Detail Information of Epigenetic Regulations
General Information of Drug Transporter (DT) | |||||
---|---|---|---|---|---|
DT ID | DTD0084 Transporter Info | ||||
Gene Name | SLC12A3 | ||||
Transporter Name | Thiazide-sensitive sodium-chloride cotransporter | ||||
Gene ID | |||||
UniProt ID | |||||
Epigenetic Regulations of This DT (EGR) | |||||
---|---|---|---|---|---|
microRNA |
|||||
Unclear Phenotype |
17 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
miR-136 directly targets SLC12A3 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-136 | miRNA Mature ID | miR-136-5p | ||
miRNA Sequence |
ACUCCAUUUGUUUUGAUGAUGGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon2 |
miR-2355 directly targets SLC12A3 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-2355 | miRNA Mature ID | miR-2355-3p | ||
miRNA Sequence |
AUUGUCCUUGCUGUUUGGAGAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon3 |
miR-335 directly targets SLC12A3 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
miRNA Stemloop ID |
miR-335 | miRNA Mature ID | miR-335-5p | ||
miRNA Sequence |
UCAAGAGCAAUAACGAAAAAUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon4 |
miR-4287 directly targets SLC12A3 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4287 | miRNA Mature ID | miR-4287 | ||
miRNA Sequence |
UCUCCCUUGAGGGCACUUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon5 |
miR-4329 directly targets SLC12A3 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4329 | miRNA Mature ID | miR-4329 | ||
miRNA Sequence |
CCUGAGACCCUAGUUCCAC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon6 |
miR-4469 directly targets SLC12A3 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4469 | miRNA Mature ID | miR-4469 | ||
miRNA Sequence |
GCUCCCUCUAGGGUCGCUCGGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon7 |
miR-4524a directly targets SLC12A3 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4524a | miRNA Mature ID | miR-4524a-3p | ||
miRNA Sequence |
UGAGACAGGCUUAUGCUGCUAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon8 |
miR-4685 directly targets SLC12A3 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4685 | miRNA Mature ID | miR-4685-3p | ||
miRNA Sequence |
UCUCCCUUCCUGCCCUGGCUAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon9 |
miR-4780 directly targets SLC12A3 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4780 | miRNA Mature ID | miR-4780 | ||
miRNA Sequence |
ACCCUUGAGCCUGAUCCCUAGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon10 |
miR-515 directly targets SLC12A3 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-515 | miRNA Mature ID | miR-515-5p | ||
miRNA Sequence |
UUCUCCAAAAGAAAGCACUUUCUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon11 |
miR-519e directly targets SLC12A3 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-519e | miRNA Mature ID | miR-519e-5p | ||
miRNA Sequence |
UUCUCCAAAAGGGAGCACUUUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon12 |
miR-5680 directly targets SLC12A3 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-5680 | miRNA Mature ID | miR-5680 | ||
miRNA Sequence |
GAGAAAUGCUGGACUAAUCUGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon13 |
miR-623 directly targets SLC12A3 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-623 | miRNA Mature ID | miR-623 | ||
miRNA Sequence |
AUCCCUUGCAGGGGCUGUUGGGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon14 |
miR-629 directly targets SLC12A3 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-629 | miRNA Mature ID | miR-629-3p | ||
miRNA Sequence |
GUUCUCCCAACGUAAGCCCAGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon15 |
miR-676 directly targets SLC12A3 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-676 | miRNA Mature ID | miR-676-3p | ||
miRNA Sequence |
CUGUCCUAAGGUUGUUGAGUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon16 |
miR-6867 directly targets SLC12A3 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6867 | miRNA Mature ID | miR-6867-3p | ||
miRNA Sequence |
CUCUCCCUCUUUACCCACUAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon17 |
miR-7113 directly targets SLC12A3 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-7113 | miRNA Mature ID | miR-7113-3p | ||
miRNA Sequence |
CCUCCCUGCCCGCCUCUCUGCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Methylation |
|||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.