Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0092 Transporter Info | ||||
| Gene Name | SLC13A2 | ||||
| Transporter Name | Sodium/dicarboxylate cotransporter 1 | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
microRNA |
|||||
|
Unclear Phenotype |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
miR-124 directly targets SLC13A2 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
|
miRNA Stemloop ID |
miR-124 | miRNA Mature ID | miR-124-3p | ||
|
miRNA Sequence |
UAAGGCACGCGGUGAAUGCCAA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
|
Methylation |
|||||
|
Obesity |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Significant hypomethylation of SLC13A2 in obesity than that in healthy individual | ||||
Studied Phenotype |
Obesity [ICD-11:5B81] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:7.88E-09; Fold-change:-0.475608421; Z-score:-3.148844346 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
| ||||
| References | |||||
|---|---|---|---|---|---|
| 1 | The impact of microRNAs on protein output. Nature. 2008 Sep 4;455(7209):64-71. | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples