Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0083 Transporter Info | ||||
| Gene Name | SLC12A2 | ||||
| Transporter Name | Basolateral Na-K-Cl symporter | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
Methylation |
|||||
|
Pancretic ductal adenocarcinoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC12A2 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
TSS1500 (cg19932080) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.11E+00 | Statistic Test | p-value:4.33E-03; Z-score:1.46E+00 | ||
|
Methylation in Case |
7.85E-01 (Median) | Methylation in Control | 7.07E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Atypical teratoid rhabdoid tumor |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC12A2 in atypical teratoid rhabdoid tumor | [ 2 ] | |||
|
Location |
Body (cg00308508) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.50E+00 | Statistic Test | p-value:2.15E-05; Z-score:1.25E+00 | ||
|
Methylation in Case |
8.25E-01 (Median) | Methylation in Control | 5.50E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC12A2 in atypical teratoid rhabdoid tumor | [ 2 ] | |||
|
Location |
Body (cg01159515) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:4.88E-05; Z-score:-9.56E-01 | ||
|
Methylation in Case |
9.11E-01 (Median) | Methylation in Control | 9.51E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC12A2 in atypical teratoid rhabdoid tumor | [ 2 ] | |||
|
Location |
Body (cg13676672) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:3.79E-02; Z-score:-1.94E-01 | ||
|
Methylation in Case |
6.79E-01 (Median) | Methylation in Control | 7.00E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC12A2 in atypical teratoid rhabdoid tumor | [ 2 ] | |||
|
Location |
3'UTR (cg19637461) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.43E+00 | Statistic Test | p-value:3.18E-10; Z-score:-1.53E+00 | ||
|
Methylation in Case |
4.71E-01 (Median) | Methylation in Control | 6.72E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Bladder cancer |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC12A2 in bladder cancer | [ 3 ] | |||
|
Location |
Body (cg13676672) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-2.14E+00 | Statistic Test | p-value:3.63E-05; Z-score:-4.22E+00 | ||
|
Methylation in Case |
1.49E-01 (Median) | Methylation in Control | 3.19E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC12A2 in bladder cancer | [ 3 ] | |||
|
Location |
Body (cg19767477) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-2.92E+00 | Statistic Test | p-value:1.64E-03; Z-score:-2.75E+00 | ||
|
Methylation in Case |
4.40E-02 (Median) | Methylation in Control | 1.29E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC12A2 in bladder cancer | [ 3 ] | |||
|
Location |
Body (cg00308508) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:5.93E-03; Z-score:-2.11E+00 | ||
|
Methylation in Case |
8.45E-01 (Median) | Methylation in Control | 8.69E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Breast cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC12A2 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg00308508) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.07E+00 | Statistic Test | p-value:1.52E-02; Z-score:9.53E-01 | ||
|
Methylation in Case |
8.37E-01 (Median) | Methylation in Control | 7.81E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Hepatocellular carcinoma |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC12A2 in hepatocellular carcinoma | [ 5 ] | |||
|
Location |
Body (cg13676672) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.44E+00 | Statistic Test | p-value:4.48E-04; Z-score:-1.52E+00 | ||
|
Methylation in Case |
3.04E-01 (Median) | Methylation in Control | 4.37E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC12A2 in hepatocellular carcinoma | [ 5 ] | |||
|
Location |
Body (cg19767477) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-2.02E+00 | Statistic Test | p-value:1.63E-02; Z-score:-1.55E+00 | ||
|
Methylation in Case |
9.64E-02 (Median) | Methylation in Control | 1.95E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC12A2 in hepatocellular carcinoma | [ 5 ] | |||
|
Location |
3'UTR (cg19637461) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:5.16E-03; Z-score:-2.11E-01 | ||
|
Methylation in Case |
8.21E-01 (Median) | Methylation in Control | 8.30E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Panic disorder |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC12A2 in panic disorder | [ 6 ] | |||
|
Location |
Body (cg01159515) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-9.52E-01 | Statistic Test | p-value:2.78E-03; Z-score:-3.23E-01 | ||
|
Methylation in Case |
-3.30E+00 (Median) | Methylation in Control | -3.14E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC12A2 in panic disorder | [ 6 ] | |||
|
Location |
3'UTR (cg19637461) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-3.09E+00 | Statistic Test | p-value:1.12E-02; Z-score:-4.73E-01 | ||
|
Methylation in Case |
8.78E-02 (Median) | Methylation in Control | 2.71E-01 (Median) | ||
|
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Papillary thyroid cancer |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC12A2 in papillary thyroid cancer | [ 7 ] | |||
|
Location |
Body (cg19767477) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-2.67E+00 | Statistic Test | p-value:1.52E-14; Z-score:-2.83E+00 | ||
|
Methylation in Case |
9.47E-02 (Median) | Methylation in Control | 2.53E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC12A2 in papillary thyroid cancer | [ 7 ] | |||
|
Location |
Body (cg01159515) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.26E+00 | Statistic Test | p-value:2.78E-09; Z-score:-1.37E+00 | ||
|
Methylation in Case |
1.41E-01 (Median) | Methylation in Control | 1.77E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC12A2 in papillary thyroid cancer | [ 7 ] | |||
|
Location |
Body (cg00308508) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:7.51E-03; Z-score:-4.08E-01 | ||
|
Methylation in Case |
9.03E-01 (Median) | Methylation in Control | 9.11E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Systemic lupus erythematosus |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC12A2 in systemic lupus erythematosus | [ 8 ] | |||
|
Location |
Body (cg13676672) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.16E+00 | Statistic Test | p-value:2.46E-04; Z-score:4.60E-01 | ||
|
Methylation in Case |
5.68E-01 (Median) | Methylation in Control | 4.88E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC12A2 in systemic lupus erythematosus | [ 8 ] | |||
|
Location |
Body (cg19767477) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.20E+00 | Statistic Test | p-value:1.91E-03; Z-score:4.13E-01 | ||
|
Methylation in Case |
9.71E-02 (Median) | Methylation in Control | 8.06E-02 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Histone dimethylation |
|||||
|
Hypertension |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Higher level of histone dimethylation of Slc12a2 in hypertension (compare with normal rats) | [ 9 ] | |||
|
Location |
Promoter | ||||
|
Epigenetic Type |
Histone dimethylation | Experiment Method | Chromatin immunoprecipitation | ||
|
Related Molecular Changes | Up regulation ofSlc12a2 | Experiment Method | RT-qPCR | ||
|
Studied Phenotype |
Hypertension[ ICD-11:BA00-BA04] | ||||
|
Experimental Material |
Model organism in vivo (mouse) | ||||
|
Additional Notes |
The increased levels of mRNA expression correlated with increment of dimethylation on H3K4 at the Slc12a2 promoter region in spontaneously hypertensive rat. | ||||
|
Epigenetic Phenomenon2 |
Lower level of histone dimethylation of Slc12a2 in hypertension (compare with normal rats) | [ 9 ] | |||
|
Location |
Promoter | ||||
|
Epigenetic Type |
Histone dimethylation | Experiment Method | Chromatin immunoprecipitation | ||
|
Related Molecular Changes | Up regulation ofSlc12a2 | Experiment Method | RT-qPCR | ||
|
Studied Phenotype |
Hypertension[ ICD-11:BA00-BA04] | ||||
|
Experimental Material |
Model organism in vivo (mouse) | ||||
|
Additional Notes |
The decreased levels of mRNA expression correlated with increment of dimethylation on H3K4 at the Slc12a2 promoter region in spontaneously hypertensive rat. | ||||
|
Histone acetylation |
|||||
|
Hypertension |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Hyperacetylation of Slc12a2 in hypertension (compare with normal rats) | [ 9 ] | |||
|
Location |
Promoter | ||||
|
Epigenetic Type |
Histone acetylation | Experiment Method | Chromatin immunoprecipitation | ||
|
Related Molecular Changes | Up regulation ofSlc12a2 | Experiment Method | RT-qPCR | ||
|
Studied Phenotype |
Hypertension[ ICD-11:BA00-BA04] | ||||
|
Experimental Material |
Model organism in vivo (mouse) | ||||
|
Additional Notes |
The increased levels of mRNA expression correlated with increment of acetylation on H3K4 at the Slc12a2 promoter region in spontaneously hypertensive rat. | ||||
|
Epigenetic Phenomenon2 |
Hypoacetylation of Slc12a2 in hypertension (compare with Ang II-treatment counterpart hypertension rats) | [ 10 ] | |||
|
Location |
Promoter | ||||
|
Epigenetic Type |
Histone acetylation | Experiment Method | Chromatin immunoprecipitation | ||
|
Related Molecular Changes | Down regulation ofSlc12a2 | Experiment Method | RT-qPCR | ||
|
Studied Phenotype |
Hypertension[ ICD-11:BA00-BA04] | ||||
|
Experimental Material |
Model organism in vivo (mouse) | ||||
|
Additional Notes |
Slc12a2 is upregulated via histone modification in the aortas of Ang II-induced hypertensive SD rats. | ||||
|
Histone trimethylation |
|||||
|
Hypertension |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Hypoacetylation of Slc12a2 in hypertension (compare with Ang II-treatment counterpart hypertension rats) | [ 10 ] | |||
|
Location |
Promoter | ||||
|
Epigenetic Type |
Histone trimethylation | Experiment Method | Chromatin immunoprecipitation | ||
|
Related Molecular Changes | Down regulation ofSlc12a2 | Experiment Method | RT-qPCR | ||
|
Studied Phenotype |
Hypertension[ ICD-11:BA00-BA04] | ||||
|
Experimental Material |
Model organism in vivo (mouse) | ||||
|
Additional Notes |
Slc12a2 is upregulated via histone modification in the aortas of Ang II-induced hypertensive SD rats. | ||||
|
microRNA |
|||||
|
Unclear Phenotype |
15 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
let-7c directly targets SLC12A2 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
|
miRNA Stemloop ID |
let-7c | miRNA Mature ID | let-7c-5p | ||
|
miRNA Sequence |
UGAGGUAGUAGGUUGUAUGGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon2 |
miR-16 directly targets SLC12A2 | [ 12 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | pSILAC//Proteomics;Other | ||
|
miRNA Stemloop ID |
miR-16 | miRNA Mature ID | miR-16-5p | ||
|
miRNA Sequence |
UAGCAGCACGUAAAUAUUGGCG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
|
Epigenetic Phenomenon3 |
miR-190a directly targets SLC12A2 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP//HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-190a | miRNA Mature ID | miR-190a-3p | ||
|
miRNA Sequence |
CUAUAUAUCAAACAUAUUCCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon4 |
miR-30a directly targets SLC12A2 | [ 12 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Proteomics | ||
|
miRNA Stemloop ID |
miR-30a | miRNA Mature ID | miR-30a-5p | ||
|
miRNA Sequence |
UGUAAACAUCCUCGACUGGAAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
|
Epigenetic Phenomenon5 |
miR-329 directly targets SLC12A2 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP//HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-329 | miRNA Mature ID | miR-329-3p | ||
|
miRNA Sequence |
AACACACCUGGUUAACCUCUUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon6 |
miR-362 directly targets SLC12A2 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP//HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-362 | miRNA Mature ID | miR-362-3p | ||
|
miRNA Sequence |
AACACACCUAUUCAAGGAUUCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon7 |
miR-3941 directly targets SLC12A2 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP//HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3941 | miRNA Mature ID | miR-3941 | ||
|
miRNA Sequence |
UUACACACAACUGAGGAUCAUA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon8 |
miR-4719 directly targets SLC12A2 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP//HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4719 | miRNA Mature ID | miR-4719 | ||
|
miRNA Sequence |
UCACAAAUCUAUAAUAUGCAGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon9 |
miR-4789 directly targets SLC12A2 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP//HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4789 | miRNA Mature ID | miR-4789-5p | ||
|
miRNA Sequence |
GUAUACACCUGAUAUGUGUAUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon10 |
miR-5011 directly targets SLC12A2 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP//HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-5011 | miRNA Mature ID | miR-5011-5p | ||
|
miRNA Sequence |
UAUAUAUACAGCCAUGCACUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon11 |
miR-5580 directly targets SLC12A2 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP//HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-5580 | miRNA Mature ID | miR-5580-3p | ||
|
miRNA Sequence |
CACAUAUGAAGUGAGCCAGCAC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon12 |
miR-603 directly targets SLC12A2 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP//HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-603 | miRNA Mature ID | miR-603 | ||
|
miRNA Sequence |
CACACACUGCAAUUACUUUUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon13 |
miR-6504 directly targets SLC12A2 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP//HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6504 | miRNA Mature ID | miR-6504-3p | ||
|
miRNA Sequence |
CAUUACAGCACAGCCAUUCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon14 |
miR-8485 directly targets SLC12A2 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP//HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-8485 | miRNA Mature ID | miR-8485 | ||
|
miRNA Sequence |
CACACACACACACACACGUAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon15 |
miR-935 directly targets SLC12A2 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-935 | miRNA Mature ID | miR-935 | ||
|
miRNA Sequence |
CCAGUUACCGCUUCCGCUACCGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Left ventricular cardiac tissues of human | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.