General Information of Drug Transporter (DT)
DT ID DTD0089 Transporter Info
Gene Name SLC12A8
Transporter Name Cation-chloride cotransporter 9
Gene ID
84561
UniProt ID
A0AV02
Epigenetic Regulations of This DT (EGR)

Methylation

  Atypical teratoid rhabdoid tumor

         19 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC12A8 in atypical teratoid rhabdoid tumor [ 1 ]

Location

5'UTR (cg06983508)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.19E+00 Statistic Test p-value:8.04E-08; Z-score:-1.51E+00

Methylation in Case

6.62E-01 (Median) Methylation in Control 7.86E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC12A8 in atypical teratoid rhabdoid tumor [ 1 ]

Location

5'UTR (cg07405771)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:1.09E-07; Z-score:-1.35E+00

Methylation in Case

8.42E-01 (Median) Methylation in Control 8.96E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC12A8 in atypical teratoid rhabdoid tumor [ 1 ]

Location

5'UTR (cg12662091)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.40E+00 Statistic Test p-value:3.86E-07; Z-score:-1.18E+00

Methylation in Case

4.66E-01 (Median) Methylation in Control 6.51E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC12A8 in atypical teratoid rhabdoid tumor [ 1 ]

Location

5'UTR (cg20208384)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.22E+00 Statistic Test p-value:3.99E-06; Z-score:-1.03E+00

Methylation in Case

5.46E-01 (Median) Methylation in Control 6.67E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC12A8 in atypical teratoid rhabdoid tumor [ 1 ]

Location

Body (cg00087274)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:1.63E-05; Z-score:-7.30E-01

Methylation in Case

6.91E-01 (Median) Methylation in Control 7.58E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC12A8 in atypical teratoid rhabdoid tumor [ 1 ]

Location

Body (cg00316080)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.32E+00 Statistic Test p-value:2.16E-05; Z-score:-1.19E+00

Methylation in Case

5.69E-01 (Median) Methylation in Control 7.50E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC12A8 in atypical teratoid rhabdoid tumor [ 1 ]

Location

Body (cg00663396)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.31E+00 Statistic Test p-value:3.17E-05; Z-score:1.15E+00

Methylation in Case

7.85E-01 (Median) Methylation in Control 5.97E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC12A8 in atypical teratoid rhabdoid tumor [ 1 ]

Location

Body (cg01040624)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.13E+00 Statistic Test p-value:4.51E-05; Z-score:7.10E-01

Methylation in Case

8.90E-01 (Median) Methylation in Control 7.85E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC12A8 in atypical teratoid rhabdoid tumor [ 1 ]

Location

Body (cg01432055)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:6.49E-05; Z-score:-8.52E-01

Methylation in Case

8.23E-01 (Median) Methylation in Control 9.09E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC12A8 in atypical teratoid rhabdoid tumor [ 1 ]

Location

Body (cg01464473)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.18E+00 Statistic Test p-value:6.98E-05; Z-score:-7.99E-01

Methylation in Case

6.52E-01 (Median) Methylation in Control 7.66E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC12A8 in atypical teratoid rhabdoid tumor [ 1 ]

Location

Body (cg01660001)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.15E+00 Statistic Test p-value:7.68E-05; Z-score:-1.02E+00

Methylation in Case

5.61E-01 (Median) Methylation in Control 6.45E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC12A8 in atypical teratoid rhabdoid tumor [ 1 ]

Location

Body (cg06713373)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.47E+00 Statistic Test p-value:2.90E-03; Z-score:-1.14E+00

Methylation in Case

2.75E-01 (Median) Methylation in Control 4.03E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC12A8 in atypical teratoid rhabdoid tumor [ 1 ]

Location

Body (cg07279442)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.11E+00 Statistic Test p-value:3.73E-03; Z-score:5.26E-01

Methylation in Case

8.36E-01 (Median) Methylation in Control 7.56E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLC12A8 in atypical teratoid rhabdoid tumor [ 1 ]

Location

Body (cg09866143)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.00E+00 Statistic Test p-value:1.23E-02; Z-score:-2.34E-01

Methylation in Case

9.05E-01 (Median) Methylation in Control 9.09E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of SLC12A8 in atypical teratoid rhabdoid tumor [ 1 ]

Location

Body (cg11034122)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:1.99E-02; Z-score:3.94E-01

Methylation in Case

8.44E-01 (Median) Methylation in Control 8.11E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon16

Methylation of SLC12A8 in atypical teratoid rhabdoid tumor [ 1 ]

Location

Body (cg11591485)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.29E+00 Statistic Test p-value:2.33E-02; Z-score:5.77E-01

Methylation in Case

2.49E-02 (Median) Methylation in Control 1.93E-02 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon17

Methylation of SLC12A8 in atypical teratoid rhabdoid tumor [ 1 ]

Location

Body (cg12788878)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.11E+00 Statistic Test p-value:2.94E-02; Z-score:3.29E-01

Methylation in Case

9.70E-02 (Median) Methylation in Control 8.75E-02 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon18

Methylation of SLC12A8 in atypical teratoid rhabdoid tumor [ 1 ]

Location

Body (cg13691441)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:3.81E-02; Z-score:-1.78E-01

Methylation in Case

8.18E-01 (Median) Methylation in Control 8.29E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon19

Methylation of SLC12A8 in atypical teratoid rhabdoid tumor [ 1 ]

Location

3'UTR (cg11165756)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.35E+00 Statistic Test p-value:8.06E-12; Z-score:1.59E+00

Methylation in Case

6.32E-01 (Median) Methylation in Control 4.70E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Bladder cancer

         22 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC12A8 in bladder cancer [ 2 ]

Location

5'UTR (cg07405771)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.29E+00 Statistic Test p-value:3.81E-08; Z-score:-1.04E+01

Methylation in Case

5.69E-01 (Median) Methylation in Control 7.31E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC12A8 in bladder cancer [ 2 ]

Location

5'UTR (cg06983508)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.22E+00 Statistic Test p-value:1.29E-04; Z-score:-2.52E+00

Methylation in Case

3.07E-01 (Median) Methylation in Control 3.75E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC12A8 in bladder cancer [ 2 ]

Location

TSS1500 (cg25260865)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.78E+00 Statistic Test p-value:3.35E-05; Z-score:-4.75E+00

Methylation in Case

8.80E-02 (Median) Methylation in Control 2.44E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC12A8 in bladder cancer [ 2 ]

Location

TSS1500 (cg25611254)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.75E+00 Statistic Test p-value:4.49E-04; Z-score:-2.85E+00

Methylation in Case

1.36E-01 (Median) Methylation in Control 2.37E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC12A8 in bladder cancer [ 2 ]

Location

TSS1500 (cg14391622)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.65E+00 Statistic Test p-value:4.90E-04; Z-score:-3.65E+00

Methylation in Case

1.70E-01 (Median) Methylation in Control 2.81E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC12A8 in bladder cancer [ 2 ]

Location

TSS200 (cg19768599)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.62E+00 Statistic Test p-value:2.64E-04; Z-score:-3.64E+00

Methylation in Case

1.62E-01 (Median) Methylation in Control 2.62E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC12A8 in bladder cancer [ 2 ]

Location

TSS200 (cg09363539)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.41E+00 Statistic Test p-value:8.77E-03; Z-score:-2.34E+00

Methylation in Case

2.04E-01 (Median) Methylation in Control 2.89E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC12A8 in bladder cancer [ 2 ]

Location

TSS200 (cg07755390)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.37E+00 Statistic Test p-value:2.16E-02; Z-score:-1.75E+00

Methylation in Case

8.07E-02 (Median) Methylation in Control 1.10E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC12A8 in bladder cancer [ 2 ]

Location

Body (cg25213968)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.37E+00 Statistic Test p-value:1.85E-07; Z-score:1.01E+01

Methylation in Case

6.97E-01 (Median) Methylation in Control 5.08E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC12A8 in bladder cancer [ 2 ]

Location

Body (cg24838136)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.20E+00 Statistic Test p-value:1.99E-06; Z-score:5.25E+00

Methylation in Case

7.66E-01 (Median) Methylation in Control 6.39E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC12A8 in bladder cancer [ 2 ]

Location

Body (cg11591485)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.51E+00 Statistic Test p-value:1.57E-05; Z-score:5.57E+00

Methylation in Case

8.98E-01 (Median) Methylation in Control 5.94E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC12A8 in bladder cancer [ 2 ]

Location

Body (cg24984735)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.40E+00 Statistic Test p-value:4.42E-05; Z-score:-5.51E+00

Methylation in Case

5.06E-01 (Median) Methylation in Control 7.11E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC12A8 in bladder cancer [ 2 ]

Location

Body (cg01660001)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:3.41E-04; Z-score:-3.19E+00

Methylation in Case

8.77E-01 (Median) Methylation in Control 9.07E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLC12A8 in bladder cancer [ 2 ]

Location

Body (cg18741958)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.53E+00 Statistic Test p-value:1.46E-03; Z-score:-4.21E+00

Methylation in Case

2.88E-01 (Median) Methylation in Control 4.41E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of SLC12A8 in bladder cancer [ 2 ]

Location

Body (cg11034122)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.14E+00 Statistic Test p-value:8.04E-03; Z-score:2.23E+00

Methylation in Case

5.23E-01 (Median) Methylation in Control 4.57E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon16

Methylation of SLC12A8 in bladder cancer [ 2 ]

Location

Body (cg01040624)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:1.33E-02; Z-score:-1.87E+00

Methylation in Case

7.15E-01 (Median) Methylation in Control 7.59E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon17

Methylation of SLC12A8 in bladder cancer [ 2 ]

Location

Body (cg26107890)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:1.50E-02; Z-score:-6.28E-02

Methylation in Case

3.52E-02 (Median) Methylation in Control 3.90E-02 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon18

Methylation of SLC12A8 in bladder cancer [ 2 ]

Location

Body (cg12788878)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.28E+00 Statistic Test p-value:3.12E-02; Z-score:4.99E-01

Methylation in Case

1.08E-01 (Median) Methylation in Control 8.46E-02 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon19

Methylation of SLC12A8 in bladder cancer [ 2 ]

Location

Body (cg01432055)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:3.17E-02; Z-score:3.49E+00

Methylation in Case

8.81E-01 (Median) Methylation in Control 8.47E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon20

Methylation of SLC12A8 in bladder cancer [ 2 ]

Location

Body (cg07279442)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.34E+00 Statistic Test p-value:3.45E-02; Z-score:-3.99E+00

Methylation in Case

2.67E-01 (Median) Methylation in Control 3.59E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon21

Methylation of SLC12A8 in bladder cancer [ 2 ]

Location

Body (cg00087274)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.20E+00 Statistic Test p-value:3.45E-02; Z-score:-1.55E+00

Methylation in Case

5.96E-01 (Median) Methylation in Control 7.15E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon22

Methylation of SLC12A8 in bladder cancer [ 2 ]

Location

3'UTR (cg11165756)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:5.44E-03; Z-score:-2.83E+00

Methylation in Case

8.81E-01 (Median) Methylation in Control 9.02E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Breast cancer

         20 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC12A8 in breast cancer [ 3 ]

Location

5'UTR (cg07405771)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:2.60E-06; Z-score:-1.26E+00

Methylation in Case

6.98E-01 (Median) Methylation in Control 7.60E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC12A8 in breast cancer [ 3 ]

Location

5'UTR (cg12662091)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.15E+00 Statistic Test p-value:7.63E-04; Z-score:7.71E-01

Methylation in Case

9.95E-02 (Median) Methylation in Control 8.66E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC12A8 in breast cancer [ 3 ]

Location

TSS1500 (cg14391622)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.12E+00 Statistic Test p-value:1.59E-03; Z-score:1.04E+00

Methylation in Case

3.23E-01 (Median) Methylation in Control 2.87E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC12A8 in breast cancer [ 3 ]

Location

Body (cg11591485)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.58E+00 Statistic Test p-value:1.73E-35; Z-score:4.36E+00

Methylation in Case

7.59E-01 (Median) Methylation in Control 4.81E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC12A8 in breast cancer [ 3 ]

Location

Body (cg24838136)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.36E+00 Statistic Test p-value:2.53E-24; Z-score:3.26E+00

Methylation in Case

7.19E-01 (Median) Methylation in Control 5.28E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC12A8 in breast cancer [ 3 ]

Location

Body (cg25213968)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.19E+00 Statistic Test p-value:3.69E-13; Z-score:2.32E+00

Methylation in Case

6.58E-01 (Median) Methylation in Control 5.54E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC12A8 in breast cancer [ 3 ]

Location

Body (cg17478992)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.23E+00 Statistic Test p-value:1.36E-12; Z-score:-2.32E+00

Methylation in Case

6.55E-01 (Median) Methylation in Control 8.08E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC12A8 in breast cancer [ 3 ]

Location

Body (cg18253113)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.21E+00 Statistic Test p-value:1.51E-11; Z-score:2.28E+00

Methylation in Case

6.89E-01 (Median) Methylation in Control 5.68E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC12A8 in breast cancer [ 3 ]

Location

Body (cg11034122)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.36E+00 Statistic Test p-value:3.96E-08; Z-score:2.36E+00

Methylation in Case

5.27E-01 (Median) Methylation in Control 3.89E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC12A8 in breast cancer [ 3 ]

Location

Body (cg01432055)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:2.81E-07; Z-score:-1.35E+00

Methylation in Case

7.98E-01 (Median) Methylation in Control 8.56E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC12A8 in breast cancer [ 3 ]

Location

Body (cg26107890)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.09E+00 Statistic Test p-value:9.41E-07; Z-score:1.80E+00

Methylation in Case

4.85E-01 (Median) Methylation in Control 2.32E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC12A8 in breast cancer [ 3 ]

Location

Body (cg01464473)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:4.88E-06; Z-score:-1.25E+00

Methylation in Case

8.18E-01 (Median) Methylation in Control 8.66E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC12A8 in breast cancer [ 3 ]

Location

Body (cg12788878)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.58E+00 Statistic Test p-value:1.85E-04; Z-score:1.53E+00

Methylation in Case

4.14E-01 (Median) Methylation in Control 2.62E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLC12A8 in breast cancer [ 3 ]

Location

Body (cg26125625)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.20E+00 Statistic Test p-value:4.15E-03; Z-score:2.82E-01

Methylation in Case

1.94E-01 (Median) Methylation in Control 1.62E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of SLC12A8 in breast cancer [ 3 ]

Location

Body (cg06713373)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:4.25E-03; Z-score:-9.25E-01

Methylation in Case

7.82E-01 (Median) Methylation in Control 8.54E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon16

Methylation of SLC12A8 in breast cancer [ 3 ]

Location

Body (cg17997976)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.03E+00 Statistic Test p-value:6.21E-03; Z-score:4.72E-01

Methylation in Case

8.28E-01 (Median) Methylation in Control 8.02E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon17

Methylation of SLC12A8 in breast cancer [ 3 ]

Location

Body (cg18741958)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.18E+00 Statistic Test p-value:8.56E-03; Z-score:1.01E+00

Methylation in Case

5.01E-01 (Median) Methylation in Control 4.23E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon18

Methylation of SLC12A8 in breast cancer [ 3 ]

Location

Body (cg01660001)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:3.21E-02; Z-score:-5.85E-01

Methylation in Case

8.86E-01 (Median) Methylation in Control 8.97E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon19

Methylation of SLC12A8 in breast cancer [ 3 ]

Location

Body (cg00316080)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:3.34E-02; Z-score:-4.33E-01

Methylation in Case

8.00E-01 (Median) Methylation in Control 8.17E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon20

Methylation of SLC12A8 in breast cancer [ 3 ]

Location

3'UTR (cg11165756)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:1.39E-03; Z-score:-8.61E-01

Methylation in Case

8.67E-01 (Median) Methylation in Control 9.08E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Renal cell carcinoma

         12 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC12A8 in clear cell renal cell carcinoma [ 4 ]

Location

5'UTR (cg07405771)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.10E+00 Statistic Test p-value:3.21E-05; Z-score:2.24E+00

Methylation in Case

9.11E-01 (Median) Methylation in Control 8.29E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC12A8 in clear cell renal cell carcinoma [ 4 ]

Location

5'UTR (cg12662091)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.22E+00 Statistic Test p-value:1.00E-03; Z-score:8.29E-01

Methylation in Case

6.51E-02 (Median) Methylation in Control 5.33E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC12A8 in clear cell renal cell carcinoma [ 4 ]

Location

5'UTR (cg06983508)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.17E+00 Statistic Test p-value:9.08E-03; Z-score:1.31E+00

Methylation in Case

4.87E-01 (Median) Methylation in Control 4.16E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC12A8 in clear cell renal cell carcinoma [ 4 ]

Location

5'UTR (cg20208384)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.15E+00 Statistic Test p-value:1.74E-02; Z-score:6.54E-01

Methylation in Case

6.83E-02 (Median) Methylation in Control 5.92E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC12A8 in clear cell renal cell carcinoma [ 4 ]

Location

TSS1500 (cg14391622)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.21E+00 Statistic Test p-value:7.79E-03; Z-score:1.55E+00

Methylation in Case

3.84E-01 (Median) Methylation in Control 3.17E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC12A8 in clear cell renal cell carcinoma [ 4 ]

Location

TSS1500 (cg25611254)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.15E+00 Statistic Test p-value:1.35E-02; Z-score:8.23E-01

Methylation in Case

2.26E-01 (Median) Methylation in Control 1.97E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC12A8 in clear cell renal cell carcinoma [ 4 ]

Location

TSS200 (cg07755390)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.45E+00 Statistic Test p-value:5.55E-04; Z-score:6.54E-01

Methylation in Case

6.29E-02 (Median) Methylation in Control 4.34E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC12A8 in clear cell renal cell carcinoma [ 4 ]

Location

TSS200 (cg19768599)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.25E+00 Statistic Test p-value:1.00E-03; Z-score:9.18E-01

Methylation in Case

1.92E-01 (Median) Methylation in Control 1.54E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC12A8 in clear cell renal cell carcinoma [ 4 ]

Location

TSS200 (cg10747115)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.12E+00 Statistic Test p-value:1.15E-03; Z-score:7.36E-01

Methylation in Case

3.41E-02 (Median) Methylation in Control 3.04E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC12A8 in clear cell renal cell carcinoma [ 4 ]

Location

TSS200 (cg09363539)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.17E+00 Statistic Test p-value:1.19E-02; Z-score:9.62E-01

Methylation in Case

3.21E-01 (Median) Methylation in Control 2.74E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC12A8 in clear cell renal cell carcinoma [ 4 ]

Location

Body (cg26107890)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:1.20E-02; Z-score:-7.87E-02

Methylation in Case

3.43E-02 (Median) Methylation in Control 3.56E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC12A8 in clear cell renal cell carcinoma [ 4 ]

Location

Body (cg12788878)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.19E+00 Statistic Test p-value:2.15E-02; Z-score:-2.23E-01

Methylation in Case

3.77E-02 (Median) Methylation in Control 4.48E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Colon cancer

         12 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC12A8 in colon adenocarcinoma [ 5 ]

Location

5'UTR (cg14794191)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.24E+00 Statistic Test p-value:1.62E-05; Z-score:-3.92E+00

Methylation in Case

6.43E-01 (Median) Methylation in Control 8.00E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC12A8 in colon adenocarcinoma [ 5 ]

Location

5'UTR (cg00319655)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.20E+00 Statistic Test p-value:1.84E-03; Z-score:-1.01E+00

Methylation in Case

2.03E-01 (Median) Methylation in Control 2.44E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC12A8 in colon adenocarcinoma [ 5 ]

Location

TSS1500 (cg21455983)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:1.36E-03; Z-score:-1.94E+00

Methylation in Case

7.76E-01 (Median) Methylation in Control 8.27E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC12A8 in colon adenocarcinoma [ 5 ]

Location

Body (cg09811123)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.14E+00 Statistic Test p-value:1.22E-04; Z-score:6.67E+00

Methylation in Case

3.00E-01 (Median) Methylation in Control 1.40E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC12A8 in colon adenocarcinoma [ 5 ]

Location

Body (cg15275965)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.23E+00 Statistic Test p-value:1.96E-04; Z-score:-3.40E+00

Methylation in Case

6.44E-01 (Median) Methylation in Control 7.90E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC12A8 in colon adenocarcinoma [ 5 ]

Location

Body (cg13425279)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.20E+00 Statistic Test p-value:1.96E-04; Z-score:-4.13E+00

Methylation in Case

6.35E-01 (Median) Methylation in Control 7.61E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC12A8 in colon adenocarcinoma [ 5 ]

Location

Body (cg17143291)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.46E+00 Statistic Test p-value:2.12E-04; Z-score:-1.85E+00

Methylation in Case

4.28E-01 (Median) Methylation in Control 6.25E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC12A8 in colon adenocarcinoma [ 5 ]

Location

Body (cg08831522)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:1.19E-03; Z-score:-1.80E+00

Methylation in Case

7.19E-01 (Median) Methylation in Control 7.82E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC12A8 in colon adenocarcinoma [ 5 ]

Location

Body (cg14353506)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:1.82E-03; Z-score:-1.44E+00

Methylation in Case

7.18E-01 (Median) Methylation in Control 7.70E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC12A8 in colon adenocarcinoma [ 5 ]

Location

Body (cg24375085)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.24E+00 Statistic Test p-value:2.08E-03; Z-score:-1.07E+00

Methylation in Case

1.35E-01 (Median) Methylation in Control 1.68E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC12A8 in colon adenocarcinoma [ 5 ]

Location

Body (cg15035421)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.14E+00 Statistic Test p-value:2.52E-03; Z-score:-1.58E+00

Methylation in Case

5.30E-01 (Median) Methylation in Control 6.02E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC12A8 in colon adenocarcinoma [ 5 ]

Location

Body (cg01364202)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:3.25E-03; Z-score:-1.30E+00

Methylation in Case

8.55E-01 (Median) Methylation in Control 8.78E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Colorectal cancer

         13 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC12A8 in colorectal cancer [ 6 ]

Location

5'UTR (cg20208384)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:1.58E-02; Z-score:5.37E-01

Methylation in Case

1.68E-01 (Median) Methylation in Control 1.57E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC12A8 in colorectal cancer [ 6 ]

Location

5'UTR (cg12662091)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:1.87E-02; Z-score:-7.70E-01

Methylation in Case

9.99E-02 (Median) Methylation in Control 1.10E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC12A8 in colorectal cancer [ 6 ]

Location

Body (cg23250039)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:3.92E-08; Z-score:-1.72E+00

Methylation in Case

8.86E-01 (Median) Methylation in Control 9.06E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC12A8 in colorectal cancer [ 6 ]

Location

Body (cg07279442)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.36E+00 Statistic Test p-value:4.70E-06; Z-score:-1.72E+00

Methylation in Case

5.46E-01 (Median) Methylation in Control 7.41E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC12A8 in colorectal cancer [ 6 ]

Location

Body (cg26125625)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.46E+00 Statistic Test p-value:1.70E-04; Z-score:1.12E+00

Methylation in Case

4.40E-01 (Median) Methylation in Control 3.01E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC12A8 in colorectal cancer [ 6 ]

Location

Body (cg24984735)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:2.47E-03; Z-score:-4.19E-01

Methylation in Case

9.16E-01 (Median) Methylation in Control 9.22E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC12A8 in colorectal cancer [ 6 ]

Location

Body (cg12788878)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.18E+00 Statistic Test p-value:5.19E-03; Z-score:7.23E-01

Methylation in Case

7.11E-01 (Median) Methylation in Control 6.02E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC12A8 in colorectal cancer [ 6 ]

Location

Body (cg01660001)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:6.03E-03; Z-score:-7.82E-01

Methylation in Case

9.50E-01 (Median) Methylation in Control 9.55E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC12A8 in colorectal cancer [ 6 ]

Location

Body (cg17997976)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:6.77E-03; Z-score:-7.86E-01

Methylation in Case

9.36E-01 (Median) Methylation in Control 9.44E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC12A8 in colorectal cancer [ 6 ]

Location

Body (cg00663396)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.01E+00 Statistic Test p-value:1.06E-02; Z-score:4.14E-01

Methylation in Case

8.97E-01 (Median) Methylation in Control 8.90E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC12A8 in colorectal cancer [ 6 ]

Location

Body (cg26107890)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.28E+00 Statistic Test p-value:1.52E-02; Z-score:7.52E-01

Methylation in Case

7.22E-01 (Median) Methylation in Control 5.65E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC12A8 in colorectal cancer [ 6 ]

Location

Body (cg25213968)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:2.13E-02; Z-score:4.52E-01

Methylation in Case

8.29E-01 (Median) Methylation in Control 7.92E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC12A8 in colorectal cancer [ 6 ]

Location

Body (cg01040624)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:2.63E-02; Z-score:-6.08E-01

Methylation in Case

9.13E-01 (Median) Methylation in Control 9.25E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Hepatocellular carcinoma

         27 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC12A8 in hepatocellular carcinoma [ 7 ]

Location

5'UTR (cg07405771)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:9.12E-04; Z-score:-7.68E-01

Methylation in Case

7.50E-01 (Median) Methylation in Control 7.78E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC12A8 in hepatocellular carcinoma [ 7 ]

Location

5'UTR (cg06983508)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:2.94E-02; Z-score:-5.95E-01

Methylation in Case

4.10E-01 (Median) Methylation in Control 4.49E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC12A8 in hepatocellular carcinoma [ 7 ]

Location

TSS1500 (cg04104132)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.48E+00 Statistic Test p-value:1.18E-12; Z-score:3.54E+00

Methylation in Case

4.46E-01 (Median) Methylation in Control 3.00E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC12A8 in hepatocellular carcinoma [ 7 ]

Location

TSS1500 (cg20966504)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.36E+00 Statistic Test p-value:4.91E-11; Z-score:-4.04E+00

Methylation in Case

5.36E-01 (Median) Methylation in Control 7.28E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC12A8 in hepatocellular carcinoma [ 7 ]

Location

TSS1500 (cg00891176)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.15E+00 Statistic Test p-value:5.21E-11; Z-score:-4.72E+00

Methylation in Case

8.15E-01 (Median) Methylation in Control 9.36E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC12A8 in hepatocellular carcinoma [ 7 ]

Location

TSS1500 (cg12101479)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.29E+00 Statistic Test p-value:2.14E-10; Z-score:-5.46E+00

Methylation in Case

6.31E-01 (Median) Methylation in Control 8.11E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC12A8 in hepatocellular carcinoma [ 7 ]

Location

TSS1500 (cg25260865)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.52E+00 Statistic Test p-value:1.33E-03; Z-score:-1.58E+00

Methylation in Case

1.62E-01 (Median) Methylation in Control 2.47E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC12A8 in hepatocellular carcinoma [ 7 ]

Location

TSS1500 (cg25611254)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.45E+00 Statistic Test p-value:2.46E-02; Z-score:-1.23E+00

Methylation in Case

1.81E-01 (Median) Methylation in Control 2.63E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC12A8 in hepatocellular carcinoma [ 7 ]

Location

TSS200 (cg16105620)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.80E+00 Statistic Test p-value:1.86E-10; Z-score:1.97E+00

Methylation in Case

3.34E-01 (Median) Methylation in Control 1.86E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC12A8 in hepatocellular carcinoma [ 7 ]

Location

Body (cg04330389)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.36E+00 Statistic Test p-value:1.05E-15; Z-score:-1.19E+01

Methylation in Case

7.07E-01 (Median) Methylation in Control 9.64E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC12A8 in hepatocellular carcinoma [ 7 ]

Location

Body (cg10228857)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.48E+00 Statistic Test p-value:2.76E-15; Z-score:-2.33E+00

Methylation in Case

5.12E-01 (Median) Methylation in Control 7.57E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC12A8 in hepatocellular carcinoma [ 7 ]

Location

Body (cg04098547)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.56E+00 Statistic Test p-value:1.42E-14; Z-score:-3.41E+00

Methylation in Case

4.94E-01 (Median) Methylation in Control 7.69E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC12A8 in hepatocellular carcinoma [ 7 ]

Location

Body (cg11185804)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.43E+00 Statistic Test p-value:3.24E-14; Z-score:-9.77E+00

Methylation in Case

5.48E-01 (Median) Methylation in Control 7.86E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLC12A8 in hepatocellular carcinoma [ 7 ]

Location

Body (cg13701954)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.23E+00 Statistic Test p-value:5.96E-13; Z-score:-2.86E+00

Methylation in Case

5.45E-01 (Median) Methylation in Control 6.68E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of SLC12A8 in hepatocellular carcinoma [ 7 ]

Location

Body (cg10634702)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.36E+00 Statistic Test p-value:1.75E-12; Z-score:-7.77E+00

Methylation in Case

6.24E-01 (Median) Methylation in Control 8.45E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon16

Methylation of SLC12A8 in hepatocellular carcinoma [ 7 ]

Location

Body (cg15371566)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.31E+00 Statistic Test p-value:1.74E-10; Z-score:-1.86E+00

Methylation in Case

3.63E-01 (Median) Methylation in Control 4.76E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon17

Methylation of SLC12A8 in hepatocellular carcinoma [ 7 ]

Location

Body (cg11591485)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:1.36E-07; Z-score:1.25E+00

Methylation in Case

8.83E-01 (Median) Methylation in Control 8.28E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon18

Methylation of SLC12A8 in hepatocellular carcinoma [ 7 ]

Location

Body (cg25213968)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:2.17E-05; Z-score:-1.14E+00

Methylation in Case

7.40E-01 (Median) Methylation in Control 7.73E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon19

Methylation of SLC12A8 in hepatocellular carcinoma [ 7 ]

Location

Body (cg11034122)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.10E+00 Statistic Test p-value:3.09E-05; Z-score:8.50E-01

Methylation in Case

6.91E-01 (Median) Methylation in Control 6.27E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon20

Methylation of SLC12A8 in hepatocellular carcinoma [ 7 ]

Location

Body (cg24838136)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:2.09E-04; Z-score:-6.24E-01

Methylation in Case

7.85E-01 (Median) Methylation in Control 8.03E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon21

Methylation of SLC12A8 in hepatocellular carcinoma [ 7 ]

Location

Body (cg00316080)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:9.42E-03; Z-score:6.58E-01

Methylation in Case

7.89E-01 (Median) Methylation in Control 7.71E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon22

Methylation of SLC12A8 in hepatocellular carcinoma [ 7 ]

Location

Body (cg24984735)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:9.45E-03; Z-score:-5.71E-01

Methylation in Case

8.20E-01 (Median) Methylation in Control 8.39E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon23

Methylation of SLC12A8 in hepatocellular carcinoma [ 7 ]

Location

Body (cg23250039)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.44E-02; Z-score:-3.79E-01

Methylation in Case

8.62E-01 (Median) Methylation in Control 8.72E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon24

Methylation of SLC12A8 in hepatocellular carcinoma [ 7 ]

Location

Body (cg07279442)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:1.85E-02; Z-score:-4.52E-01

Methylation in Case

6.70E-01 (Median) Methylation in Control 7.01E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon25

Methylation of SLC12A8 in hepatocellular carcinoma [ 7 ]

Location

Body (cg00087274)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:2.58E-02; Z-score:-5.88E-01

Methylation in Case

7.88E-01 (Median) Methylation in Control 7.98E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon26

Methylation of SLC12A8 in hepatocellular carcinoma [ 7 ]

Location

Body (cg01040624)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:3.50E-02; Z-score:-2.35E-01

Methylation in Case

8.45E-01 (Median) Methylation in Control 8.52E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon27

Methylation of SLC12A8 in hepatocellular carcinoma [ 7 ]

Location

Body (cg17478992)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.09E+00 Statistic Test p-value:4.25E-02; Z-score:5.20E-01

Methylation in Case

7.36E-01 (Median) Methylation in Control 6.76E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  HIV infection

         19 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC12A8 in HIV infection [ 8 ]

Location

5'UTR (cg12662091)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.44E+00 Statistic Test p-value:1.12E-04; Z-score:1.68E+00

Methylation in Case

1.49E-01 (Median) Methylation in Control 1.04E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC12A8 in HIV infection [ 8 ]

Location

5'UTR (cg06983508)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.08E+00 Statistic Test p-value:1.05E-02; Z-score:8.07E-01

Methylation in Case

6.03E-01 (Median) Methylation in Control 5.60E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC12A8 in HIV infection [ 8 ]

Location

5'UTR (cg20208384)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.22E+00 Statistic Test p-value:1.51E-02; Z-score:1.17E+00

Methylation in Case

1.43E-01 (Median) Methylation in Control 1.18E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC12A8 in HIV infection [ 8 ]

Location

TSS1500 (cg14391622)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.19E+00 Statistic Test p-value:4.07E-05; Z-score:1.49E+00

Methylation in Case

4.29E-01 (Median) Methylation in Control 3.59E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC12A8 in HIV infection [ 8 ]

Location

TSS1500 (cg25611254)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.11E+00 Statistic Test p-value:9.01E-03; Z-score:4.18E-01

Methylation in Case

2.84E-01 (Median) Methylation in Control 2.56E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC12A8 in HIV infection [ 8 ]

Location

TSS200 (cg19768599)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.39E+00 Statistic Test p-value:8.00E-08; Z-score:2.17E+00

Methylation in Case

3.09E-01 (Median) Methylation in Control 2.22E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC12A8 in HIV infection [ 8 ]

Location

TSS200 (cg09363539)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.16E+00 Statistic Test p-value:1.29E-05; Z-score:9.78E-01

Methylation in Case

3.83E-01 (Median) Methylation in Control 3.29E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC12A8 in HIV infection [ 8 ]

Location

TSS200 (cg07755390)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.68E+00 Statistic Test p-value:4.04E-05; Z-score:2.15E+00

Methylation in Case

1.66E-01 (Median) Methylation in Control 9.89E-02 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC12A8 in HIV infection [ 8 ]

Location

Body (cg17478992)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.21E+00 Statistic Test p-value:3.59E-10; Z-score:-2.84E+00

Methylation in Case

6.38E-01 (Median) Methylation in Control 7.74E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC12A8 in HIV infection [ 8 ]

Location

Body (cg01432055)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:2.12E-08; Z-score:-2.79E+00

Methylation in Case

8.27E-01 (Median) Methylation in Control 9.05E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC12A8 in HIV infection [ 8 ]

Location

Body (cg06713373)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:3.10E-04; Z-score:-8.84E-01

Methylation in Case

7.68E-01 (Median) Methylation in Control 8.02E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC12A8 in HIV infection [ 8 ]

Location

Body (cg17997976)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:6.63E-04; Z-score:7.92E-01

Methylation in Case

8.82E-01 (Median) Methylation in Control 8.63E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC12A8 in HIV infection [ 8 ]

Location

Body (cg13691441)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.01E+00 Statistic Test p-value:3.25E-03; Z-score:4.19E-01

Methylation in Case

9.50E-01 (Median) Methylation in Control 9.41E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLC12A8 in HIV infection [ 8 ]

Location

Body (cg11034122)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:3.58E-03; Z-score:7.36E-01

Methylation in Case

9.02E-01 (Median) Methylation in Control 8.85E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of SLC12A8 in HIV infection [ 8 ]

Location

Body (cg00087274)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:6.64E-03; Z-score:5.29E-01

Methylation in Case

7.93E-01 (Median) Methylation in Control 7.80E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon16

Methylation of SLC12A8 in HIV infection [ 8 ]

Location

Body (cg11591485)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.01E+00 Statistic Test p-value:2.17E-02; Z-score:3.05E-01

Methylation in Case

9.35E-01 (Median) Methylation in Control 9.27E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon17

Methylation of SLC12A8 in HIV infection [ 8 ]

Location

Body (cg00316080)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:2.49E-02; Z-score:5.87E-01

Methylation in Case

8.39E-01 (Median) Methylation in Control 8.18E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon18

Methylation of SLC12A8 in HIV infection [ 8 ]

Location

Body (cg26125625)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.27E+00 Statistic Test p-value:2.60E-02; Z-score:6.62E-01

Methylation in Case

1.89E-02 (Median) Methylation in Control 1.48E-02 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon19

Methylation of SLC12A8 in HIV infection [ 8 ]

Location

3'UTR (cg11165756)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:3.50E-02; Z-score:-5.07E-01

Methylation in Case

9.02E-01 (Median) Methylation in Control 9.13E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Lung adenocarcinoma

         13 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC12A8 in lung adenocarcinoma [ 9 ]

Location

5'UTR (cg12662091)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.38E+00 Statistic Test p-value:8.58E-03; Z-score:3.20E+00

Methylation in Case

1.70E-01 (Median) Methylation in Control 1.23E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC12A8 in lung adenocarcinoma [ 9 ]

Location

5'UTR (cg06983508)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.14E+00 Statistic Test p-value:9.97E-03; Z-score:1.52E+00

Methylation in Case

5.62E-01 (Median) Methylation in Control 4.94E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC12A8 in lung adenocarcinoma [ 9 ]

Location

5'UTR (cg07405771)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:1.37E-02; Z-score:1.22E+00

Methylation in Case

7.68E-01 (Median) Methylation in Control 7.32E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC12A8 in lung adenocarcinoma [ 9 ]

Location

5'UTR (cg20208384)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.06E+00 Statistic Test p-value:4.03E-02; Z-score:6.47E-01

Methylation in Case

1.64E-01 (Median) Methylation in Control 1.54E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC12A8 in lung adenocarcinoma [ 9 ]

Location

TSS1500 (cg14391622)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.19E+00 Statistic Test p-value:2.32E-02; Z-score:2.66E+00

Methylation in Case

4.56E-01 (Median) Methylation in Control 3.84E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC12A8 in lung adenocarcinoma [ 9 ]

Location

Body (cg17478992)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:8.73E-04; Z-score:-1.97E+00

Methylation in Case

6.90E-01 (Median) Methylation in Control 7.64E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC12A8 in lung adenocarcinoma [ 9 ]

Location

Body (cg23250039)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:1.23E-02; Z-score:-1.98E+00

Methylation in Case

7.94E-01 (Median) Methylation in Control 8.16E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC12A8 in lung adenocarcinoma [ 9 ]

Location

Body (cg01040624)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:2.03E-02; Z-score:-2.72E+00

Methylation in Case

8.37E-01 (Median) Methylation in Control 8.83E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC12A8 in lung adenocarcinoma [ 9 ]

Location

Body (cg11034122)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.23E+00 Statistic Test p-value:2.18E-02; Z-score:1.97E+00

Methylation in Case

7.50E-01 (Median) Methylation in Control 6.09E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC12A8 in lung adenocarcinoma [ 9 ]

Location

Body (cg00316080)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:3.38E-02; Z-score:-1.71E+00

Methylation in Case

8.17E-01 (Median) Methylation in Control 8.54E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC12A8 in lung adenocarcinoma [ 9 ]

Location

Body (cg01432055)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:3.42E-02; Z-score:-1.70E+00

Methylation in Case

7.90E-01 (Median) Methylation in Control 8.48E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC12A8 in lung adenocarcinoma [ 9 ]

Location

Body (cg12788878)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.62E+00 Statistic Test p-value:3.92E-02; Z-score:1.15E+01

Methylation in Case

2.22E-01 (Median) Methylation in Control 8.50E-02 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC12A8 in lung adenocarcinoma [ 9 ]

Location

Body (cg26107890)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.88E+00 Statistic Test p-value:3.93E-02; Z-score:1.18E+01

Methylation in Case

1.88E-01 (Median) Methylation in Control 6.52E-02 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Pancretic ductal adenocarcinoma

         15 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC12A8 in pancretic ductal adenocarcinoma [ 10 ]

Location

5'UTR (cg14957718)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.50E+00 Statistic Test p-value:7.15E-14; Z-score:1.61E+00

Methylation in Case

7.98E-02 (Median) Methylation in Control 5.31E-02 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC12A8 in pancretic ductal adenocarcinoma [ 10 ]

Location

5'UTR (cg03046812)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.12E+00 Statistic Test p-value:1.01E-04; Z-score:4.18E-01

Methylation in Case

1.11E-01 (Median) Methylation in Control 9.89E-02 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC12A8 in pancretic ductal adenocarcinoma [ 10 ]

Location

TSS1500 (cg25963980)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.23E+00 Statistic Test p-value:8.77E-12; Z-score:2.41E+00

Methylation in Case

4.65E-01 (Median) Methylation in Control 3.78E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC12A8 in pancretic ductal adenocarcinoma [ 10 ]

Location

TSS1500 (cg07052880)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.28E-04; Z-score:-6.08E-01

Methylation in Case

8.70E-01 (Median) Methylation in Control 8.77E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC12A8 in pancretic ductal adenocarcinoma [ 10 ]

Location

TSS1500 (cg02011918)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:7.64E-04; Z-score:-6.68E-01

Methylation in Case

9.10E-02 (Median) Methylation in Control 9.96E-02 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC12A8 in pancretic ductal adenocarcinoma [ 10 ]

Location

TSS1500 (cg26622895)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.18E+00 Statistic Test p-value:1.68E-03; Z-score:1.04E+00

Methylation in Case

6.92E-01 (Median) Methylation in Control 5.86E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC12A8 in pancretic ductal adenocarcinoma [ 10 ]

Location

TSS200 (cg16269048)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.46E+00 Statistic Test p-value:4.18E-18; Z-score:2.33E+00

Methylation in Case

2.09E-01 (Median) Methylation in Control 1.43E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC12A8 in pancretic ductal adenocarcinoma [ 10 ]

Location

TSS200 (cg26319800)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.03E+00 Statistic Test p-value:1.33E-02; Z-score:9.53E-01

Methylation in Case

8.80E-01 (Median) Methylation in Control 8.56E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC12A8 in pancretic ductal adenocarcinoma [ 10 ]

Location

TSS200 (cg22469836)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:4.57E-02; Z-score:-3.78E-01

Methylation in Case

3.88E-02 (Median) Methylation in Control 4.31E-02 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC12A8 in pancretic ductal adenocarcinoma [ 10 ]

Location

Body (cg00532936)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.33E+00 Statistic Test p-value:2.26E-10; Z-score:-2.00E+00

Methylation in Case

5.46E-01 (Median) Methylation in Control 7.24E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC12A8 in pancretic ductal adenocarcinoma [ 10 ]

Location

Body (cg14718495)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:2.36E-06; Z-score:-7.92E-01

Methylation in Case

8.32E-01 (Median) Methylation in Control 8.49E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC12A8 in pancretic ductal adenocarcinoma [ 10 ]

Location

Body (cg27649194)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.12E+00 Statistic Test p-value:3.94E-05; Z-score:9.39E-01

Methylation in Case

4.64E-01 (Median) Methylation in Control 4.12E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC12A8 in pancretic ductal adenocarcinoma [ 10 ]

Location

Body (cg16300329)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:7.37E-04; Z-score:-7.21E-01

Methylation in Case

7.57E-01 (Median) Methylation in Control 7.90E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLC12A8 in pancretic ductal adenocarcinoma [ 10 ]

Location

Body (cg01788205)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:1.12E-03; Z-score:8.10E-01

Methylation in Case

8.45E-01 (Median) Methylation in Control 8.12E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of SLC12A8 in pancretic ductal adenocarcinoma [ 10 ]

Location

Body (cg19107578)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.11E+00 Statistic Test p-value:1.42E-02; Z-score:8.68E-01

Methylation in Case

5.40E-01 (Median) Methylation in Control 4.87E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Prostate cancer

           6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC12A8 in prostate cancer [ 11 ]

Location

5'UTR (cg03721454)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.35E+00 Statistic Test p-value:4.82E-02; Z-score:-5.37E+00

Methylation in Case

5.33E-01 (Median) Methylation in Control 7.17E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC12A8 in prostate cancer [ 11 ]

Location

TSS1500 (cg02516845)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.09E+00 Statistic Test p-value:2.56E-03; Z-score:3.30E+00

Methylation in Case

9.01E-01 (Median) Methylation in Control 8.30E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC12A8 in prostate cancer [ 11 ]

Location

TSS1500 (cg17218342)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.52E+00 Statistic Test p-value:1.26E-02; Z-score:-5.80E+00

Methylation in Case

5.26E-01 (Median) Methylation in Control 8.01E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC12A8 in prostate cancer [ 11 ]

Location

TSS200 (cg11207307)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.52E+00 Statistic Test p-value:1.44E-02; Z-score:2.31E+00

Methylation in Case

5.73E-01 (Median) Methylation in Control 3.77E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC12A8 in prostate cancer [ 11 ]

Location

Body (cg13459035)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.57E+00 Statistic Test p-value:1.75E-03; Z-score:4.74E+00

Methylation in Case

7.57E-01 (Median) Methylation in Control 4.82E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC12A8 in prostate cancer [ 11 ]

Location

Body (cg04431596)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.01E+00 Statistic Test p-value:1.85E-02; Z-score:2.51E+00

Methylation in Case

9.45E-01 (Median) Methylation in Control 9.33E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Systemic lupus erythematosus

           6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC12A8 in systemic lupus erythematosus [ 12 ]

Location

5'UTR (cg12662091)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:4.94E-02; Z-score:1.86E-01

Methylation in Case

1.09E-01 (Median) Methylation in Control 1.04E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC12A8 in systemic lupus erythematosus [ 12 ]

Location

TSS200 (cg10747115)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:3.94E-02; Z-score:2.41E-01

Methylation in Case

5.00E-02 (Median) Methylation in Control 4.76E-02 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC12A8 in systemic lupus erythematosus [ 12 ]

Location

Body (cg07279442)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:2.01E-03; Z-score:-2.03E-01

Methylation in Case

8.42E-01 (Median) Methylation in Control 8.49E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC12A8 in systemic lupus erythematosus [ 12 ]

Location

Body (cg00663396)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:9.73E-03; Z-score:-2.44E-01

Methylation in Case

9.03E-01 (Median) Methylation in Control 9.09E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC12A8 in systemic lupus erythematosus [ 12 ]

Location

Body (cg12788878)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:1.98E-02; Z-score:-1.30E-01

Methylation in Case

7.63E-02 (Median) Methylation in Control 7.85E-02 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC12A8 in systemic lupus erythematosus [ 12 ]

Location

Body (cg24838136)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:2.95E-02; Z-score:-1.73E-01

Methylation in Case

8.76E-01 (Median) Methylation in Control 8.83E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Panic disorder

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC12A8 in panic disorder [ 13 ]

Location

TSS200 (cg19768599)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-9.21E-01 Statistic Test p-value:1.13E-02; Z-score:-4.20E-01

Methylation in Case

-2.22E+00 (Median) Methylation in Control -2.04E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC12A8 in panic disorder [ 13 ]

Location

Body (cg06713373)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.11E+00 Statistic Test p-value:5.89E-04; Z-score:6.40E-01

Methylation in Case

2.42E+00 (Median) Methylation in Control 2.19E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC12A8 in panic disorder [ 13 ]

Location

Body (cg11034122)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:2.18E-02; Z-score:-2.64E-01

Methylation in Case

2.93E+00 (Median) Methylation in Control 3.04E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC12A8 in panic disorder [ 13 ]

Location

Body (cg00663396)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:3.06E-02; Z-score:-4.23E-01

Methylation in Case

4.14E+00 (Median) Methylation in Control 4.27E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

         12 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC12A8 in papillary thyroid cancer [ 14 ]

Location

Body (cg11034122)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.32E+00 Statistic Test p-value:1.67E-11; Z-score:-2.86E+00

Methylation in Case

5.11E-01 (Median) Methylation in Control 6.74E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC12A8 in papillary thyroid cancer [ 14 ]

Location

Body (cg11591485)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.06E+00 Statistic Test p-value:1.13E-09; Z-score:1.72E+00

Methylation in Case

8.55E-01 (Median) Methylation in Control 8.04E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC12A8 in papillary thyroid cancer [ 14 ]

Location

Body (cg24984735)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:1.08E-06; Z-score:-1.38E+00

Methylation in Case

8.79E-01 (Median) Methylation in Control 9.06E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC12A8 in papillary thyroid cancer [ 14 ]

Location

Body (cg00316080)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:3.33E-05; Z-score:-1.02E+00

Methylation in Case

8.58E-01 (Median) Methylation in Control 8.84E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC12A8 in papillary thyroid cancer [ 14 ]

Location

Body (cg01432055)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:4.08E-05; Z-score:-1.11E+00

Methylation in Case

8.89E-01 (Median) Methylation in Control 9.17E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC12A8 in papillary thyroid cancer [ 14 ]

Location

Body (cg12788878)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.14E+00 Statistic Test p-value:2.58E-04; Z-score:9.31E-01

Methylation in Case

4.13E-01 (Median) Methylation in Control 3.62E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC12A8 in papillary thyroid cancer [ 14 ]

Location

Body (cg18253113)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:1.05E-03; Z-score:-6.76E-01

Methylation in Case

7.88E-01 (Median) Methylation in Control 8.18E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC12A8 in papillary thyroid cancer [ 14 ]

Location

Body (cg25213968)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:1.21E-03; Z-score:-7.13E-01

Methylation in Case

6.01E-01 (Median) Methylation in Control 6.36E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC12A8 in papillary thyroid cancer [ 14 ]

Location

Body (cg01660001)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.33E-03; Z-score:-9.43E-01

Methylation in Case

9.36E-01 (Median) Methylation in Control 9.44E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC12A8 in papillary thyroid cancer [ 14 ]

Location

Body (cg17478992)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:1.98E-02; Z-score:-4.29E-01

Methylation in Case

8.50E-01 (Median) Methylation in Control 8.73E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC12A8 in papillary thyroid cancer [ 14 ]

Location

Body (cg01040624)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.00E+00 Statistic Test p-value:4.81E-02; Z-score:-1.12E-01

Methylation in Case

8.56E-01 (Median) Methylation in Control 8.60E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC12A8 in papillary thyroid cancer [ 14 ]

Location

3'UTR (cg11165756)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:3.81E-03; Z-score:-5.35E-01

Methylation in Case

9.35E-01 (Median) Methylation in Control 9.41E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

microRNA

  Unclear Phenotype

         13 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-1227 directly targets SLC12A8 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1227 miRNA Mature ID miR-1227-3p

miRNA Sequence

CGUGCCACCCUUUUCCCCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon2

miR-2467 directly targets SLC12A8 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-2467 miRNA Mature ID miR-2467-3p

miRNA Sequence

AGCAGAGGCAGAGAGGCUCAGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon3

miR-377 directly targets SLC12A8 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-377 miRNA Mature ID miR-377-5p

miRNA Sequence

AGAGGUUGCCCUUGGUGAAUUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon4

miR-425 directly targets SLC12A8 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-425 miRNA Mature ID miR-425-3p

miRNA Sequence

AUCGGGAAUGUCGUGUCCGCCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon5

miR-4252 directly targets SLC12A8 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4252 miRNA Mature ID miR-4252

miRNA Sequence

GGCCACUGAGUCAGCACCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon6

miR-4257 directly targets SLC12A8 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4257 miRNA Mature ID miR-4257

miRNA Sequence

CCAGAGGUGGGGACUGAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon7

miR-455 directly targets SLC12A8 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-455 miRNA Mature ID miR-455-3p

miRNA Sequence

GCAGUCCAUGGGCAUAUACAC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon8

miR-4680 directly targets SLC12A8 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4680 miRNA Mature ID miR-4680-5p

miRNA Sequence

AGAACUCUUGCAGUCUUAGAUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon9

miR-6086 directly targets SLC12A8 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6086 miRNA Mature ID miR-6086

miRNA Sequence

GGAGGUUGGGAAGGGCAGAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon10

miR-6499 directly targets SLC12A8 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6499 miRNA Mature ID miR-6499-3p

miRNA Sequence

AGCAGUGUUUGUUUUGCCCACA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon11

miR-6516 directly targets SLC12A8 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6516 miRNA Mature ID miR-6516-5p

miRNA Sequence

UUUGCAGUAACAGGUGUGAGCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon12

miR-6807 directly targets SLC12A8 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6807 miRNA Mature ID miR-6807-5p

miRNA Sequence

GUGAGCCAGUGGAAUGGAGAGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon13

miR-6828 directly targets SLC12A8 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6828 miRNA Mature ID miR-6828-5p

miRNA Sequence

AGGAAGCAAGAGAACCCUGUGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human
References
1 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2 DNA Methylation Dynamics in Urological Tumors.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
5 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
6 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
7 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
8 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
9 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
10 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
11 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
12 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
13 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
14 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
15 The Landscape of microRNA Targeting in Prostate Cancer Defined by AGO-PAR-CLIP. Neoplasia. 2016 Jun;18(6):356-70.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.