Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0099 Transporter Info
Gene Name	SLC15A4
Transporter Name	Peptide transporter 4
Gene ID	121260
UniProt ID	Q8N697

Epigenetic Regulations of This DT (EGR)
Methylation
Pancretic ductal adenocarcinoma	17 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC15A4 in pancretic ductal adenocarcinoma			[ 1 ]
Location	5'UTR (cg13907146)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.09E+00	Statistic Test	p-value:4.21E-06; Z-score:6.26E-01
Methylation in Case	3.62E-01 (Median)	Methylation in Control	3.33E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC15A4 in pancretic ductal adenocarcinoma			[ 1 ]
Location	5'UTR (cg00655147)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.20E+00	Statistic Test	p-value:8.99E-04; Z-score:8.35E-01
Methylation in Case	7.96E-01 (Median)	Methylation in Control	6.64E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC15A4 in pancretic ductal adenocarcinoma			[ 1 ]
Location	TSS1500 (cg14642395)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.10E+00	Statistic Test	p-value:2.40E-04; Z-score:-1.20E+00
Methylation in Case	6.34E-01 (Median)	Methylation in Control	6.97E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC15A4 in pancretic ductal adenocarcinoma			[ 1 ]
Location	TSS1500 (cg00498305)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.13E+00	Statistic Test	p-value:1.65E-03; Z-score:9.63E-01
Methylation in Case	3.54E-01 (Median)	Methylation in Control	3.12E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC15A4 in pancretic ductal adenocarcinoma			[ 1 ]
Location	TSS200 (cg00111823)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.15E+00	Statistic Test	p-value:9.18E-07; Z-score:1.29E+00
Methylation in Case	9.22E-01 (Median)	Methylation in Control	8.04E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC15A4 in pancretic ductal adenocarcinoma			[ 1 ]
Location	TSS200 (cg17733616)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-5.83E+00	Statistic Test	p-value:7.03E-06; Z-score:-1.08E+00
Methylation in Case	3.34E-02 (Median)	Methylation in Control	1.95E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC15A4 in pancretic ductal adenocarcinoma			[ 1 ]
Location	TSS200 (cg13742513)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.21E+00	Statistic Test	p-value:1.23E-04; Z-score:-1.14E+00
Methylation in Case	5.68E-01 (Median)	Methylation in Control	6.88E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC15A4 in pancretic ductal adenocarcinoma			[ 1 ]
Location	1stExon (cg14038482)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.02E+00	Statistic Test	p-value:3.47E-03; Z-score:9.82E-01
Methylation in Case	9.27E-01 (Median)	Methylation in Control	9.04E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC15A4 in pancretic ductal adenocarcinoma			[ 1 ]
Location	Body (cg05367173)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:2.73E-09; Z-score:-1.25E+00
Methylation in Case	8.42E-01 (Median)	Methylation in Control	8.85E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC15A4 in pancretic ductal adenocarcinoma			[ 1 ]
Location	Body (cg15668533)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.22E+00	Statistic Test	p-value:1.28E-06; Z-score:1.07E+00
Methylation in Case	3.99E-01 (Median)	Methylation in Control	3.27E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC15A4 in pancretic ductal adenocarcinoma			[ 1 ]
Location	Body (cg26175428)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.14E+00	Statistic Test	p-value:3.13E-06; Z-score:1.29E+00
Methylation in Case	7.62E-01 (Median)	Methylation in Control	6.71E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of SLC15A4 in pancretic ductal adenocarcinoma			[ 1 ]
Location	Body (cg11376147)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.13E+00	Statistic Test	p-value:7.24E-06; Z-score:-1.16E+00
Methylation in Case	2.45E-01 (Median)	Methylation in Control	2.79E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon13	Methylation of SLC15A4 in pancretic ductal adenocarcinoma			[ 1 ]
Location	Body (cg07986907)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:4.51E-05; Z-score:-7.46E-01
Methylation in Case	8.70E-01 (Median)	Methylation in Control	8.91E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon14	Methylation of SLC15A4 in pancretic ductal adenocarcinoma			[ 1 ]
Location	Body (cg20475114)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.05E+00	Statistic Test	p-value:1.24E-03; Z-score:9.29E-01
Methylation in Case	6.57E-01 (Median)	Methylation in Control	6.24E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon15	Methylation of SLC15A4 in pancretic ductal adenocarcinoma			[ 1 ]
Location	Body (cg07262873)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.13E+00	Statistic Test	p-value:2.09E-03; Z-score:8.67E-01
Methylation in Case	4.97E-01 (Median)	Methylation in Control	4.38E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon16	Methylation of SLC15A4 in pancretic ductal adenocarcinoma			[ 1 ]
Location	Body (ch.12.2625550F)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.15E+00	Statistic Test	p-value:9.72E-03; Z-score:-4.79E-01
Methylation in Case	6.46E-02 (Median)	Methylation in Control	7.40E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon17	Methylation of SLC15A4 in pancretic ductal adenocarcinoma			[ 1 ]
Location	Body (cg14372753)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:1.25E-02; Z-score:-7.10E-01
Methylation in Case	8.61E-01 (Median)	Methylation in Control	9.00E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Bladder cancer	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC15A4 in bladder cancer			[ 2 ]
Location	TSS1500 (cg19777783)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.56E+00	Statistic Test	p-value:8.59E-05; Z-score:-3.88E+00
Methylation in Case	3.29E-01 (Median)	Methylation in Control	5.14E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC15A4 in bladder cancer			[ 2 ]
Location	Body (cg24102222)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.25E+00	Statistic Test	p-value:4.12E-06; Z-score:6.38E+00
Methylation in Case	8.43E-01 (Median)	Methylation in Control	6.75E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC15A4 in bladder cancer			[ 2 ]
Location	Body (cg03751906)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.77E+00	Statistic Test	p-value:2.15E-05; Z-score:-4.29E+00
Methylation in Case	9.23E-02 (Median)	Methylation in Control	1.63E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC15A4 in bladder cancer			[ 2 ]
Location	Body (cg04043695)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.10E+00	Statistic Test	p-value:5.90E-05; Z-score:4.54E+00
Methylation in Case	8.68E-01 (Median)	Methylation in Control	7.91E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC15A4 in bladder cancer			[ 2 ]
Location	Body (cg09035930)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.37E+00	Statistic Test	p-value:5.94E-04; Z-score:2.71E+00
Methylation in Case	7.86E-01 (Median)	Methylation in Control	5.72E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC15A4 in bladder cancer			[ 2 ]
Location	Body (cg10189593)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.08E+00	Statistic Test	p-value:3.13E-03; Z-score:-1.88E+00
Methylation in Case	8.02E-01 (Median)	Methylation in Control	8.65E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC15A4 in bladder cancer			[ 2 ]
Location	Body (cg24301247)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.12E+00	Statistic Test	p-value:3.70E-02; Z-score:1.67E+00
Methylation in Case	8.50E-01 (Median)	Methylation in Control	7.57E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Breast cancer	18 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC15A4 in breast cancer			[ 3 ]
Location	TSS1500 (cg19777783)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.20E+00	Statistic Test	p-value:4.96E-09; Z-score:1.99E+00
Methylation in Case	5.37E-01 (Median)	Methylation in Control	4.49E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC15A4 in breast cancer			[ 3 ]
Location	TSS1500 (cg01356908)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.24E+00	Statistic Test	p-value:1.11E-04; Z-score:1.00E+00
Methylation in Case	1.42E-01 (Median)	Methylation in Control	1.14E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC15A4 in breast cancer			[ 3 ]
Location	TSS1500 (cg10643271)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.24E+00	Statistic Test	p-value:1.99E-04; Z-score:9.59E-01
Methylation in Case	2.63E-01 (Median)	Methylation in Control	2.12E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC15A4 in breast cancer			[ 3 ]
Location	TSS1500 (cg15623519)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.30E+00	Statistic Test	p-value:8.39E-04; Z-score:1.14E+00
Methylation in Case	2.92E-01 (Median)	Methylation in Control	2.25E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC15A4 in breast cancer			[ 3 ]
Location	TSS200 (cg02278697)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.12E+00	Statistic Test	p-value:6.63E-03; Z-score:-3.60E-01
Methylation in Case	4.75E-02 (Median)	Methylation in Control	5.31E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC15A4 in breast cancer			[ 3 ]
Location	TSS200 (cg27541875)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.15E+00	Statistic Test	p-value:2.59E-02; Z-score:-3.89E-01
Methylation in Case	3.37E-02 (Median)	Methylation in Control	3.86E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC15A4 in breast cancer			[ 3 ]
Location	Body (cg02742418)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:1.10E-05; Z-score:-1.15E+00
Methylation in Case	8.52E-01 (Median)	Methylation in Control	8.96E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC15A4 in breast cancer			[ 3 ]
Location	Body (cg06653632)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.14E+00	Statistic Test	p-value:1.44E-04; Z-score:-1.44E+00
Methylation in Case	7.37E-01 (Median)	Methylation in Control	8.38E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC15A4 in breast cancer			[ 3 ]
Location	Body (cg03751906)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.25E+00	Statistic Test	p-value:2.11E-04; Z-score:-8.69E-01
Methylation in Case	9.62E-02 (Median)	Methylation in Control	1.20E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC15A4 in breast cancer			[ 3 ]
Location	Body (cg24102222)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.18E+00	Statistic Test	p-value:3.02E-04; Z-score:-8.95E-01
Methylation in Case	6.31E-01 (Median)	Methylation in Control	7.48E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC15A4 in breast cancer			[ 3 ]
Location	Body (cg09001549)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.06E+00	Statistic Test	p-value:3.05E-04; Z-score:-9.11E-01
Methylation in Case	8.50E-01 (Median)	Methylation in Control	8.99E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of SLC15A4 in breast cancer			[ 3 ]
Location	Body (cg05934015)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.10E+00	Statistic Test	p-value:1.55E-03; Z-score:-6.62E-01
Methylation in Case	8.24E-01 (Median)	Methylation in Control	9.04E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon13	Methylation of SLC15A4 in breast cancer			[ 3 ]
Location	Body (cg19717347)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:2.28E-03; Z-score:-6.59E-01
Methylation in Case	8.37E-01 (Median)	Methylation in Control	8.78E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon14	Methylation of SLC15A4 in breast cancer			[ 3 ]
Location	Body (cg02555727)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:5.02E-03; Z-score:-4.23E-01
Methylation in Case	8.18E-01 (Median)	Methylation in Control	8.29E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon15	Methylation of SLC15A4 in breast cancer			[ 3 ]
Location	Body (cg21830849)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.06E+00	Statistic Test	p-value:8.45E-03; Z-score:-8.80E-01
Methylation in Case	8.39E-01 (Median)	Methylation in Control	8.90E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon16	Methylation of SLC15A4 in breast cancer			[ 3 ]
Location	Body (cg24301247)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.08E+00	Statistic Test	p-value:1.02E-02; Z-score:-7.89E-01
Methylation in Case	7.24E-01 (Median)	Methylation in Control	7.84E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon17	Methylation of SLC15A4 in breast cancer			[ 3 ]
Location	Body (cg04826413)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:1.41E-02; Z-score:-5.11E-01
Methylation in Case	8.03E-01 (Median)	Methylation in Control	8.28E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon18	Methylation of SLC15A4 in breast cancer			[ 3 ]
Location	Body (cg04356090)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.09E+00	Statistic Test	p-value:3.04E-02; Z-score:-8.81E-01
Methylation in Case	8.33E-01 (Median)	Methylation in Control	9.09E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Renal cell carcinoma	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC15A4 in clear cell renal cell carcinoma			[ 4 ]
Location	TSS1500 (cg19777783)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:2.24E-02; Z-score:-5.09E-01
Methylation in Case	6.39E-01 (Median)	Methylation in Control	6.57E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC15A4 in clear cell renal cell carcinoma			[ 4 ]
Location	Body (cg24102222)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.16E+00	Statistic Test	p-value:8.61E-08; Z-score:-2.06E+00
Methylation in Case	7.25E-01 (Median)	Methylation in Control	8.43E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC15A4 in clear cell renal cell carcinoma			[ 4 ]
Location	Body (cg06653632)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:2.54E-06; Z-score:-1.34E+00
Methylation in Case	9.19E-01 (Median)	Methylation in Control	9.41E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC15A4 in clear cell renal cell carcinoma			[ 4 ]
Location	Body (cg16782719)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:7.40E-04; Z-score:-8.80E-01
Methylation in Case	8.91E-01 (Median)	Methylation in Control	9.10E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC15A4 in clear cell renal cell carcinoma			[ 4 ]
Location	Body (cg02555727)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:1.47E-02; Z-score:-3.54E-01
Methylation in Case	9.18E-01 (Median)	Methylation in Control	9.23E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC15A4 in clear cell renal cell carcinoma			[ 4 ]
Location	Body (cg05934015)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.00E+00	Statistic Test	p-value:1.58E-02; Z-score:-2.47E-01
Methylation in Case	9.63E-01 (Median)	Methylation in Control	9.67E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC15A4 in clear cell renal cell carcinoma			[ 4 ]
Location	Body (cg02742418)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.00E+00	Statistic Test	p-value:2.37E-02; Z-score:-5.04E-01
Methylation in Case	9.73E-01 (Median)	Methylation in Control	9.77E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC15A4 in clear cell renal cell carcinoma			[ 4 ]
Location	Body (cg09035930)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.12E+00	Statistic Test	p-value:3.00E-02; Z-score:-8.32E-01
Methylation in Case	6.58E-01 (Median)	Methylation in Control	7.34E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Colorectal cancer	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC15A4 in colorectal cancer			[ 5 ]
Location	TSS1500 (cg01356908)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.13E+00	Statistic Test	p-value:2.42E-03; Z-score:5.27E-01
Methylation in Case	2.71E-01 (Median)	Methylation in Control	2.40E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC15A4 in colorectal cancer			[ 5 ]
Location	TSS1500 (cg15623519)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.31E+00	Statistic Test	p-value:1.38E-02; Z-score:1.50E+00
Methylation in Case	3.92E-01 (Median)	Methylation in Control	3.00E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC15A4 in colorectal cancer			[ 5 ]
Location	TSS200 (cg27541875)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.13E+00	Statistic Test	p-value:7.25E-03; Z-score:8.76E-01
Methylation in Case	7.39E-02 (Median)	Methylation in Control	6.56E-02 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC15A4 in colorectal cancer			[ 5 ]
Location	TSS200 (cg02278697)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.04E+00	Statistic Test	p-value:9.76E-03; Z-score:2.88E-01
Methylation in Case	8.46E-02 (Median)	Methylation in Control	8.13E-02 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC15A4 in colorectal cancer			[ 5 ]
Location	1stExon (cg09597465)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.07E+00	Statistic Test	p-value:2.19E-02; Z-score:6.48E-01
Methylation in Case	1.18E-01 (Median)	Methylation in Control	1.10E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC15A4 in colorectal cancer			[ 5 ]
Location	Body (cg19717347)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:6.83E-03; Z-score:-3.13E-01
Methylation in Case	9.07E-01 (Median)	Methylation in Control	9.16E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC15A4 in colorectal cancer			[ 5 ]
Location	Body (cg05934015)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.08E+00	Statistic Test	p-value:1.64E-02; Z-score:6.71E-01
Methylation in Case	9.12E-01 (Median)	Methylation in Control	8.45E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC15A4 in colorectal cancer			[ 5 ]
Location	Body (cg24301247)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.03E+00	Statistic Test	p-value:2.51E-02; Z-score:6.67E-01
Methylation in Case	9.11E-01 (Median)	Methylation in Control	8.80E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	18 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC15A4 in hepatocellular carcinoma			[ 6 ]
Location	TSS1500 (cg16244747)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.42E+00	Statistic Test	p-value:2.12E-15; Z-score:-9.83E+00
Methylation in Case	6.02E-01 (Median)	Methylation in Control	8.57E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC15A4 in hepatocellular carcinoma			[ 6 ]
Location	TSS1500 (cg19777783)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.19E+00	Statistic Test	p-value:2.57E-08; Z-score:-2.00E+00
Methylation in Case	4.94E-01 (Median)	Methylation in Control	5.87E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC15A4 in hepatocellular carcinoma			[ 6 ]
Location	TSS1500 (cg15623519)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.17E+00	Statistic Test	p-value:3.80E-04; Z-score:-6.23E-01
Methylation in Case	2.40E-01 (Median)	Methylation in Control	2.81E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC15A4 in hepatocellular carcinoma			[ 6 ]
Location	TSS1500 (cg01356908)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.25E+00	Statistic Test	p-value:9.42E-04; Z-score:-7.68E-01
Methylation in Case	1.09E-01 (Median)	Methylation in Control	1.37E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC15A4 in hepatocellular carcinoma			[ 6 ]
Location	TSS1500 (cg10643271)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.24E+00	Statistic Test	p-value:2.34E-03; Z-score:-8.69E-01
Methylation in Case	2.18E-01 (Median)	Methylation in Control	2.70E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC15A4 in hepatocellular carcinoma			[ 6 ]
Location	TSS1500 (cg16444942)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.09E+00	Statistic Test	p-value:1.52E-02; Z-score:-3.30E-01
Methylation in Case	1.26E-01 (Median)	Methylation in Control	1.38E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC15A4 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg22168987)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.40E+00	Statistic Test	p-value:3.37E-21; Z-score:-3.36E+00
Methylation in Case	4.46E-01 (Median)	Methylation in Control	6.26E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC15A4 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg14506366)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.29E+00	Statistic Test	p-value:4.74E-10; Z-score:-1.69E+00
Methylation in Case	5.67E-01 (Median)	Methylation in Control	7.31E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC15A4 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg09001549)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.07E+00	Statistic Test	p-value:6.88E-09; Z-score:1.18E+00
Methylation in Case	9.33E-01 (Median)	Methylation in Control	8.70E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC15A4 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg06653632)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.06E+00	Statistic Test	p-value:6.62E-08; Z-score:1.06E+00
Methylation in Case	8.39E-01 (Median)	Methylation in Control	7.90E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC15A4 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg02555727)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.03E+00	Statistic Test	p-value:4.98E-07; Z-score:7.13E-01
Methylation in Case	8.36E-01 (Median)	Methylation in Control	8.13E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of SLC15A4 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg16782719)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.05E+00	Statistic Test	p-value:4.90E-04; Z-score:6.59E-01
Methylation in Case	7.99E-01 (Median)	Methylation in Control	7.64E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon13	Methylation of SLC15A4 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg09035930)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.08E+00	Statistic Test	p-value:1.51E-03; Z-score:6.10E-01
Methylation in Case	7.85E-01 (Median)	Methylation in Control	7.28E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon14	Methylation of SLC15A4 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg05934015)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.05E+00	Statistic Test	p-value:2.81E-03; Z-score:6.46E-01
Methylation in Case	9.38E-01 (Median)	Methylation in Control	8.91E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon15	Methylation of SLC15A4 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg10189593)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:3.07E-03; Z-score:-4.50E-01
Methylation in Case	8.69E-01 (Median)	Methylation in Control	8.81E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon16	Methylation of SLC15A4 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg04356090)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.02E+00	Statistic Test	p-value:3.92E-03; Z-score:5.12E-01
Methylation in Case	9.48E-01 (Median)	Methylation in Control	9.25E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon17	Methylation of SLC15A4 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg21830849)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.01E+00	Statistic Test	p-value:1.45E-02; Z-score:4.69E-01
Methylation in Case	8.85E-01 (Median)	Methylation in Control	8.75E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon18	Methylation of SLC15A4 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg19717347)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:3.75E-02; Z-score:-2.42E-01
Methylation in Case	8.31E-01 (Median)	Methylation in Control	8.38E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
HIV infection	17 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC15A4 in HIV infection			[ 7 ]
Location	TSS1500 (cg15623519)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.25E+00	Statistic Test	p-value:1.42E-04; Z-score:1.37E+00
Methylation in Case	4.12E-01 (Median)	Methylation in Control	3.30E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC15A4 in HIV infection			[ 7 ]
Location	TSS1500 (cg01356908)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.26E+00	Statistic Test	p-value:3.37E-03; Z-score:9.49E-01
Methylation in Case	2.14E-01 (Median)	Methylation in Control	1.70E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC15A4 in HIV infection			[ 7 ]
Location	TSS1500 (cg10643271)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.10E+00	Statistic Test	p-value:1.01E-02; Z-score:5.99E-01
Methylation in Case	5.12E-01 (Median)	Methylation in Control	4.66E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC15A4 in HIV infection			[ 7 ]
Location	TSS1500 (cg19777783)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.03E+00	Statistic Test	p-value:3.72E-02; Z-score:4.87E-01
Methylation in Case	8.06E-01 (Median)	Methylation in Control	7.86E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC15A4 in HIV infection			[ 7 ]
Location	1stExon (cg09597465)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:4.55E-02; Z-score:-2.38E-01
Methylation in Case	8.60E-02 (Median)	Methylation in Control	8.94E-02 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC15A4 in HIV infection			[ 7 ]
Location	Body (cg19717347)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.66E+00	Statistic Test	p-value:1.30E-12; Z-score:4.25E+00
Methylation in Case	7.51E-01 (Median)	Methylation in Control	4.52E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC15A4 in HIV infection			[ 7 ]
Location	Body (cg24301247)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.18E+00	Statistic Test	p-value:2.55E-09; Z-score:-3.93E+00
Methylation in Case	7.06E-01 (Median)	Methylation in Control	8.32E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC15A4 in HIV infection			[ 7 ]
Location	Body (cg02742418)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.06E+00	Statistic Test	p-value:7.94E-07; Z-score:-1.79E+00
Methylation in Case	8.74E-01 (Median)	Methylation in Control	9.26E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC15A4 in HIV infection			[ 7 ]
Location	Body (cg06653632)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.13E+00	Statistic Test	p-value:2.62E-06; Z-score:-2.12E+00
Methylation in Case	7.33E-01 (Median)	Methylation in Control	8.27E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC15A4 in HIV infection			[ 7 ]
Location	Body (cg09001549)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.15E+00	Statistic Test	p-value:3.47E-06; Z-score:-2.11E+00
Methylation in Case	7.79E-01 (Median)	Methylation in Control	8.93E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC15A4 in HIV infection			[ 7 ]
Location	Body (cg24102222)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.22E+00	Statistic Test	p-value:1.90E-05; Z-score:-1.38E+00
Methylation in Case	4.50E-01 (Median)	Methylation in Control	5.48E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of SLC15A4 in HIV infection			[ 7 ]
Location	Body (cg02555727)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.07E+00	Statistic Test	p-value:3.93E-05; Z-score:-1.63E+00
Methylation in Case	7.80E-01 (Median)	Methylation in Control	8.33E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon13	Methylation of SLC15A4 in HIV infection			[ 7 ]
Location	Body (cg04356090)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:9.59E-04; Z-score:-1.00E+00
Methylation in Case	9.15E-01 (Median)	Methylation in Control	9.41E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon14	Methylation of SLC15A4 in HIV infection			[ 7 ]
Location	Body (cg09035930)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.33E+00	Statistic Test	p-value:1.03E-03; Z-score:-9.06E-01
Methylation in Case	5.17E-01 (Median)	Methylation in Control	6.87E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon15	Methylation of SLC15A4 in HIV infection			[ 7 ]
Location	Body (cg21830849)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:1.31E-02; Z-score:-4.49E-01
Methylation in Case	9.12E-01 (Median)	Methylation in Control	9.20E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon16	Methylation of SLC15A4 in HIV infection			[ 7 ]
Location	Body (cg04826413)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:2.06E-02; Z-score:-6.95E-01
Methylation in Case	8.54E-01 (Median)	Methylation in Control	8.75E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon17	Methylation of SLC15A4 in HIV infection			[ 7 ]
Location	Body (cg05934015)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:3.27E-02; Z-score:-4.12E-01
Methylation in Case	9.41E-01 (Median)	Methylation in Control	9.52E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Colon cancer	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC15A4 in colon adenocarcinoma			[ 8 ]
Location	TSS200 (cg23365801)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.12E+00	Statistic Test	p-value:2.30E-03; Z-score:1.10E+00
Methylation in Case	7.88E-01 (Median)	Methylation in Control	7.05E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC15A4 in colon adenocarcinoma			[ 8 ]
Location	Body (cg01669085)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.39E+00	Statistic Test	p-value:3.83E-07; Z-score:-6.37E+00
Methylation in Case	5.20E-01 (Median)	Methylation in Control	7.24E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC15A4 in colon adenocarcinoma			[ 8 ]
Location	Body (cg04609875)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.41E+00	Statistic Test	p-value:2.57E-06; Z-score:-3.31E+00
Methylation in Case	4.22E-01 (Median)	Methylation in Control	5.94E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC15A4 in colon adenocarcinoma			[ 8 ]
Location	Body (cg07359379)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.09E+00	Statistic Test	p-value:1.52E-04; Z-score:8.50E-01
Methylation in Case	8.07E-01 (Median)	Methylation in Control	7.39E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC15A4 in colon adenocarcinoma			[ 8 ]
Location	Body (cg05207973)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.08E+00	Statistic Test	p-value:2.19E-03; Z-score:1.25E+00
Methylation in Case	8.60E-01 (Median)	Methylation in Control	7.98E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC15A4 in colon adenocarcinoma			[ 8 ]
Location	Body (cg16397021)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.06E+00	Statistic Test	p-value:3.32E-03; Z-score:-1.80E+00
Methylation in Case	8.65E-01 (Median)	Methylation in Control	9.13E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC15A4 in colon adenocarcinoma			[ 8 ]
Location	Body (cg12589308)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.14E+00	Statistic Test	p-value:3.45E-03; Z-score:-1.35E+00
Methylation in Case	6.49E-01 (Median)	Methylation in Control	7.37E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC15A4 in colon adenocarcinoma			[ 8 ]
Location	Body (cg16395892)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:4.36E-03; Z-score:-9.29E-01
Methylation in Case	8.85E-01 (Median)	Methylation in Control	9.04E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC15A4 in systemic lupus erythematosus			[ 9 ]
Location	TSS200 (cg02278697)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:1.32E-02; Z-score:-2.29E-01
Methylation in Case	6.62E-02 (Median)	Methylation in Control	6.93E-02 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC15A4 in systemic lupus erythematosus			[ 9 ]
Location	Body (cg24102222)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.09E+00	Statistic Test	p-value:6.33E-03; Z-score:1.83E-01
Methylation in Case	6.21E-01 (Median)	Methylation in Control	5.72E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Atypical teratoid rhabdoid tumor	14 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC15A4 in atypical teratoid rhabdoid tumor			[ 10 ]
Location	1stExon (cg09597465)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.35E+00	Statistic Test	p-value:2.93E-20; Z-score:-4.11E+00
Methylation in Case	6.42E-01 (Median)	Methylation in Control	8.63E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC15A4 in atypical teratoid rhabdoid tumor			[ 10 ]
Location	Body (cg02322843)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.31E+00	Statistic Test	p-value:1.43E-04; Z-score:-1.15E+00
Methylation in Case	4.21E-01 (Median)	Methylation in Control	5.53E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC15A4 in atypical teratoid rhabdoid tumor			[ 10 ]
Location	Body (cg02555727)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.10E+00	Statistic Test	p-value:1.75E-04; Z-score:1.02E+00
Methylation in Case	7.96E-01 (Median)	Methylation in Control	7.25E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC15A4 in atypical teratoid rhabdoid tumor			[ 10 ]
Location	Body (cg02742418)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.30E+00	Statistic Test	p-value:2.24E-04; Z-score:1.05E+00
Methylation in Case	3.49E-01 (Median)	Methylation in Control	2.69E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC15A4 in atypical teratoid rhabdoid tumor			[ 10 ]
Location	Body (cg03751906)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.37E+00	Statistic Test	p-value:4.13E-04; Z-score:-9.47E-01
Methylation in Case	1.36E-01 (Median)	Methylation in Control	1.87E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC15A4 in atypical teratoid rhabdoid tumor			[ 10 ]
Location	Body (cg04043695)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.09E+00	Statistic Test	p-value:5.42E-04; Z-score:1.15E+00
Methylation in Case	8.80E-01 (Median)	Methylation in Control	8.05E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC15A4 in atypical teratoid rhabdoid tumor			[ 10 ]
Location	Body (cg04356090)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.15E+00	Statistic Test	p-value:7.37E-04; Z-score:7.18E-01
Methylation in Case	7.53E-01 (Median)	Methylation in Control	6.57E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC15A4 in atypical teratoid rhabdoid tumor			[ 10 ]
Location	Body (cg04826413)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.08E+00	Statistic Test	p-value:9.66E-04; Z-score:-8.21E-01
Methylation in Case	8.20E-01 (Median)	Methylation in Control	8.89E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC15A4 in atypical teratoid rhabdoid tumor			[ 10 ]
Location	Body (cg05934015)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.02E+00	Statistic Test	p-value:1.82E-03; Z-score:5.47E-01
Methylation in Case	8.82E-01 (Median)	Methylation in Control	8.60E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC15A4 in atypical teratoid rhabdoid tumor			[ 10 ]
Location	Body (cg06653632)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.05E+00	Statistic Test	p-value:2.72E-03; Z-score:3.13E-01
Methylation in Case	9.08E-01 (Median)	Methylation in Control	8.61E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC15A4 in atypical teratoid rhabdoid tumor			[ 10 ]
Location	Body (cg09001549)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.06E+00	Statistic Test	p-value:8.77E-03; Z-score:1.82E-01
Methylation in Case	1.98E-01 (Median)	Methylation in Control	1.88E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of SLC15A4 in atypical teratoid rhabdoid tumor			[ 10 ]
Location	Body (cg09035930)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:8.87E-03; Z-score:-8.56E-01
Methylation in Case	7.95E-01 (Median)	Methylation in Control	8.31E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon13	Methylation of SLC15A4 in atypical teratoid rhabdoid tumor			[ 10 ]
Location	Body (cg10189593)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.25E+00	Statistic Test	p-value:1.40E-02; Z-score:-6.23E-01
Methylation in Case	1.73E-01 (Median)	Methylation in Control	2.17E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon14	Methylation of SLC15A4 in atypical teratoid rhabdoid tumor			[ 10 ]
Location	3'UTR (cg15611164)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.23E+00	Statistic Test	p-value:6.55E-11; Z-score:-1.66E+00
Methylation in Case	6.20E-01 (Median)	Methylation in Control	7.61E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Panic disorder	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC15A4 in panic disorder			[ 11 ]
Location	1stExon (cg09597465)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:9.71E-01	Statistic Test	p-value:2.36E-02; Z-score:3.97E-01
Methylation in Case	-3.86E+00 (Median)	Methylation in Control	-3.98E+00 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC15A4 in panic disorder			[ 11 ]
Location	Body (cg02555727)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.10E+00	Statistic Test	p-value:1.74E-03; Z-score:5.09E-01
Methylation in Case	2.64E+00 (Median)	Methylation in Control	2.40E+00 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC15A4 in panic disorder			[ 11 ]
Location	Body (cg06653632)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.15E+00	Statistic Test	p-value:9.72E-03; Z-score:5.45E-01
Methylation in Case	2.28E+00 (Median)	Methylation in Control	1.98E+00 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC15A4 in panic disorder			[ 11 ]
Location	Body (cg19717347)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-6.30E-01	Statistic Test	p-value:1.82E-02; Z-score:-4.16E-01
Methylation in Case	-7.28E-01 (Median)	Methylation in Control	-4.59E-01 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC15A4 in panic disorder			[ 11 ]
Location	Body (cg09001549)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.15E+00	Statistic Test	p-value:2.42E-02; Z-score:5.85E-01
Methylation in Case	3.73E+00 (Median)	Methylation in Control	3.23E+00 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC15A4 in lung adenocarcinoma			[ 12 ]
Location	Body (cg03751906)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.41E+00	Statistic Test	p-value:1.91E-03; Z-score:-1.98E+00
Methylation in Case	1.82E-01 (Median)	Methylation in Control	2.58E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC15A4 in lung adenocarcinoma			[ 12 ]
Location	Body (cg24301247)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.11E+00	Statistic Test	p-value:9.43E-03; Z-score:-5.09E+00
Methylation in Case	7.41E-01 (Median)	Methylation in Control	8.21E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC15A4 in lung adenocarcinoma			[ 12 ]
Location	Body (cg06653632)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:4.36E-02; Z-score:-1.76E+00
Methylation in Case	7.97E-01 (Median)	Methylation in Control	8.34E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC15A4 in papillary thyroid cancer			[ 13 ]
Location	Body (cg21830849)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.85E+00	Statistic Test	p-value:3.31E-22; Z-score:-5.82E+00
Methylation in Case	4.61E-01 (Median)	Methylation in Control	8.51E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC15A4 in papillary thyroid cancer			[ 13 ]
Location	Body (cg03751906)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.17E+00	Statistic Test	p-value:5.52E-07; Z-score:-9.47E-01
Methylation in Case	1.15E-01 (Median)	Methylation in Control	1.34E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC15A4 in papillary thyroid cancer			[ 13 ]
Location	Body (cg09035930)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.11E+00	Statistic Test	p-value:4.28E-04; Z-score:-9.20E-01
Methylation in Case	5.70E-01 (Median)	Methylation in Control	6.33E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC15A4 in papillary thyroid cancer			[ 13 ]
Location	Body (cg02555727)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:2.84E-03; Z-score:-4.39E-01
Methylation in Case	8.93E-01 (Median)	Methylation in Control	9.02E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC15A4 in papillary thyroid cancer			[ 13 ]
Location	Body (cg16782719)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:3.12E-03; Z-score:-5.43E-01
Methylation in Case	8.43E-01 (Median)	Methylation in Control	8.64E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC15A4 in papillary thyroid cancer			[ 13 ]
Location	Body (cg06653632)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:1.79E-02; Z-score:-3.82E-01
Methylation in Case	8.95E-01 (Median)	Methylation in Control	9.08E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC15A4 in papillary thyroid cancer			[ 13 ]
Location	Body (cg04356090)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:4.33E-02; Z-score:-4.04E-01
Methylation in Case	9.10E-01 (Median)	Methylation in Control	9.23E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Prostate cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC15A4 in prostate cancer			[ 14 ]
Location	Body (cg09564802)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.04E+00	Statistic Test	p-value:3.73E-02; Z-score:3.13E+00
Methylation in Case	9.14E-01 (Median)	Methylation in Control	8.82E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
microRNA
Unclear Phenotype	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	miR-124 directly targets SLC15A4			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
miRNA Stemloop ID	miR-124	miRNA Mature ID	miR-124-3p
miRNA Sequence	UAAGGCACGCGGUGAAUGCCAA
miRNA Target Type	Direct
Experimental Material	Human cervical cancer cell line (Hela)
Epigenetic Phenomenon2	miR-151a directly targets SLC15A4			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	CLASH
miRNA Stemloop ID	miR-151a	miRNA Mature ID	miR-151a-5p
miRNA Sequence	UCGAGGAGCUCACAGUCUAGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon3	miR-186 directly targets SLC15A4			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	CLASH
miRNA Stemloop ID	miR-186	miRNA Mature ID	miR-186-5p
miRNA Sequence	CAAAGAAUUCUCCUUUUGGGCU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon4	miR-302b directly targets SLC15A4			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-302b	miRNA Mature ID	miR-302b-5p
miRNA Sequence	ACUUUAACAUGGAAGUGCUUUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon5	miR-302d directly targets SLC15A4			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-302d	miRNA Mature ID	miR-302d-5p
miRNA Sequence	ACUUUAACAUGGAGGCACUUGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon6	miR-4668 directly targets SLC15A4			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4668	miRNA Mature ID	miR-4668-3p
miRNA Sequence	GAAAAUCCUUUUUGUUUUUCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon7	miR-548c directly targets SLC15A4			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-548c	miRNA Mature ID	miR-548c-3p
miRNA Sequence	CAAAAAUCUCAAUUACUUUUGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human

References
1	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
2	DNA Methylation Dynamics in Urological Tumors.
3	Genome-wide Scan for Methylation Profiles in Breast Cancer
4	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
5	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
7	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
8	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
9	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
10	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
11	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
12	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
13	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
14	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
15	The impact of microRNAs on protein output. Nature. 2008 Sep 4;455(7209):64-71.
16	Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
17	Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature. 2009 Jul 23;460(7254):479-86.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence