC16A1 in hepatocellular carcinoma [ 5 ]

Location

TSS1500 (cg24977541)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.30E+00 Statistic Test p-value:2.94E-12; Z-score:-4.34E+00

Methylation in Case

5.28E-01 (Median) Methylation in Control 6.89E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  HIV infection

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC16A1 in HIV infection [ 6 ]

Location

TSS1500 (cg07176692)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.69E+00 Statistic Test p-value:2.25E-08; Z-score:-2.64E+00

Methylation in Case

2.91E-01 (Median) Methylation in Control 4.92E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC16A1 in HIV infection [ 6 ]

Location

TSS1500 (cg19645639)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.28E+00 Statistic Test p-value:4.68E-06; Z-score:-2.83E+00

Methylation in Case

5.39E-01 (Median) Methylation in Control 6.92E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Lung adenocarcinoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC16A1 in lung adenocarcinoma [ 7 ]

Location

TSS1500 (cg19645639)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.21E+00 Statistic Test p-value:2.49E-02; Z-score:-1.90E+00

Methylation in Case

4.06E-01 (Median) Methylation in Control 4.91E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Panic disorder

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC16A1 in panic disorder [ 8 ]

Location

TSS1500 (cg07176692)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:6.04E-01 Statistic Test p-value:6.50E-03; Z-score:3.84E-01

Methylation in Case

-2.77E-01 (Median) Methylation in Control -4.59E-01 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC16A1 in panic disorder [ 8 ]

Location

TSS1500 (cg19645639)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.21E+00 Statistic Test p-value:2.53E-02; Z-score:6.03E-01

Methylation in Case

2.00E+00 (Median) Methylation in Control 1.65E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC16A1 in papillary thyroid cancer [ 9 ]

Location

TSS1500 (cg07176692)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:9.77E-03; Z-score:-6.68E-01

Methylation in Case

6.23E-01 (Median) Methylation in Control 6.76E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Prostate cancer

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC16A1 in prostate cancer [ 10 ]

Location

TSS1500 (cg08620470)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:3.29E-02; Z-score:1.71E+00

Methylation in Case

9.50E-01 (Median) Methylation in Control 9.15E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC16A1 in prostate cancer [ 10 ]

Location

Body (cg01650904)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.39E+00 Statistic Test p-value:4.68E-02; Z-score:5.64E+00

Methylation in Case

4.03E-01 (Median) Methylation in Control 1.68E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Colon cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC16A1 in colon adenocarcinoma [ 11 ]

Location

Body (cg23529278)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:6.44E-04; Z-score:-2.34E+00

Methylation in Case

8.60E-01 (Median) Methylation in Control 8.97E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

Histone acetylation

  Oligodendrocyte precursors

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Hypoacetylation of Slc16a1 in oligodendrocyte precursors (compare with oligodendrocyte) [ 12 ]

Location

Promoter

Epigenetic Type

Histone acetylation Experiment Method Chromatin immunoprecipitation

Related Molecular Changes

Up regulation ofSlc16a1 Experiment Method RT-qPCR

Studied Phenotype

Oligodendrocyte precursors

Experimental Material

Model organism in vivo (mouse)

Additional Notes

There was a significant negative correlation between H3K9ac in the Slc16a1 promoter and Slc16a1 expression.

microRNA

  Medulloblastoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Lower expression of miR-124 in medulloblastoma (compare with adjacent normal tissue) [ 13 ]

Epigenetic Type

microRNA Experiment Method Luciferase reporter assay

Related Molecular Changes

Down regulation ofSLC16A1 Experiment Method Western Blot

miRNA Stemloop ID

miR-124 miRNA Mature ID miR-124-3p

miRNA Sequence

UAAGGCACGCGGUGAAUGCCAA

miRNA Target Type

Direct

Studied Phenotype

Medulloblastoma[ ICD-11:2A00.10]

Experimental Material

Patient tissue samples; Multiple cell lines of human

Additional Notes

miR-124 deregulation is common in medulloblastomas, and reexpression of miR-124 inhibits cell proliferation.

