Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0086 Transporter Info
Gene Name	SLC12A5
Transporter Name	Electroneutral potassium-chloride cotransporter 2
Gene ID	57468
UniProt ID	Q9H2X9

Epigenetic Regulations of This DT (EGR)
Methylation
Colon cancer	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC12A5 in colon adenocarcinoma			[ 1 ]
Location	5'UTR (cg17846334)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:3.05E+00	Statistic Test	p-value:2.13E-08; Z-score:6.03E+00
Methylation in Case	4.75E-01 (Median)	Methylation in Control	1.56E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC12A5 in colon adenocarcinoma			[ 1 ]
Location	5'UTR (cg22115748)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.16E+00	Statistic Test	p-value:2.90E-03; Z-score:-1.99E+00
Methylation in Case	4.70E-01 (Median)	Methylation in Control	5.45E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC12A5 in colon adenocarcinoma			[ 1 ]
Location	TSS200 (cg06750832)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.57E+00	Statistic Test	p-value:1.06E-08; Z-score:2.40E+00
Methylation in Case	5.38E-01 (Median)	Methylation in Control	2.09E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC12A5 in colon adenocarcinoma			[ 1 ]
Location	TSS200 (cg22988581)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.18E+00	Statistic Test	p-value:2.96E-03; Z-score:-1.32E+00
Methylation in Case	2.90E-01 (Median)	Methylation in Control	3.43E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC12A5 in colon adenocarcinoma			[ 1 ]
Location	1stExon (cg16435571)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.58E+00	Statistic Test	p-value:5.37E-07; Z-score:2.31E+00
Methylation in Case	4.99E-01 (Median)	Methylation in Control	3.17E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC12A5 in colon adenocarcinoma			[ 1 ]
Location	1stExon (cg22049569)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.87E+00	Statistic Test	p-value:2.52E-06; Z-score:2.34E+00
Methylation in Case	4.00E-01 (Median)	Methylation in Control	2.13E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC12A5 in hepatocellular carcinoma			[ 2 ]
Location	5'UTR (cg06852309)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.36E+00	Statistic Test	p-value:2.60E-13; Z-score:-2.72E+00
Methylation in Case	4.36E-01 (Median)	Methylation in Control	5.93E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC12A5 in hepatocellular carcinoma			[ 2 ]
Location	TSS1500 (cg09595245)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.10E+00	Statistic Test	p-value:1.39E-04; Z-score:-7.08E-01
Methylation in Case	7.16E-01 (Median)	Methylation in Control	7.86E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC12A5 in hepatocellular carcinoma			[ 2 ]
Location	TSS200 (cg21609339)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.61E+00	Statistic Test	p-value:2.72E-06; Z-score:4.82E+00
Methylation in Case	3.39E-01 (Median)	Methylation in Control	2.11E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC12A5 in hepatocellular carcinoma			[ 2 ]
Location	TSS200 (cg23463144)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.32E+00	Statistic Test	p-value:2.25E-05; Z-score:1.49E+00
Methylation in Case	9.72E-02 (Median)	Methylation in Control	7.35E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC12A5 in hepatocellular carcinoma			[ 2 ]
Location	TSS200 (cg04980291)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.14E+00	Statistic Test	p-value:1.15E-04; Z-score:5.87E-01
Methylation in Case	1.09E-01 (Median)	Methylation in Control	9.59E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC12A5 in hepatocellular carcinoma			[ 2 ]
Location	1stExon (cg14921743)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.38E+00	Statistic Test	p-value:1.54E-06; Z-score:1.69E+00
Methylation in Case	5.92E-02 (Median)	Methylation in Control	2.49E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC12A5 in hepatocellular carcinoma			[ 2 ]
Location	Body (cg05654361)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.29E+00	Statistic Test	p-value:4.47E-10; Z-score:-4.78E+00
Methylation in Case	5.60E-01 (Median)	Methylation in Control	7.21E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC12A5 in hepatocellular carcinoma			[ 2 ]
Location	Body (cg01160557)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.98E+00	Statistic Test	p-value:1.62E-09; Z-score:-2.01E+00
Methylation in Case	1.55E-01 (Median)	Methylation in Control	3.07E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC12A5 in hepatocellular carcinoma			[ 2 ]
Location	Body (cg12832857)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:2.51E-02; Z-score:-7.59E-02
Methylation in Case	7.97E-02 (Median)	Methylation in Control	8.22E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC12A5 in pancretic ductal adenocarcinoma			[ 3 ]
Location	5'UTR (cg19755318)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.49E+00	Statistic Test	p-value:2.93E-16; Z-score:1.77E+00
Methylation in Case	1.77E-01 (Median)	Methylation in Control	1.19E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC12A5 in pancretic ductal adenocarcinoma			[ 3 ]
Location	5'UTR (cg19464780)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.07E+00	Statistic Test	p-value:9.82E-09; Z-score:-1.58E+00
Methylation in Case	8.01E-01 (Median)	Methylation in Control	8.61E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC12A5 in pancretic ductal adenocarcinoma			[ 3 ]
Location	TSS200 (cg08288703)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.22E+00	Statistic Test	p-value:1.18E-09; Z-score:-1.45E+00
Methylation in Case	3.98E-01 (Median)	Methylation in Control	4.85E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC12A5 in pancretic ductal adenocarcinoma			[ 3 ]
Location	TSS200 (cg24707219)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:5.54E-03; Z-score:-3.67E-01
Methylation in Case	5.71E-01 (Median)	Methylation in Control	6.01E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC12A5 in pancretic ductal adenocarcinoma			[ 3 ]
Location	Body (cg25945642)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.22E+00	Statistic Test	p-value:1.81E-09; Z-score:-1.81E+00
Methylation in Case	5.84E-01 (Median)	Methylation in Control	7.11E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC12A5 in pancretic ductal adenocarcinoma			[ 3 ]
Location	Body (cg17332016)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.08E+00	Statistic Test	p-value:1.29E-04; Z-score:-2.90E-01
Methylation in Case	5.31E-02 (Median)	Methylation in Control	5.73E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC12A5 in pancretic ductal adenocarcinoma			[ 3 ]
Location	Body (cg04135385)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.04E+00	Statistic Test	p-value:1.94E-02; Z-score:8.03E-01
Methylation in Case	8.50E-01 (Median)	Methylation in Control	8.20E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC12A5 in pancretic ductal adenocarcinoma			[ 3 ]
Location	Body (cg11244695)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:4.88E-02; Z-score:-3.75E-01
Methylation in Case	8.84E-01 (Median)	Methylation in Control	8.99E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Prostate cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC12A5 in prostate cancer			[ 4 ]
Location	5'UTR (cg03363743)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.71E+00	Statistic Test	p-value:5.95E-03; Z-score:2.65E+00
Methylation in Case	5.81E-01 (Median)	Methylation in Control	3.41E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC12A5 in prostate cancer			[ 4 ]
Location	TSS200 (cg25963505)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.20E+00	Statistic Test	p-value:5.80E-03; Z-score:2.71E+00
Methylation in Case	8.80E-01 (Median)	Methylation in Control	7.34E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC12A5 in prostate cancer			[ 4 ]
Location	1stExon (cg13348944)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.95E+00	Statistic Test	p-value:1.16E-02; Z-score:7.27E+00
Methylation in Case	6.24E-01 (Median)	Methylation in Control	3.20E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC12A5 in prostate cancer			[ 4 ]
Location	Body (cg22882121)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.50E+00	Statistic Test	p-value:1.32E-02; Z-score:-2.54E+00
Methylation in Case	4.36E-01 (Median)	Methylation in Control	6.52E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Bladder cancer	10 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC12A5 in bladder cancer			[ 5 ]
Location	TSS1500 (cg04539957)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.28E+00	Statistic Test	p-value:1.67E-08; Z-score:6.73E+00
Methylation in Case	7.48E-01 (Median)	Methylation in Control	5.86E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC12A5 in bladder cancer			[ 5 ]
Location	TSS1500 (cg09595245)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.20E+00	Statistic Test	p-value:7.80E-05; Z-score:-4.94E+00
Methylation in Case	7.16E-01 (Median)	Methylation in Control	8.61E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC12A5 in bladder cancer			[ 5 ]
Location	TSS200 (cg17920479)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.21E+00	Statistic Test	p-value:3.94E-09; Z-score:9.95E+00
Methylation in Case	4.54E-01 (Median)	Methylation in Control	2.05E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC12A5 in bladder cancer			[ 5 ]
Location	TSS200 (cg07191594)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.81E+00	Statistic Test	p-value:2.62E-07; Z-score:1.06E+01
Methylation in Case	3.99E-01 (Median)	Methylation in Control	2.20E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC12A5 in bladder cancer			[ 5 ]
Location	TSS200 (cg21609339)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.85E+00	Statistic Test	p-value:9.28E-06; Z-score:7.35E+00
Methylation in Case	3.16E-01 (Median)	Methylation in Control	1.71E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC12A5 in bladder cancer			[ 5 ]
Location	TSS200 (cg23463144)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.58E+00	Statistic Test	p-value:9.05E-05; Z-score:9.25E+00
Methylation in Case	6.82E-02 (Median)	Methylation in Control	4.32E-02 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC12A5 in bladder cancer			[ 5 ]
Location	TSS200 (cg04980291)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.34E+00	Statistic Test	p-value:5.76E-04; Z-score:2.73E+00
Methylation in Case	9.84E-02 (Median)	Methylation in Control	7.37E-02 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC12A5 in bladder cancer			[ 5 ]
Location	1stExon (cg14921743)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.73E+00	Statistic Test	p-value:2.45E-04; Z-score:8.17E+00
Methylation in Case	7.53E-02 (Median)	Methylation in Control	2.76E-02 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC12A5 in bladder cancer			[ 5 ]
Location	Body (cg23274660)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-4.26E+00	Statistic Test	p-value:3.22E-08; Z-score:-8.72E+00
Methylation in Case	9.33E-02 (Median)	Methylation in Control	3.98E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC12A5 in bladder cancer			[ 5 ]
Location	Body (cg01160557)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.36E+00	Statistic Test	p-value:2.36E-03; Z-score:-2.15E+00
Methylation in Case	8.41E-02 (Median)	Methylation in Control	1.15E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Breast cancer	11 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC12A5 in breast cancer			[ 6 ]
Location	TSS1500 (cg04539957)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.15E+00	Statistic Test	p-value:6.56E-13; Z-score:1.76E+00
Methylation in Case	7.18E-01 (Median)	Methylation in Control	6.23E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC12A5 in breast cancer			[ 6 ]
Location	TSS200 (cg17920479)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.75E+00	Statistic Test	p-value:1.16E-17; Z-score:4.10E+00
Methylation in Case	3.98E-01 (Median)	Methylation in Control	2.28E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC12A5 in breast cancer			[ 6 ]
Location	TSS200 (cg07191594)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.58E+00	Statistic Test	p-value:1.93E-17; Z-score:3.37E+00
Methylation in Case	3.59E-01 (Median)	Methylation in Control	2.27E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC12A5 in breast cancer			[ 6 ]
Location	TSS200 (cg21609339)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.55E+00	Statistic Test	p-value:2.02E-13; Z-score:3.12E+00
Methylation in Case	2.71E-01 (Median)	Methylation in Control	1.75E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC12A5 in breast cancer			[ 6 ]
Location	TSS200 (cg04980291)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.26E+00	Statistic Test	p-value:8.77E-06; Z-score:7.89E-01
Methylation in Case	9.86E-02 (Median)	Methylation in Control	7.84E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC12A5 in breast cancer			[ 6 ]
Location	TSS200 (cg23463144)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.28E+00	Statistic Test	p-value:9.81E-06; Z-score:9.26E-01
Methylation in Case	6.60E-02 (Median)	Methylation in Control	5.16E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC12A5 in breast cancer			[ 6 ]
Location	1stExon (cg14921743)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.38E+00	Statistic Test	p-value:4.25E-07; Z-score:2.03E-01
Methylation in Case	2.56E-02 (Median)	Methylation in Control	1.86E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC12A5 in breast cancer			[ 6 ]
Location	Body (cg23274660)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.35E+00	Statistic Test	p-value:1.60E-05; Z-score:-8.88E-01
Methylation in Case	1.83E-01 (Median)	Methylation in Control	2.47E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC12A5 in breast cancer			[ 6 ]
Location	Body (cg01160557)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.75E+00	Statistic Test	p-value:1.61E-03; Z-score:-1.46E+00
Methylation in Case	9.54E-02 (Median)	Methylation in Control	1.67E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC12A5 in breast cancer			[ 6 ]
Location	Body (cg23508607)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:1.85E-02; Z-score:-3.48E-02
Methylation in Case	6.96E-02 (Median)	Methylation in Control	7.02E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC12A5 in breast cancer			[ 6 ]
Location	Body (cg12832857)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.32E+00	Statistic Test	p-value:4.18E-02; Z-score:4.60E-01
Methylation in Case	7.68E-02 (Median)	Methylation in Control	5.82E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Renal cell carcinoma	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC12A5 in clear cell renal cell carcinoma			[ 7 ]
Location	TSS1500 (cg04539957)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.17E+00	Statistic Test	p-value:1.45E-07; Z-score:2.89E+00
Methylation in Case	8.51E-01 (Median)	Methylation in Control	7.26E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC12A5 in clear cell renal cell carcinoma			[ 7 ]
Location	TSS200 (cg07191594)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.88E+00	Statistic Test	p-value:3.79E-12; Z-score:4.28E+00
Methylation in Case	3.65E-01 (Median)	Methylation in Control	1.94E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC12A5 in clear cell renal cell carcinoma			[ 7 ]
Location	TSS200 (cg17920479)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.16E+00	Statistic Test	p-value:1.50E-10; Z-score:4.51E+00
Methylation in Case	4.08E-01 (Median)	Methylation in Control	1.89E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC12A5 in clear cell renal cell carcinoma			[ 7 ]
Location	TSS200 (cg21609339)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.40E+00	Statistic Test	p-value:2.53E-06; Z-score:1.75E+00
Methylation in Case	2.14E-01 (Median)	Methylation in Control	1.53E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC12A5 in clear cell renal cell carcinoma			[ 7 ]
Location	TSS200 (cg23463144)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.30E+00	Statistic Test	p-value:1.97E-02; Z-score:9.51E-01
Methylation in Case	2.52E-02 (Median)	Methylation in Control	1.94E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC12A5 in clear cell renal cell carcinoma			[ 7 ]
Location	1stExon (cg14921743)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.00E+00	Statistic Test	p-value:2.02E-02; Z-score:4.42E-03
Methylation in Case	1.71E-02 (Median)	Methylation in Control	1.71E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Colorectal cancer	12 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC12A5 in colorectal cancer			[ 8 ]
Location	TSS1500 (cg09595245)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.12E+00	Statistic Test	p-value:3.69E-07; Z-score:-2.29E+00
Methylation in Case	8.06E-01 (Median)	Methylation in Control	9.03E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC12A5 in colorectal cancer			[ 8 ]
Location	TSS200 (cg21609339)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.92E+00	Statistic Test	p-value:1.71E-13; Z-score:4.62E+00
Methylation in Case	5.79E-01 (Median)	Methylation in Control	3.02E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC12A5 in colorectal cancer			[ 8 ]
Location	TSS200 (cg17920479)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.40E+00	Statistic Test	p-value:1.67E-08; Z-score:2.06E+00
Methylation in Case	6.57E-01 (Median)	Methylation in Control	4.69E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC12A5 in colorectal cancer			[ 8 ]
Location	TSS200 (cg04980291)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.15E+00	Statistic Test	p-value:6.40E-08; Z-score:3.83E-01
Methylation in Case	1.80E-01 (Median)	Methylation in Control	1.57E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC12A5 in colorectal cancer			[ 8 ]
Location	TSS200 (cg23463144)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.22E+00	Statistic Test	p-value:3.24E-06; Z-score:1.02E+00
Methylation in Case	1.53E-01 (Median)	Methylation in Control	1.26E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC12A5 in colorectal cancer			[ 8 ]
Location	TSS200 (cg07191594)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.13E+00	Statistic Test	p-value:3.96E-03; Z-score:7.12E-01
Methylation in Case	6.28E-01 (Median)	Methylation in Control	5.55E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC12A5 in colorectal cancer			[ 8 ]
Location	1stExon (cg14921743)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.10E+01	Statistic Test	p-value:3.26E-13; Z-score:2.56E+01
Methylation in Case	4.18E-01 (Median)	Methylation in Control	1.99E-02 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC12A5 in colorectal cancer			[ 8 ]
Location	Body (cg01634998)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.01E+00	Statistic Test	p-value:9.11E-04; Z-score:1.34E-01
Methylation in Case	2.12E-01 (Median)	Methylation in Control	2.10E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC12A5 in colorectal cancer			[ 8 ]
Location	Body (cg23508607)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.18E+00	Statistic Test	p-value:7.36E-03; Z-score:-1.08E+00
Methylation in Case	1.22E-01 (Median)	Methylation in Control	1.44E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC12A5 in colorectal cancer			[ 8 ]
Location	Body (cg12832857)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.20E+00	Statistic Test	p-value:1.97E-02; Z-score:5.57E-01
Methylation in Case	5.37E-02 (Median)	Methylation in Control	4.49E-02 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC12A5 in colorectal cancer			[ 8 ]
Location	Body (cg23274660)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.25E+00	Statistic Test	p-value:2.31E-02; Z-score:-6.38E-01
Methylation in Case	2.65E-01 (Median)	Methylation in Control	3.32E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC12A5 in lung adenocarcinoma			[ 9 ]
Location	TSS1500 (cg09595245)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.03E+00	Statistic Test	p-value:4.35E-02; Z-score:7.67E-01
Methylation in Case	8.27E-01 (Median)	Methylation in Control	8.06E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC12A5 in lung adenocarcinoma			[ 9 ]
Location	Body (cg01160557)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.35E+00	Statistic Test	p-value:1.02E-03; Z-score:-1.46E+00
Methylation in Case	1.22E-01 (Median)	Methylation in Control	1.65E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC12A5 in lung adenocarcinoma			[ 9 ]
Location	Body (cg23274660)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.35E+00	Statistic Test	p-value:1.83E-02; Z-score:-1.44E+00
Methylation in Case	3.23E-01 (Median)	Methylation in Control	4.36E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC12A5 in papillary thyroid cancer			[ 10 ]
Location	TSS1500 (cg04539957)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.08E+00	Statistic Test	p-value:7.72E-03; Z-score:8.89E-01
Methylation in Case	6.02E-01 (Median)	Methylation in Control	5.60E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC12A5 in papillary thyroid cancer			[ 10 ]
Location	TSS200 (cg07191594)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.17E+00	Statistic Test	p-value:1.82E-05; Z-score:8.54E-01
Methylation in Case	1.78E-01 (Median)	Methylation in Control	1.52E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC12A5 in papillary thyroid cancer			[ 10 ]
Location	TSS200 (cg17920479)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.23E+00	Statistic Test	p-value:1.43E-04; Z-score:9.97E-01
Methylation in Case	1.79E-01 (Median)	Methylation in Control	1.46E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC12A5 in papillary thyroid cancer			[ 10 ]
Location	TSS200 (cg21609339)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.17E+00	Statistic Test	p-value:6.44E-04; Z-score:9.41E-01
Methylation in Case	1.22E-01 (Median)	Methylation in Control	1.04E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC12A5 in papillary thyroid cancer			[ 10 ]
Location	TSS200 (cg23463144)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.06E+00	Statistic Test	p-value:2.15E-02; Z-score:2.87E-01
Methylation in Case	5.77E-02 (Median)	Methylation in Control	5.44E-02 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC12A5 in papillary thyroid cancer			[ 10 ]
Location	Body (cg23274660)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.28E+00	Statistic Test	p-value:1.21E-06; Z-score:-1.32E+00
Methylation in Case	3.94E-01 (Median)	Methylation in Control	5.05E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC12A5 in papillary thyroid cancer			[ 10 ]
Location	Body (cg01160557)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.35E+00	Statistic Test	p-value:3.13E-02; Z-score:-1.19E+00
Methylation in Case	1.22E-01 (Median)	Methylation in Control	1.66E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC12A5 in systemic lupus erythematosus			[ 11 ]
Location	TSS1500 (cg09595245)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.00E+00	Statistic Test	p-value:7.26E-04; Z-score:-6.48E-02
Methylation in Case	8.98E-01 (Median)	Methylation in Control	9.01E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC12A5 in systemic lupus erythematosus			[ 11 ]
Location	TSS200 (cg04980291)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:1.23E-02; Z-score:-1.18E-01
Methylation in Case	1.06E-01 (Median)	Methylation in Control	1.11E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC12A5 in systemic lupus erythematosus			[ 11 ]
Location	Body (cg23274660)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.10E+00	Statistic Test	p-value:7.75E-04; Z-score:-3.28E-01
Methylation in Case	3.98E-01 (Median)	Methylation in Control	4.36E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC12A5 in systemic lupus erythematosus			[ 11 ]
Location	Body (cg23508607)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.07E+00	Statistic Test	p-value:8.44E-03; Z-score:-2.72E-01
Methylation in Case	8.16E-02 (Median)	Methylation in Control	8.73E-02 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Depression	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC12A5 in depression			[ 12 ]
Location	TSS200 (cg17920479)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.09E+00	Statistic Test	p-value:1.02E-02; Z-score:6.60E-01
Methylation in Case	1.38E-01 (Median)	Methylation in Control	1.27E-01 (Median)
Studied Phenotype	Depression[ ICD-11:6A8Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC12A5 in depression			[ 12 ]
Location	Body (cg23274660)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:2.73E-02; Z-score:-3.87E-01
Methylation in Case	3.37E-01 (Median)	Methylation in Control	3.54E-01 (Median)
Studied Phenotype	Depression[ ICD-11:6A8Z]
Experimental Material	Patient tissue samples
HIV infection	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC12A5 in HIV infection			[ 13 ]
Location	TSS200 (cg17920479)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.30E+00	Statistic Test	p-value:1.24E-05; Z-score:1.63E+00
Methylation in Case	2.43E-01 (Median)	Methylation in Control	1.86E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC12A5 in HIV infection			[ 13 ]
Location	TSS200 (cg07191594)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.30E+00	Statistic Test	p-value:1.45E-05; Z-score:1.69E+00
Methylation in Case	2.74E-01 (Median)	Methylation in Control	2.11E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC12A5 in HIV infection			[ 13 ]
Location	TSS200 (cg21609339)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.50E+00	Statistic Test	p-value:1.48E-05; Z-score:2.40E+00
Methylation in Case	2.07E-01 (Median)	Methylation in Control	1.38E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC12A5 in HIV infection			[ 13 ]
Location	1stExon (cg14921743)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.30E+00	Statistic Test	p-value:1.67E-02; Z-score:6.53E-01
Methylation in Case	1.99E-02 (Median)	Methylation in Control	1.53E-02 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC12A5 in HIV infection			[ 13 ]
Location	Body (cg01160557)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.11E+00	Statistic Test	p-value:3.38E-04; Z-score:-4.93E-01
Methylation in Case	9.34E-02 (Median)	Methylation in Control	1.04E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC12A5 in HIV infection			[ 13 ]
Location	Body (cg23274660)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.14E+00	Statistic Test	p-value:1.90E-03; Z-score:-7.73E-01
Methylation in Case	3.53E-01 (Median)	Methylation in Control	4.04E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Panic disorder	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC12A5 in panic disorder			[ 14 ]
Location	TSS200 (cg07191594)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-8.92E-01	Statistic Test	p-value:1.45E-03; Z-score:-6.20E-01
Methylation in Case	-2.75E+00 (Median)	Methylation in Control	-2.46E+00 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC12A5 in panic disorder			[ 14 ]
Location	TSS200 (cg17920479)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-9.37E-01	Statistic Test	p-value:1.74E-02; Z-score:-3.60E-01
Methylation in Case	-2.94E+00 (Median)	Methylation in Control	-2.75E+00 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC12A5 in panic disorder			[ 14 ]
Location	TSS200 (cg21609339)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-9.61E-01	Statistic Test	p-value:2.42E-02; Z-score:-2.70E-01
Methylation in Case	-3.22E+00 (Median)	Methylation in Control	-3.10E+00 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC12A5 in panic disorder			[ 14 ]
Location	Body (cg01160557)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:9.51E-01	Statistic Test	p-value:2.80E-04; Z-score:5.05E-01
Methylation in Case	-3.84E+00 (Median)	Methylation in Control	-4.04E+00 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC12A5 in panic disorder			[ 14 ]
Location	Body (cg23274660)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:7.76E-01	Statistic Test	p-value:3.01E-03; Z-score:5.65E-01
Methylation in Case	-8.55E-01 (Median)	Methylation in Control	-1.10E+00 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Atypical teratoid rhabdoid tumor	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC12A5 in atypical teratoid rhabdoid tumor			[ 15 ]
Location	1stExon (cg14921743)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.26E+00	Statistic Test	p-value:7.07E-19; Z-score:3.54E+00
Methylation in Case	5.61E-01 (Median)	Methylation in Control	2.48E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC12A5 in atypical teratoid rhabdoid tumor			[ 15 ]
Location	Body (cg01160557)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.10E+00	Statistic Test	p-value:4.91E-05; Z-score:-9.85E-01
Methylation in Case	8.17E-01 (Median)	Methylation in Control	8.98E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC12A5 in atypical teratoid rhabdoid tumor			[ 15 ]
Location	Body (cg01634998)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.99E+00	Statistic Test	p-value:7.46E-05; Z-score:-1.24E+00
Methylation in Case	1.05E-01 (Median)	Methylation in Control	2.09E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC12A5 in atypical teratoid rhabdoid tumor			[ 15 ]
Location	Body (cg12832857)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.01E+00	Statistic Test	p-value:2.98E-02; Z-score:6.35E-02
Methylation in Case	7.71E-02 (Median)	Methylation in Control	7.65E-02 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Squamous cell carcinoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Moderate hypomethylation of SLC12A5 in squamous cell carcinoma than that in healthy individual
Studied Phenotype	Squamous cell carcinoma [ICD-11:2B60]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:0.005539222; Fold-change:-0.259128293; Z-score:-1.481890268
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue adjacent to the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data of patients in the normal section of the tissue adjacent to the disease section Download DT methylation data in the tissue of healthy individual
Brain neuroepithelial tumour	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypomethylation of SLC12A5 in brain neuroepithelial tumour than that in healthy individual
Studied Phenotype	Brain neuroepithelial tumour [ICD-11:2A00.2Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:0.003272911; Fold-change:-0.314442811; Z-score:-1.40310293
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Melanoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypomethylation of SLC12A5 in melanoma than that in healthy individual
Studied Phenotype	Melanoma [ICD-11:2C30]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:1.03E-05; Fold-change:-0.440875689; Z-score:-1.692068608
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Multilayered rosettes embryonal tumour	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypomethylation of SLC12A5 in multilayered rosettes embryonal tumour than that in healthy individual
Studied Phenotype	Multilayered rosettes embryonal tumour [ICD-11:2A00.1]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:1.50E-13; Fold-change:-0.558340343; Z-score:-2.301500053
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Third ventricle chordoid glioma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypomethylation of SLC12A5 in third ventricle chordoid glioma than that in healthy individual
Studied Phenotype	Third ventricle chordoid glioma [ICD-11:2A00.0Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:0.005064491; Fold-change:-0.372595446; Z-score:-7.541705034
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Gastric cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Moderate hypermethylation of SLC12A5 in gastric cancer than that in adjacent tissue
Studied Phenotype	Gastric cancer [ICD-11:2B72]
The Methylation Level of Disease Section Compare with the Adjacent Tissue	p-value:0.005109813; Fold-change:0.240848646; Z-score:7.982504387
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue adjacent to the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data of patients in the normal section of the tissue adjacent to the disease section Download DT methylation data in the tissue of healthy individual
Histone acetylation
Bone cancer pain	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Hypoacetylation of Slc12a5 in bone cancer pain (compare with normal rats)			[ 16 ]
Location	Promoter
Epigenetic Type	Histone acetylation	Experiment Method	Chromatin immunoprecipitation
Related Molecular Changes	Down regulation ofSlc12a5	Experiment Method	Western Blot
Studied Phenotype	Bone cancer pain[ ICD-11:MG30.1]
Experimental Material	Model organism in vivo (mouse)
Additional Notes	Suppression of HDAC2 in spinal cord alleviates mechanical hyperalgesia and restores KCC2 expression in a rat model of bone cancer pain.