  Unclear Phenotype

       118 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-1202 directly targets SLC16A1 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1202 miRNA Mature ID miR-1202

miRNA Sequence

GUGCCAGCUGCAGUGGGGGAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon2

miR-124 directly targets SLC16A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-124 miRNA Mature ID miR-124-3p

miRNA Sequence

UAAGGCACGCGGUGAAUGCCAA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon3

miR-1267 directly targets SLC16A1 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1267 miRNA Mature ID miR-1267

miRNA Sequence

CCUGUUGAAGUGUAAUCCCCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon4

miR-128 directly targets SLC16A1 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-128 miRNA Mature ID miR-128-3p

miRNA Sequence

UCACAGUGAACCGGUCUCUUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon5

miR-129 directly targets SLC16A1 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-129 miRNA Mature ID miR-129-5p

miRNA Sequence

CUUUUUGCGGUCUGGGCUUGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon6

miR-1343 directly targets SLC16A1 [ 17 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1343 miRNA Mature ID miR-1343-3p

miRNA Sequence

CUCCUGGGGCCCGCACUCUCGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon7

miR-188 directly targets SLC16A1 [ 18 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-188 miRNA Mature ID miR-188-5p

miRNA Sequence

CAUCCCUUGCAUGGUGGAGGG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon8

miR-190a directly targets SLC16A1 [ 18 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-190a miRNA Mature ID miR-190a-3p

miRNA Sequence

CUAUAUAUCAAACAUAUUCCU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon9

miR-1914 directly targets SLC16A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1914 miRNA Mature ID miR-1914-3p

miRNA Sequence

GGAGGGGUCCCGCACUGGGAGG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon10

miR-1972 directly targets SLC16A1 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1972 miRNA Mature ID miR-1972

miRNA Sequence

UCAGGCCAGGCACAGUGGCUCA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon11

miR-216a directly targets SLC16A1 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-216a miRNA Mature ID miR-216a-3p

miRNA Sequence

UCACAGUGGUCUCUGGGAUUAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon12

miR-23b directly targets SLC16A1 [ 20 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-23b miRNA Mature ID miR-23b-3p

miRNA Sequence

AUCACAUUGCCAGGGAUUACCAC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon13

miR-27a directly targets SLC16A1 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-27a miRNA Mature ID miR-27a-3p

miRNA Sequence

UUCACAGUGGCUAAGUUCCGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon14

miR-27b directly targets SLC16A1 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-27b miRNA Mature ID miR-27b-3p

miRNA Sequence

UUCACAGUGGCUAAGUUCUGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon15

miR-29a directly targets SLC16A1 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-29a miRNA Mature ID miR-29a-3p

miRNA Sequence

UAGCACCAUCUGAAAUCGGUUA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon16

miR-29b directly targets SLC16A1 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-29b miRNA Mature ID miR-29b-3p

miRNA Sequence

UAGCACCAUUUGAAAUCAGUGUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon17

miR-29c directly targets SLC16A1 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-29c miRNA Mature ID miR-29c-3p

miRNA Sequence

UAGCACCAUUUGAAAUCGGUUA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon18

miR-302a directly targets SLC16A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-302a miRNA Mature ID miR-302a-5p

miRNA Sequence

ACUUAAACGUGGAUGUACUUGCU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon19

miR-302c directly targets SLC16A1 [ 21 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-302c miRNA Mature ID miR-302c-5p

miRNA Sequence

UUUAACAUGGGGGUACCUGCUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon20

miR-30a directly targets SLC16A1 [ 17 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-30a miRNA Mature ID miR-30a-3p

miRNA Sequence

CUUUCAGUCGGAUGUUUGCAGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon21

miR-30d directly targets SLC16A1 [ 17 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-30d miRNA Mature ID miR-30d-3p

miRNA Sequence

CUUUCAGUCAGAUGUUUGCUGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon22

miR-30e directly targets SLC16A1 [ 17 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-30e miRNA Mature ID miR-30e-3p

miRNA Sequence

CUUUCAGUCGGAUGUUUACAGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon23

miR-3117 directly targets SLC16A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3117 miRNA Mature ID miR-3117-5p

miRNA Sequence

AGACACUAUACGAGUCAUAU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon24

miR-3148 directly targets SLC16A1 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3148 miRNA Mature ID miR-3148

miRNA Sequence

UGGAAAAAACUGGUGUGUGCUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon25

miR-3194 directly targets SLC16A1 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3194 miRNA Mature ID miR-3194-3p

miRNA Sequence

AGCUCUGCUGCUCACUGGCAGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon26

miR-33a directly targets SLC16A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-33a miRNA Mature ID miR-33a-3p

miRNA Sequence

CAAUGUUUCCACAGUGCAUCAC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon27

miR-33a directly targets SLC16A1 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-33a miRNA Mature ID miR-33a-5p

miRNA Sequence

GUGCAUUGUAGUUGCAUUGCA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon28

miR-33b directly targets SLC16A1 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-33b miRNA Mature ID miR-33b-5p

miRNA Sequence

GUGCAUUGCUGUUGCAUUGC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon29

miR-3529 directly targets SLC16A1 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3529 miRNA Mature ID miR-3529-5p

miRNA Sequence

AGGUAGACUGGGAUUUGUUGUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon30

miR-3663 directly targets SLC16A1 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3663 miRNA Mature ID miR-3663-3p

miRNA Sequence

UGAGCACCACACAGGCCGGGCGC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon31

miR-367 directly targets SLC16A1 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-367 miRNA Mature ID miR-367-5p

miRNA Sequence

ACUGUUGCUAAUAUGCAACUCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon32

miR-3672 directly targets SLC16A1 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3672 miRNA Mature ID miR-3672

miRNA Sequence

AUGAGACUCAUGUAAAACAUCUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon33

miR-3680 directly targets SLC16A1 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3680 miRNA Mature ID miR-3680-3p

miRNA Sequence

UUUUGCAUGACCCUGGGAGUAGG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon34

miR-3681 directly targets SLC16A1 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3681 miRNA Mature ID miR-3681-3p

miRNA Sequence

ACACAGUGCUUCAUCCACUACU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon35

miR-3714 directly targets SLC16A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3714 miRNA Mature ID miR-3714

miRNA Sequence

GAAGGCAGCAGUGCUCCCCUGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon36

miR-374a directly targets SLC16A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-374a miRNA Mature ID miR-374a-5p

miRNA Sequence

UUAUAAUACAACCUGAUAAGUG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon37

miR-374b directly targets SLC16A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-374b miRNA Mature ID miR-374b-5p

miRNA Sequence

AUAUAAUACAACCUGCUAAGUG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon38

miR-377 directly targets SLC16A1 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-377 miRNA Mature ID miR-377-5p

miRNA Sequence

AGAGGUUGCCCUUGGUGAAUUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon39

miR-379 directly targets SLC16A1 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-379 miRNA Mature ID miR-379-5p

miRNA Sequence

UGGUAGACUAUGGAACGUAGG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon40

miR-380 directly targets SLC16A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-380 miRNA Mature ID miR-380-5p

miRNA Sequence

UGGUUGACCAUAGAACAUGCGC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon41

miR-3910 directly targets SLC16A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3910 miRNA Mature ID miR-3910

miRNA Sequence

AAAGGCAUAAAACCAAGACA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon42

miR-3936 directly targets SLC16A1 [ 17 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3936 miRNA Mature ID miR-3936

miRNA Sequence

UAAGGGGUGUAUGGCAGAUGCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon43

miR-3942 directly targets SLC16A1 [ 17 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3942 miRNA Mature ID miR-3942-3p

miRNA Sequence

UUUCAGAUAACAGUAUUACAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon44

miR-3972 directly targets SLC16A1 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3972 miRNA Mature ID miR-3972

miRNA Sequence

CUGCCAGCCCCGUUCCAGGGCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon45

miR-3978 directly targets SLC16A1 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3978 miRNA Mature ID miR-3978

miRNA Sequence

GUGGAAAGCAUGCAUCCAGGGUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon46

miR-425 directly targets SLC16A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-425 miRNA Mature ID miR-425-5p

miRNA Sequence

AAUGACACGAUCACUCCCGUUGA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon47

miR-4294 directly targets SLC16A1 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4294 miRNA Mature ID miR-4294

miRNA Sequence

GGGAGUCUACAGCAGGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon48

miR-4307 directly targets SLC16A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4307 miRNA Mature ID miR-4307

miRNA Sequence

AAUGUUUUUUCCUGUUUCC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon49

miR-431 directly targets SLC16A1 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-431 miRNA Mature ID miR-431-5p

miRNA Sequence

UGUCUUGCAGGCCGUCAUGCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon50

miR-4324 directly targets SLC16A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4324 miRNA Mature ID miR-4324

miRNA Sequence

CCCUGAGACCCUAACCUUAA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon51

miR-4423 directly targets SLC16A1 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4423 miRNA Mature ID miR-4423-5p

miRNA Sequence

AGUUGCCUUUUUGUUCCCAUGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon52

miR-4438 directly targets SLC16A1 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4438 miRNA Mature ID miR-4438

miRNA Sequence

CACAGGCUUAGAAAAGACAGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon53

miR-4451 directly targets SLC16A1 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4451 miRNA Mature ID miR-4451

miRNA Sequence

UGGUAGAGCUGAGGACA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon54

miR-4503 directly targets SLC16A1 [ 21 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4503 miRNA Mature ID miR-4503

miRNA Sequence

UUUAAGCAGGAAAUAGAAUUUA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon55

miR-4650 directly targets SLC16A1 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4650 miRNA Mature ID miR-4650-3p

miRNA Sequence

AGGUAGAAUGAGGCCUGACAU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon56

miR-4719 directly targets SLC16A1 [ 17 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4719 miRNA Mature ID miR-4719

miRNA Sequence

UCACAAAUCUAUAAUAUGCAGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon57

miR-4733 directly targets SLC16A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4733 miRNA Mature ID miR-4733-5p

miRNA Sequence

AAUCCCAAUGCUAGACCCGGUG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon58

miR-4755 directly targets SLC16A1 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4755 miRNA Mature ID miR-4755-3p

miRNA Sequence

AGCCAGGCUCUGAAGGGAAAGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon59

miR-484 directly targets SLC16A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method Sequencing

miRNA Stemloop ID

miR-484 miRNA Mature ID miR-484

miRNA Sequence

UCAGGCUCAGUCCCCUCCCGAU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon60

miR-488 directly targets SLC16A1 [ 17 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-488 miRNA Mature ID miR-488-3p

miRNA Sequence

UUGAAAGGCUAUUUCUUGGUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon61

miR-5002 directly targets SLC16A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-5002 miRNA Mature ID miR-5002-5p

miRNA Sequence

AAUUUGGUUUCUGAGGCACUUAGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon62

miR-5003 directly targets SLC16A1 [ 17 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-5003 miRNA Mature ID miR-5003-3p

miRNA Sequence

UACUUUUCUAGGUUGUUGGGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon63

miR-5006 directly targets SLC16A1 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-5006 miRNA Mature ID miR-5006-5p

miRNA Sequence

UUGCCAGGGCAGGAGGUGGAA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon64

miR-5011 directly targets SLC16A1 [ 18 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-5011 miRNA Mature ID miR-5011-5p

miRNA Sequence

UAUAUAUACAGCCAUGCACUC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon65

miR-506 directly targets SLC16A1 [ 18 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-506 miRNA Mature ID miR-506-3p

miRNA Sequence

UAAGGCACCCUUCUGAGUAGA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon66

miR-506 directly targets SLC16A1 [ 18 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-506 miRNA Mature ID miR-506-5p

miRNA Sequence

UAUUCAGGAAGGUGUUACUUAA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon67

miR-5100 directly targets SLC16A1 [ 17 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-5100 miRNA Mature ID miR-5100

miRNA Sequence

UUCAGAUCCCAGCGGUGCCUCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon68

miR-513a directly targets SLC16A1 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-513a miRNA Mature ID miR-513a-5p

miRNA Sequence

UUCACAGGGAGGUGUCAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon69

miR-5194 directly targets SLC16A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-5194 miRNA Mature ID miR-5194

miRNA Sequence

UGAGGGGUUUGGAAUGGGAUGG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon70

miR-548a directly targets SLC16A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-548a miRNA Mature ID miR-548a-3p

miRNA Sequence

CAAAACUGGCAAUUACUUUUGC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon71

miR-548ar directly targets SLC16A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-548ar miRNA Mature ID miR-548ar-3p

miRNA Sequence

UAAAACUGCAGUUAUUUUUGC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon72

miR-548az directly targets SLC16A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-548az miRNA Mature ID miR-548az-3p

miRNA Sequence

AAAAACUGCAAUCACUUUUGC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon73

miR-548e directly targets SLC16A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-548e miRNA Mature ID miR-548e-3p

miRNA Sequence

AAAAACUGAGACUACUUUUGCA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon74

miR-548f directly targets SLC16A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-548f miRNA Mature ID miR-548f-3p

miRNA Sequence

AAAAACUGUAAUUACUUUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon75

miR-548j directly targets SLC16A1 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-548j miRNA Mature ID miR-548j-3p

miRNA Sequence

CAAAAACUGCAUUACUUUUGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon76

miR-548m directly targets SLC16A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-548m miRNA Mature ID miR-548m

miRNA Sequence

CAAAGGUAUUUGUGGUUUUUG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon77

miR-548x directly targets SLC16A1 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-548x miRNA Mature ID miR-548x-3p

miRNA Sequence

UAAAAACUGCAAUUACUUUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon78

miR-552 directly targets SLC16A1 [ 21 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-552 miRNA Mature ID miR-552-5p

miRNA Sequence

GUUUAACCUUUUGCCUGUUGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon79

miR-5582 directly targets SLC16A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-5582 miRNA Mature ID miR-5582-5p

miRNA Sequence

UAGGCACACUUAAAGUUAUAGC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon80

miR-5582 directly targets SLC16A1 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-5582 miRNA Mature ID miR-5582-3p

miRNA Sequence

UAAAACUUUAAGUGUGCCUAGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon81

miR-563 directly targets SLC16A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-563 miRNA Mature ID miR-563

miRNA Sequence

AGGUUGACAUACGUUUCCC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon82

miR-5681a directly targets SLC16A1 [ 17 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-5681a miRNA Mature ID miR-5681a

miRNA Sequence

AGAAAGGGUGGCAAUACCUCUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon83

miR-5691 directly targets SLC16A1 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-5691 miRNA Mature ID miR-5691

miRNA Sequence

UUGCUCUGAGCUCCGAGAAAGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon84

miR-576 directly targets SLC16A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-576 miRNA Mature ID miR-576-5p

miRNA Sequence

AUUCUAAUUUCUCCACGUCUUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon85

miR-605 directly targets SLC16A1 [ 18 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-605 miRNA Mature ID miR-605-5p

miRNA Sequence

UAAAUCCCAUGGUGCCUUCUCCU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon86

miR-6074 directly targets SLC16A1 [ 18 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6074 miRNA Mature ID miR-6074

miRNA Sequence

GAUAUUCAGAGGCUAGGUGG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon87

miR-6086 directly targets SLC16A1 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6086 miRNA Mature ID miR-6086

miRNA Sequence

GGAGGUUGGGAAGGGCAGAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon88

miR-6124 directly targets SLC16A1 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6124 miRNA Mature ID miR-6124

miRNA Sequence

GGGAAAAGGAAGGGGGAGGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon89

miR-615 directly targets SLC16A1 [ 20 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-615 miRNA Mature ID miR-615-3p

miRNA Sequence

UCCGAGCCUGGGUCUCCCUCUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon90

miR-6501 directly targets SLC16A1 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6501 miRNA Mature ID miR-6501-5p

miRNA Sequence

AGUUGCCAGGGCUGCCUUUGGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon91

miR-6504 directly targets SLC16A1 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6504 miRNA Mature ID miR-6504-3p

miRNA Sequence

CAUUACAGCACAGCCAUUCU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon92

miR-655 directly targets SLC16A1 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-655 miRNA Mature ID miR-655-5p

miRNA Sequence

AGAGGUUAUCCGUGUUAUGUUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon93

miR-656 directly targets SLC16A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-656 miRNA Mature ID miR-656-3p

miRNA Sequence

AAUAUUAUACAGUCAACCUCU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon94

miR-6730 directly targets SLC16A1 [ 17 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6730 miRNA Mature ID miR-6730-5p

miRNA Sequence

AGAAAGGUGGAGGGGUUGUCAGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon95

miR-6738 directly targets SLC16A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6738 miRNA Mature ID miR-6738-5p

miRNA Sequence

CGAGGGGUAGAAGAGCACAGGGG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon96

miR-6742 directly targets SLC16A1 [ 17 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6742 miRNA Mature ID miR-6742-3p

miRNA Sequence

ACCUGGGUUGUCCCCUCUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon97

miR-6761 directly targets SLC16A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6761 miRNA Mature ID miR-6761-5p

miRNA Sequence

UCUGAGAGAGCUCGAUGGCAG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon98

miR-6783 directly targets SLC16A1 [ 17 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6783 miRNA Mature ID miR-6783-3p

miRNA Sequence

UUCCUGGGCUUCUCCUCUGUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon99

miR-6792 directly targets SLC16A1 [ 21 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6792 miRNA Mature ID miR-6792-5p

miRNA Sequence

GUAAGCAGGGGCUCUGGGUGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon100

miR-6805 directly targets SLC16A1 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6805 miRNA Mature ID miR-6805-3p

miRNA Sequence

UUGCUCUGCUCCCCCGCCCCCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon101

miR-6814 directly targets SLC16A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6814 miRNA Mature ID miR-6814-5p

miRNA Sequence

UCCCAAGGGUGAGAUGCUGCCA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon102

miR-6815 directly targets SLC16A1 [ 21 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6815 miRNA Mature ID miR-6815-3p

miRNA Sequence

UGGCUUCUCUUGCACACCCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon103

miR-6852 directly targets SLC16A1 [ 17 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6852 miRNA Mature ID miR-6852-5p

miRNA Sequence

CCCUGGGGUUCUGAGGACAUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon104

miR-6864 directly targets SLC16A1 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6864 miRNA Mature ID miR-6864-3p

miRNA Sequence

GUGAGACUUCUCUCCCUUCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon105

miR-6866 directly targets SLC16A1 [ 18 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6866 miRNA Mature ID miR-6866-3p

miRNA Sequence

GAUCCCUUUAUCUGUCCUCUAG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon106

miR-7109 directly targets SLC16A1 [ 18 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-7109 miRNA Mature ID miR-7109-3p

miRNA Sequence

CAAGCCUCUCCUGCCCUUCCAG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon107

miR-7151 directly targets SLC16A1 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-7151 miRNA Mature ID miR-7151-3p

miRNA Sequence

CUACAGGCUGGAAUGGGCUCA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon108

miR-7154 directly targets SLC16A1 [ 17 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-7154 miRNA Mature ID miR-7154-5p

miRNA Sequence

UUCAUGAACUGGGUCUAGCUUGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon109

miR-7162 directly targets SLC16A1 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-7162 miRNA Mature ID miR-7162-3p

miRNA Sequence

UCUGAGGUGGAACAGCAGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon110

miR-744 directly targets SLC16A1 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-744 miRNA Mature ID miR-744-3p

miRNA Sequence

CUGUUGCCACUAACCUCAACCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon111

miR-7850 directly targets SLC16A1 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-7850 miRNA Mature ID miR-7850-5p

miRNA Sequence

GUUUGGACAUAGUGUGGCUGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon112

miR-8055 directly targets SLC16A1 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-8055 miRNA Mature ID miR-8055

miRNA Sequence

CUUUGAGCACAUGAGCAGACGGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon113

miR-8060 directly targets SLC16A1 [ 17 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-8060 miRNA Mature ID miR-8060

miRNA Sequence

CCAUGAAGCAGUGGGUAGGAGGAC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon114

miR-890 directly targets SLC16A1 [ 21 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-890 miRNA Mature ID miR-890

miRNA Sequence

UACUUGGAAAGGCAUCAGUUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon115

miR-892c directly targets SLC16A1 [ 18 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-892c miRNA Mature ID miR-892c-5p

miRNA Sequence

UAUUCAGAAAGGUGCCAGUCA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon116

miR-924 directly targets SLC16A1 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-924 miRNA Mature ID miR-924

miRNA Sequence

AGAGUCUUGUGAUGUCUUGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon117

miR-936 directly targets SLC16A1 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-936 miRNA Mature ID miR-936

miRNA Sequence

ACAGUAGAGGGAGGAAUCGCAG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon118

miR-939 directly targets SLC16A1 [ 17 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-939 miRNA Mature ID miR-939-3p

miRNA Sequence

CCCUGGGCCUCUGCUCCCCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human
References
1 DNA Methylation Dynamics in Urological Tumors.
2 Genome-wide Scan for Methylation Profiles in Breast Cancer
3 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
4 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
5 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
6 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
7 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
8 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
9 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
10 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
11 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
12 H3K9ac and HDAC2 Activity Are Involved in the Expression of Monocarboxylate Transporter 1 in Oligodendrocyte. Front Mol Neurosci. 2017 Nov 14;10:376.
13 miR-124 is frequently down-regulated in medulloblastoma and is a negative regulator of SLC16A1. Hum Pathol. 2009 Sep;40(9):1234-43.
14 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
15 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
16 TP53 regulates miRNA association with AGO2 to remodel the miRNA-mRNA interaction network. Genome Res. 2016 Mar;26(3):331-41.
17 In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio. 2013 Apr 16;4(2):e000193.
18 Genome-wide identification of microRNA targets in human ES cells reveals a role for miR-302 in modulating BMP response. Genes Dev. 2011 Oct 15;25(20):2173-86.
19 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
20 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
21 Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature. 2009 Jul 23;460(7254):479-86.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.