Inflammatory pain	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Hypoacetylation of Slc12a5 in inflammatory pain (compare with normal rats)			[ 17 ]
Location	Promoter
Epigenetic Type	Histone acetylation	Experiment Method	Chromatin immunoprecipitation
Related Molecular Changes	Down regulation ofSlc12a5	Experiment Method	Western Blot
Studied Phenotype	Inflammatory pain[ ICD-11:MG30.42]
Experimental Material	Model organism in vivo (mouse)
Additional Notes	Promoter histone acetylation plays a role in complete Freund's adjuvantinduced suppression of SLC12A5 in the spinal dorsal horn.
Epigenetic Phenomenon2	Hypoacetylation of Slc12a5 in inflammatory pain (compare with normal rats)			[ 17 ]
Location	Promoter
Epigenetic Type	Histone acetylation	Experiment Method	Chromatin immunoprecipitation
Related Molecular Changes	Down regulation ofSlc12a5	Experiment Method	Western Blot
Studied Phenotype	Inflammatory pain[ ICD-11:MG30.42]
Experimental Material	Model organism in vivo (mouse)
Additional Notes	Promoter histone acetylation plays a role in complete Freund's adjuvantinduced suppression of SLC12A5 in the spinal dorsal horn.
microRNA
Unclear Phenotype	38 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	miR-1237 directly targets SLC12A5			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1237	miRNA Mature ID	miR-1237-5p
miRNA Sequence	CGGGGGCGGGGCCGAAGCGCG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon2	miR-203a directly targets SLC12A5			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-203a	miRNA Mature ID	miR-203a-3p
miRNA Sequence	GUGAAAUGUUUAGGACCACUAG
miRNA Target Type	Direct
Experimental Material	Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon3	miR-224 directly targets SLC12A5			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-224	miRNA Mature ID	miR-224-5p
miRNA Sequence	UCAAGUCACUAGUGGUUCCGUUUAG
miRNA Target Type	Direct
Experimental Material	Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon4	miR-2277 directly targets SLC12A5			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-2277	miRNA Mature ID	miR-2277-3p
miRNA Sequence	UGACAGCGCCCUGCCUGGCUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon5	miR-25 directly targets SLC12A5			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-25	miRNA Mature ID	miR-25-3p
miRNA Sequence	CAUUGCACUUGUCUCGGUCUGA
miRNA Target Type	Direct
Experimental Material	Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon6	miR-3178 directly targets SLC12A5			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3178	miRNA Mature ID	miR-3178
miRNA Sequence	GGGGCGCGGCCGGAUCG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon7	miR-32 directly targets SLC12A5			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-32	miRNA Mature ID	miR-32-5p
miRNA Sequence	UAUUGCACAUUACUAAGUUGCA
miRNA Target Type	Direct
Experimental Material	Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon8	miR-328 directly targets SLC12A5			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-328	miRNA Mature ID	miR-328-5p
miRNA Sequence	GGGGGGGCAGGAGGGGCUCAGGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon9	miR-3614 directly targets SLC12A5			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3614	miRNA Mature ID	miR-3614-5p
miRNA Sequence	CCACUUGGAUCUGAAGGCUGCCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon10	miR-363 directly targets SLC12A5			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-363	miRNA Mature ID	miR-363-3p
miRNA Sequence	AAUUGCACGGUAUCCAUCUGUA
miRNA Target Type	Direct
Experimental Material	Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon11	miR-367 directly targets SLC12A5			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-367	miRNA Mature ID	miR-367-3p
miRNA Sequence	AAUUGCACUUUAGCAAUGGUGA
miRNA Target Type	Direct
Experimental Material	Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon12	miR-4285 directly targets SLC12A5			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4285	miRNA Mature ID	miR-4285
miRNA Sequence	GCGGCGAGUCCGACUCAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon13	miR-4313 directly targets SLC12A5			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4313	miRNA Mature ID	miR-4313
miRNA Sequence	AGCCCCCUGGCCCCAAACCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon14	miR-4325 directly targets SLC12A5			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4325	miRNA Mature ID	miR-4325
miRNA Sequence	UUGCACUUGUCUCAGUGA
miRNA Target Type	Direct
Experimental Material	Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon15	miR-433 directly targets SLC12A5			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-433	miRNA Mature ID	miR-433-5p
miRNA Sequence	UACGGUGAGCCUGUCAUUAUUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon16	miR-4433a directly targets SLC12A5			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4433a	miRNA Mature ID	miR-4433a-5p
miRNA Sequence	CGUCCCACCCCCCACUCCUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon17	miR-4433b directly targets SLC12A5			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4433b	miRNA Mature ID	miR-4433b-5p
miRNA Sequence	AUGUCCCACCCCCACUCCUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon18	miR-4469 directly targets SLC12A5			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4469	miRNA Mature ID	miR-4469
miRNA Sequence	GCUCCCUCUAGGGUCGCUCGGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon19	miR-4479 directly targets SLC12A5			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4479	miRNA Mature ID	miR-4479
miRNA Sequence	CGCGCGGCCGUGCUCGGAGCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon20	miR-4488 directly targets SLC12A5			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4488	miRNA Mature ID	miR-4488
miRNA Sequence	AGGGGGCGGGCUCCGGCG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon21	miR-4646 directly targets SLC12A5			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4646	miRNA Mature ID	miR-4646-3p
miRNA Sequence	AUUGUCCCUCUCCCUUCCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon22	miR-4667 directly targets SLC12A5			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4667	miRNA Mature ID	miR-4667-3p
miRNA Sequence	UCCCUCCUUCUGUCCCCACAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon23	miR-4697 directly targets SLC12A5			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4697	miRNA Mature ID	miR-4697-5p
miRNA Sequence	AGGGGGCGCAGUCACUGACGUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon24	miR-4726 directly targets SLC12A5			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4726	miRNA Mature ID	miR-4726-3p
miRNA Sequence	ACCCAGGUUCCCUCUGGCCGCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon25	miR-5193 directly targets SLC12A5			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5193	miRNA Mature ID	miR-5193
miRNA Sequence	UCCUCCUCUACCUCAUCCCAGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon26	miR-542 directly targets SLC12A5			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-542	miRNA Mature ID	miR-542-3p
miRNA Sequence	UGUGACAGAUUGAUAACUGAAA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon27	miR-548az directly targets SLC12A5			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-548az	miRNA Mature ID	miR-548az-5p
miRNA Sequence	CAAAAGUGAUUGUGGUUUUUGC
miRNA Target Type	Direct
Experimental Material	Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon28	miR-548n directly targets SLC12A5			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-548n	miRNA Mature ID	miR-548n
miRNA Sequence	CAAAAGUAAUUGUGGAUUUUGU
miRNA Target Type	Direct
Experimental Material	Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon29	miR-548t directly targets SLC12A5			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-548t	miRNA Mature ID	miR-548t-5p
miRNA Sequence	CAAAAGUGAUCGUGGUUUUUG
miRNA Target Type	Direct
Experimental Material	Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon30	miR-6075 directly targets SLC12A5			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6075	miRNA Mature ID	miR-6075
miRNA Sequence	ACGGCCCAGGCGGCAUUGGUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon31	miR-6500 directly targets SLC12A5			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6500	miRNA Mature ID	miR-6500-3p
miRNA Sequence	ACACUUGUUGGGAUGACCUGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon32	miR-6749 directly targets SLC12A5			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6749	miRNA Mature ID	miR-6749-3p
miRNA Sequence	CUCCUCCCCUGCCUGGCCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon33	miR-6840 directly targets SLC12A5			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6840	miRNA Mature ID	miR-6840-3p
miRNA Sequence	GCCCAGGACUUUGUGCGGGGUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon34	miR-6885 directly targets SLC12A5			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6885	miRNA Mature ID	miR-6885-5p
miRNA Sequence	AGGGGGGCACUGCGCAAGCAAAGCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon35	miR-6887 directly targets SLC12A5			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6887	miRNA Mature ID	miR-6887-3p
miRNA Sequence	UCCCCUCCACUUUCCUCCUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon36	miR-7703 directly targets SLC12A5			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-7703	miRNA Mature ID	miR-7703
miRNA Sequence	UUGCACUCUGGCCUUCUCCCAGG
miRNA Target Type	Direct
Experimental Material	Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon37	miR-92a directly targets SLC12A5			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-92a	miRNA Mature ID	miR-92a-3p
miRNA Sequence	UAUUGCACUUGUCCCGGCCUGU
miRNA Target Type	Direct
Experimental Material	Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon38	miR-92b directly targets SLC12A5			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-92b	miRNA Mature ID	miR-92b-3p
miRNA Sequence	UAUUGCACUCGUCCCGGCCUCC
miRNA Target Type	Direct
Experimental Material	Human breast adenocarcinoma cell line (MCF-7)

References
1	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
2	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
3	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
4	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
5	DNA Methylation Dynamics in Urological Tumors.
6	Genome-wide Scan for Methylation Profiles in Breast Cancer
7	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
8	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
9	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
10	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
11	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
12	DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
13	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
14	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
15	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
16	Suppression of HDAC2 in Spinal Cord Alleviates Mechanical Hyperalgesia and Restores KCC2 Expression in a Rat Model of Bone Cancer Pain. Neuroscience. 2018 May 1;377:138-149.
17	Epigenetic suppression of potassium-chloride co-transporter 2 expression in inflammatory pain induced by complete Freund's adjuvant (CFA). Eur J Pain. 2017 Feb;21(2):309-321.
18	In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio. 2013 Apr 16;4(2):e000193.
19	Identification of distinct miRNA target regulation between breast cancer molecular subtypes using AGO2-PAR-CLIP and patient datasets. Genome Biol. 2014 Jan 7;15(1):R9.
20	Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence