Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0078 Transporter Info
Gene Name	SLC10A6
Transporter Name	Sodium-dependent organic anion transporter
Gene ID	345274
UniProt ID	Q3KNW5

Epigenetic Regulations of This DT (EGR)
Methylation
Bladder cancer	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC10A6 in bladder cancer			[ 1 ]
Location	TSS1500 (cg13119182)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-2.26E+00	Statistic Test	p-value:9.11E-04; Z-score:-3.36E+00
Methylation in Case	2.95E-01 (Median)	Methylation in Control	6.67E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC10A6 in bladder cancer			[ 1 ]
Location	TSS1500 (cg15881238)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.80E+00	Statistic Test	p-value:1.68E-03; Z-score:-2.51E+00
Methylation in Case	3.50E-01 (Median)	Methylation in Control	6.30E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC10A6 in bladder cancer			[ 1 ]
Location	TSS200 (cg17691545)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.40E+00	Statistic Test	p-value:1.44E-02; Z-score:-1.40E+00
Methylation in Case	3.61E-01 (Median)	Methylation in Control	5.07E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC10A6 in bladder cancer			[ 1 ]
Location	1stExon (cg25177139)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.16E+00	Statistic Test	p-value:3.83E-05; Z-score:-1.50E+01
Methylation in Case	7.74E-01 (Median)	Methylation in Control	9.01E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC10A6 in bladder cancer			[ 1 ]
Location	Body (cg18860310)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-2.01E+00	Statistic Test	p-value:2.25E-09; Z-score:-1.06E+01
Methylation in Case	2.35E-01 (Median)	Methylation in Control	4.73E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Breast cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC10A6 in breast cancer			[ 2 ]
Location	TSS1500 (cg13119182)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.18E+00	Statistic Test	p-value:3.03E-06; Z-score:1.24E+00
Methylation in Case	6.36E-01 (Median)	Methylation in Control	5.37E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC10A6 in breast cancer			[ 2 ]
Location	TSS1500 (cg15881238)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.16E+00	Statistic Test	p-value:8.51E-05; Z-score:8.76E-01
Methylation in Case	6.38E-01 (Median)	Methylation in Control	5.51E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC10A6 in breast cancer			[ 2 ]
Location	TSS200 (cg17691545)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.26E+00	Statistic Test	p-value:1.25E-04; Z-score:1.29E+00
Methylation in Case	5.47E-01 (Median)	Methylation in Control	4.35E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC10A6 in breast cancer			[ 2 ]
Location	Body (cg18860310)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:6.50E-03; Z-score:-1.79E-01
Methylation in Case	4.41E-01 (Median)	Methylation in Control	4.50E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Colorectal cancer	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC10A6 in colorectal cancer			[ 3 ]
Location	TSS1500 (cg13119182)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.11E+00	Statistic Test	p-value:3.68E-10; Z-score:-2.73E+00
Methylation in Case	8.26E-01 (Median)	Methylation in Control	9.17E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC10A6 in colorectal cancer			[ 3 ]
Location	TSS1500 (cg15881238)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.13E+00	Statistic Test	p-value:1.45E-09; Z-score:-2.36E+00
Methylation in Case	7.94E-01 (Median)	Methylation in Control	8.97E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC10A6 in colorectal cancer			[ 3 ]
Location	TSS200 (cg17691545)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.07E+00	Statistic Test	p-value:3.60E-07; Z-score:-2.08E+00
Methylation in Case	8.13E-01 (Median)	Methylation in Control	8.71E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC10A6 in colorectal cancer			[ 3 ]
Location	1stExon (cg25177139)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.00E+00	Statistic Test	p-value:1.79E-02; Z-score:-7.53E-02
Methylation in Case	9.48E-01 (Median)	Methylation in Control	9.49E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC10A6 in colorectal cancer			[ 3 ]
Location	Body (cg18860310)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.36E+00	Statistic Test	p-value:4.90E-10; Z-score:-2.15E+00
Methylation in Case	6.02E-01 (Median)	Methylation in Control	8.22E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC10A6 in lung adenocarcinoma			[ 4 ]
Location	TSS1500 (cg15881238)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.08E+00	Statistic Test	p-value:8.56E-03; Z-score:1.59E+00
Methylation in Case	8.29E-01 (Median)	Methylation in Control	7.66E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC10A6 in lung adenocarcinoma			[ 4 ]
Location	TSS1500 (cg13119182)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.08E+00	Statistic Test	p-value:4.01E-02; Z-score:1.18E+00
Methylation in Case	8.35E-01 (Median)	Methylation in Control	7.70E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC10A6 in pancretic ductal adenocarcinoma			[ 5 ]
Location	TSS1500 (cg16703956)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.96E+00	Statistic Test	p-value:1.02E-06; Z-score:1.63E+00
Methylation in Case	5.01E-01 (Median)	Methylation in Control	1.69E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC10A6 in pancretic ductal adenocarcinoma			[ 5 ]
Location	Body (cg26213155)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.16E+00	Statistic Test	p-value:2.28E-11; Z-score:2.10E+00
Methylation in Case	5.89E-01 (Median)	Methylation in Control	5.08E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC10A6 in pancretic ductal adenocarcinoma			[ 5 ]
Location	Body (cg14254480)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.10E+00	Statistic Test	p-value:5.00E-07; Z-score:-1.54E+00
Methylation in Case	7.99E-01 (Median)	Methylation in Control	8.77E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC10A6 in pancretic ductal adenocarcinoma			[ 5 ]
Location	Body (cg13775996)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.03E+00	Statistic Test	p-value:1.20E-03; Z-score:5.44E-01
Methylation in Case	8.01E-01 (Median)	Methylation in Control	7.79E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC10A6 in papillary thyroid cancer			[ 6 ]
Location	TSS1500 (cg15881238)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.11E+00	Statistic Test	p-value:1.08E-02; Z-score:2.89E-01
Methylation in Case	2.76E-01 (Median)	Methylation in Control	2.48E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC10A6 in papillary thyroid cancer			[ 6 ]
Location	TSS200 (cg17691545)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.18E+00	Statistic Test	p-value:2.81E-02; Z-score:5.11E-01
Methylation in Case	3.13E-01 (Median)	Methylation in Control	2.65E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC10A6 in papillary thyroid cancer			[ 6 ]
Location	1stExon (cg25177139)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.02E+00	Statistic Test	p-value:2.62E-04; Z-score:5.64E-01
Methylation in Case	8.92E-01 (Median)	Methylation in Control	8.78E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC10A6 in papillary thyroid cancer			[ 6 ]
Location	Body (cg18860310)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.13E+00	Statistic Test	p-value:3.19E-02; Z-score:-4.94E-01
Methylation in Case	2.57E-01 (Median)	Methylation in Control	2.90E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC10A6 in hepatocellular carcinoma			[ 7 ]
Location	TSS200 (cg24217844)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:8.04E+00	Statistic Test	p-value:2.04E-10; Z-score:9.26E+00
Methylation in Case	1.60E-01 (Median)	Methylation in Control	1.98E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC10A6 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg04860674)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.46E+00	Statistic Test	p-value:9.99E-16; Z-score:-4.60E+00
Methylation in Case	5.80E-01 (Median)	Methylation in Control	8.47E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Liver cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant/significant hypermethylation of SLC10A6 in liver cancer than that in healthy individual/adjacent tissue
Studied Phenotype	Liver cancer [ICD-11:2C12]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:5.02E-06; Fold-change:-0.449765518; Z-score:-1.223422083
The Methylation Level of Disease Section Compare with the Adjacent Tissue	p-value:4.99E-28; Fold-change:-0.518867745; Z-score:-10.02879959
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue adjacent to the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals DT methylation level in tissue other than the diseased tissue of patients
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data of patients in the normal section of the tissue adjacent to the disease section Download DT methylation data in the tissue of healthy individual Download DT methylation data in the tissue of the other disease section
Atypical teratoid rhabdoid tumour	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Moderate hypermethylation of SLC10A6 in atypical teratoid rhabdoid tumour than that in healthy individual
Studied Phenotype	Atypical teratoid rhabdoid tumour [ICD-11:2A00.1Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:4.98E-06; Fold-change:0.226849949; Z-score:0.696629737
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Melanocytoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Moderate hypermethylation of SLC10A6 in melanocytoma than that in healthy individual
Studied Phenotype	Melanocytoma [ICD-11:2F36.2]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:9.98E-06; Fold-change:0.244377617; Z-score:0.724110197
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Mixed neuronal-glial tumour	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Moderate hypermethylation of SLC10A6 in mixed neuronal-glial tumour than that in healthy individual
Studied Phenotype	Mixed neuronal-glial tumour [ICD-11:2A00.21]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:8.44E-10; Fold-change:0.230838877; Z-score:0.783165477
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Myxopapillary ependymoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Moderate hypermethylation of SLC10A6 in myxopapillary ependymoma than that in healthy individual
Studied Phenotype	Myxopapillary ependymoma [ICD-11:2A00.5]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:3.31E-05; Fold-change:0.231424784; Z-score:0.73470077
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Oligodendroglioma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Moderate hypermethylation of SLC10A6 in oligodendroglioma than that in healthy individual
Studied Phenotype	Oligodendroglioma [ICD-11:2A00.0Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:1.17E-12; Fold-change:0.23316317; Z-score:0.843544835
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Prostate cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Moderate hypermethylation of SLC10A6 in prostate cancer than that in healthy individual
Studied Phenotype	Prostate cancer [ICD-11:2C82]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:0.000569453; Fold-change:0.2997758; Z-score:1.57156148
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Spinal ependymoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Moderate hypermethylation of SLC10A6 in spinal ependymoma than that in healthy individual
Studied Phenotype	Spinal ependymoma [ICD-11:2A00.0Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:0.003296118; Fold-change:0.220485436; Z-score:0.694226295
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Brain neuroepithelial tumour	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypomethylation of SLC10A6 in brain neuroepithelial tumour than that in healthy individual
Studied Phenotype	Brain neuroepithelial tumour [ICD-11:2A00.2Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:6.16E-18; Fold-change:-0.658974125; Z-score:-2.39401903
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Central neurocytoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypomethylation of SLC10A6 in central neurocytoma than that in healthy individual
Studied Phenotype	Central neurocytoma [ICD-11:2A00.3]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:0.000868731; Fold-change:-0.388478197; Z-score:-1.132195824
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Cerebellar liponeurocytoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypomethylation of SLC10A6 in cerebellar liponeurocytoma than that in healthy individual
Studied Phenotype	Cerebellar liponeurocytoma [ICD-11:2A00.0Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:0.000171315; Fold-change:-0.620644032; Z-score:-1.701965013
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Craniopharyngioma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypomethylation of SLC10A6 in craniopharyngioma than that in healthy individual
Studied Phenotype	Craniopharyngioma [ICD-11:2F9A]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:0.000127256; Fold-change:-0.403849341; Z-score:-1.199725541
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Glioblastoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypomethylation of SLC10A6 in glioblastoma than that in healthy individual
Studied Phenotype	Glioblastoma [ICD-11:2A00.00]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:0.008556755; Fold-change:-0.326447812; Z-score:-0.94050967
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Lymphoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypomethylation of SLC10A6 in lymphoma than that in healthy individual
Studied Phenotype	Lymphoma [ICD-11:2B30]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:3.78E-07; Fold-change:-0.316094332; Z-score:-1.142915477
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Posterior fossa ependymoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypomethylation of SLC10A6 in posterior fossa ependymoma than that in healthy individual
Studied Phenotype	Posterior fossa ependymoma [ICD-11:2D50.2]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:3.27E-38; Fold-change:-0.334529489; Z-score:-1.600292092
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
RELA YAP fusion ependymoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypomethylation of SLC10A6 in rela yap fusion ependymoma than that in healthy individual
Studied Phenotype	RELA YAP fusion ependymoma [ICD-11:2A00.0Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:4.32E-18; Fold-change:-0.400491022; Z-score:-1.69115592
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Lung cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypomethylation of SLC10A6 in lung cancer than that in adjacent tissue
Studied Phenotype	Lung cancer [ICD-11:2C25]
The Methylation Level of Disease Section Compare with the Adjacent Tissue	p-value:1.16E-12; Fold-change:-0.587801395; Z-score:-7.931521734
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals DT methylation level in tissue other than the diseased tissue of patients
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual Download DT methylation data in the tissue of the other disease section
microRNA
Unclear Phenotype	101 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	miR-1253 directly targets SLC10A6			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1253	miRNA Mature ID	miR-1253
miRNA Sequence	AGAGAAGAAGAUCAGCCUGCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon2	miR-1255a directly targets SLC10A6			[ 9 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1255a	miRNA Mature ID	miR-1255a
miRNA Sequence	AGGAUGAGCAAAGAAAGUAGAUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon3	miR-1273h directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1273h	miRNA Mature ID	miR-1273h-5p
miRNA Sequence	CUGGGAGGUCAAGGCUGCAGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon4	miR-1281 directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1281	miRNA Mature ID	miR-1281
miRNA Sequence	UCGCCUCCUCCUCUCCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon5	miR-1288 directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1288	miRNA Mature ID	miR-1288-5p
miRNA Sequence	GCAGAUCAGGACUGUAACUCACC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon6	miR-1304 directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1304	miRNA Mature ID	miR-1304-3p
miRNA Sequence	UCUCACUGUAGCCUCGAACCCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon7	miR-1307 directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1307	miRNA Mature ID	miR-1307-3p
miRNA Sequence	ACUCGGCGUGGCGUCGGUCGUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon8	miR-1343 directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1343	miRNA Mature ID	miR-1343-3p
miRNA Sequence	CUCCUGGGGCCCGCACUCUCGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon9	miR-1343 directly targets SLC10A6			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1343	miRNA Mature ID	miR-1343-5p
miRNA Sequence	UGGGGAGCGGCCCCCGGGUGGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon10	miR-149 directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-149	miRNA Mature ID	miR-149-3p
miRNA Sequence	AGGGAGGGACGGGGGCUGUGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon11	miR-193a directly targets SLC10A6			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-193a	miRNA Mature ID	miR-193a-3p
miRNA Sequence	AACUGGCCUACAAAGUCCCAGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon12	miR-193b directly targets SLC10A6			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-193b	miRNA Mature ID	miR-193b-3p
miRNA Sequence	AACUGGCCCUCAAAGUCCCGCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon13	miR-219b directly targets SLC10A6			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-219b	miRNA Mature ID	miR-219b-3p
miRNA Sequence	AGAAUUGCGUUUGGACAAUCAGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon14	miR-23a directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-23a	miRNA Mature ID	miR-23a-5p
miRNA Sequence	GGGGUUCCUGGGGAUGGGAUUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon15	miR-23b directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-23b	miRNA Mature ID	miR-23b-5p
miRNA Sequence	UGGGUUCCUGGCAUGCUGAUUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon16	miR-25 directly targets SLC10A6			[ 9 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-25	miRNA Mature ID	miR-25-5p
miRNA Sequence	AGGCGGAGACUUGGGCAAUUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon17	miR-302f directly targets SLC10A6			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-302f	miRNA Mature ID	miR-302f
miRNA Sequence	UAAUUGCUUCCAUGUUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon18	miR-30b directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-30b	miRNA Mature ID	miR-30b-3p
miRNA Sequence	CUGGGAGGUGGAUGUUUACUUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon19	miR-30c-1 directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-30c-1	miRNA Mature ID	miR-30c-1-3p
miRNA Sequence	CUGGGAGAGGGUUGUUUACUCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon20	miR-30c-2 directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-30c-2	miRNA Mature ID	miR-30c-2-3p
miRNA Sequence	CUGGGAGAAGGCUGUUUACUCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon21	miR-3116 directly targets SLC10A6			[ 9 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3116	miRNA Mature ID	miR-3116
miRNA Sequence	UGCCUGGAACAUAGUAGGGACU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon22	miR-3122 directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3122	miRNA Mature ID	miR-3122
miRNA Sequence	GUUGGGACAAGAGGACGGUCUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon23	miR-3160 directly targets SLC10A6			[ 9 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3160	miRNA Mature ID	miR-3160-3p
miRNA Sequence	AGAGCUGAGACUAGAAAGCCCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon24	miR-3175 directly targets SLC10A6			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3175	miRNA Mature ID	miR-3175
miRNA Sequence	CGGGGAGAGAACGCAGUGACGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon25	miR-3190 directly targets SLC10A6			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3190	miRNA Mature ID	miR-3190-5p
miRNA Sequence	UCUGGCCAGCUACGUCCCCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon26	miR-3197 directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3197	miRNA Mature ID	miR-3197
miRNA Sequence	GGAGGCGCAGGCUCGGAAAGGCG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon27	miR-3202 directly targets SLC10A6			[ 9 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3202	miRNA Mature ID	miR-3202
miRNA Sequence	UGGAAGGGAGAAGAGCUUUAAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon28	miR-3614 directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3614	miRNA Mature ID	miR-3614-5p
miRNA Sequence	CCACUUGGAUCUGAAGGCUGCCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon29	miR-3672 directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3672	miRNA Mature ID	miR-3672
miRNA Sequence	AUGAGACUCAUGUAAAACAUCUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon30	miR-3675 directly targets SLC10A6			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3675	miRNA Mature ID	miR-3675-3p
miRNA Sequence	CAUCUCUAAGGAACUCCCCCAA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon31	miR-3689a directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3689a	miRNA Mature ID	miR-3689a-3p
miRNA Sequence	CUGGGAGGUGUGAUAUCGUGGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon32	miR-3689b directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3689b	miRNA Mature ID	miR-3689b-3p
miRNA Sequence	CUGGGAGGUGUGAUAUUGUGGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon33	miR-3689c directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3689c	miRNA Mature ID	miR-3689c
miRNA Sequence	CUGGGAGGUGUGAUAUUGUGGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon34	miR-383 directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-383	miRNA Mature ID	miR-383-3p
miRNA Sequence	ACAGCACUGCCUGGUCAGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon35	miR-3913 directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3913	miRNA Mature ID	miR-3913-5p
miRNA Sequence	UUUGGGACUGAUCUUGAUGUCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon36	miR-3926 directly targets SLC10A6			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3926	miRNA Mature ID	miR-3926
miRNA Sequence	UGGCCAAAAAGCAGGCAGAGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon37	miR-3929 directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3929	miRNA Mature ID	miR-3929
miRNA Sequence	GAGGCUGAUGUGAGUAGACCACU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon38	miR-4434 directly targets SLC10A6			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4434	miRNA Mature ID	miR-4434
miRNA Sequence	AGGAGAAGUAAAGUAGAA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon39	miR-4463 directly targets SLC10A6			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4463	miRNA Mature ID	miR-4463
miRNA Sequence	GAGACUGGGGUGGGGCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon40	miR-4478 directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4478	miRNA Mature ID	miR-4478
miRNA Sequence	GAGGCUGAGCUGAGGAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon41	miR-4485 directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4485	miRNA Mature ID	miR-4485-5p
miRNA Sequence	ACCGCCUGCCCAGUGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon42	miR-4487 directly targets SLC10A6			[ 9 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4487	miRNA Mature ID	miR-4487
miRNA Sequence	AGAGCUGGCUGAAGGGCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon43	miR-4516 directly targets SLC10A6			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4516	miRNA Mature ID	miR-4516
miRNA Sequence	GGGAGAAGGGUCGGGGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon44	miR-4533 directly targets SLC10A6			[ 9 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4533	miRNA Mature ID	miR-4533
miRNA Sequence	UGGAAGGAGGUUGCCGGACGCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon45	miR-455 directly targets SLC10A6			[ 9 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-455	miRNA Mature ID	miR-455-3p
miRNA Sequence	GCAGUCCAUGGGCAUAUACAC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon46	miR-4638 directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4638	miRNA Mature ID	miR-4638-5p
miRNA Sequence	ACUCGGCUGCGGUGGACAAGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon47	miR-4649 directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4649	miRNA Mature ID	miR-4649-3p
miRNA Sequence	UCUGAGGCCUGCCUCUCCCCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon48	miR-4667 directly targets SLC10A6			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4667	miRNA Mature ID	miR-4667-5p
miRNA Sequence	ACUGGGGAGCAGAAGGAGAACC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon49	miR-4684 directly targets SLC10A6			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4684	miRNA Mature ID	miR-4684-5p
miRNA Sequence	CUCUCUACUGACUUGCAACAUA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon50	miR-4700 directly targets SLC10A6			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4700	miRNA Mature ID	miR-4700-5p
miRNA Sequence	UCUGGGGAUGAGGACAGUGUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon51	miR-4722 directly targets SLC10A6			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4722	miRNA Mature ID	miR-4722-5p
miRNA Sequence	GGCAGGAGGGCUGUGCCAGGUUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon52	miR-4728 directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4728	miRNA Mature ID	miR-4728-5p
miRNA Sequence	UGGGAGGGGAGAGGCAGCAAGCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon53	miR-4768 directly targets SLC10A6			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4768	miRNA Mature ID	miR-4768-3p
miRNA Sequence	CCAGGAGAUCCAGAGAGAAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon54	miR-4772 directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4772	miRNA Mature ID	miR-4772-3p
miRNA Sequence	CCUGCAACUUUGCCUGAUCAGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon55	miR-4786 directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4786	miRNA Mature ID	miR-4786-5p
miRNA Sequence	UGAGACCAGGACUGGAUGCACC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon56	miR-485 directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-485	miRNA Mature ID	miR-485-5p
miRNA Sequence	AGAGGCUGGCCGUGAUGAAUUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon57	miR-490 directly targets SLC10A6			[ 9 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-490	miRNA Mature ID	miR-490-3p
miRNA Sequence	CAACCUGGAGGACUCCAUGCUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon58	miR-548s directly targets SLC10A6			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-548s	miRNA Mature ID	miR-548s
miRNA Sequence	AUGGCCAAAACUGCAGUUAUUUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon59	miR-558 directly targets SLC10A6			[ 9 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-558	miRNA Mature ID	miR-558
miRNA Sequence	UGAGCUGCUGUACCAAAAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon60	miR-5703 directly targets SLC10A6			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5703	miRNA Mature ID	miR-5703
miRNA Sequence	AGGAGAAGUCGGGAAGGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon61	miR-619 directly targets SLC10A6			[ 9 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-619	miRNA Mature ID	miR-619-3p
miRNA Sequence	GACCUGGACAUGUUUGUGCCCAGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon62	miR-6499 directly targets SLC10A6			[ 9 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6499	miRNA Mature ID	miR-6499-3p
miRNA Sequence	AGCAGUGUUUGUUUUGCCCACA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon63	miR-6500 directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6500	miRNA Mature ID	miR-6500-3p
miRNA Sequence	ACACUUGUUGGGAUGACCUGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon64	miR-6513 directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6513	miRNA Mature ID	miR-6513-5p
miRNA Sequence	UUUGGGAUUGACGCCACAUGUCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon65	miR-6516 directly targets SLC10A6			[ 9 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6516	miRNA Mature ID	miR-6516-5p
miRNA Sequence	UUUGCAGUAACAGGUGUGAGCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon66	miR-658 directly targets SLC10A6			[ 9 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-658	miRNA Mature ID	miR-658
miRNA Sequence	GGCGGAGGGAAGUAGGUCCGUUGGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon67	miR-660 directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-660	miRNA Mature ID	miR-660-3p
miRNA Sequence	ACCUCCUGUGUGCAUGGAUUA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon68	miR-665 directly targets SLC10A6			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-665	miRNA Mature ID	miR-665
miRNA Sequence	ACCAGGAGGCUGAGGCCCCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon69	miR-6741 directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6741	miRNA Mature ID	miR-6741-3p
miRNA Sequence	UCGGCUCUCUCCCUCACCCUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon70	miR-6742 directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6742	miRNA Mature ID	miR-6742-3p
miRNA Sequence	ACCUGGGUUGUCCCCUCUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon71	miR-6744 directly targets SLC10A6			[ 9 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6744	miRNA Mature ID	miR-6744-5p
miRNA Sequence	UGGAUGACAGUGGAGGCCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon72	miR-6763 directly targets SLC10A6			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6763	miRNA Mature ID	miR-6763-5p
miRNA Sequence	CUGGGGAGUGGCUGGGGAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon73	miR-6765 directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6765	miRNA Mature ID	miR-6765-5p
miRNA Sequence	GUGAGGCGGGGCCAGGAGGGUGUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon74	miR-6771 directly targets SLC10A6			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6771	miRNA Mature ID	miR-6771-3p
miRNA Sequence	CAAACCCCUGUCUACCCGCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon75	miR-6779 directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6779	miRNA Mature ID	miR-6779-5p
miRNA Sequence	CUGGGAGGGGCUGGGUUUGGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon76	miR-6780a directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6780a	miRNA Mature ID	miR-6780a-5p
miRNA Sequence	UUGGGAGGGAAGACAGCUGGAGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon77	miR-6783 directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6783	miRNA Mature ID	miR-6783-3p
miRNA Sequence	UUCCUGGGCUUCUCCUCUGUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon78	miR-6785 directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6785	miRNA Mature ID	miR-6785-5p
miRNA Sequence	UGGGAGGGCGUGGAUGAUGGUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon79	miR-6788 directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6788	miRNA Mature ID	miR-6788-5p
miRNA Sequence	CUGGGAGAAGAGUGGUGAAGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon80	miR-6791 directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6791	miRNA Mature ID	miR-6791-3p
miRNA Sequence	UGCCUCCUUGGUCUCCGGCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon81	miR-6799 directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6799	miRNA Mature ID	miR-6799-5p
miRNA Sequence	GGGGAGGUGUGCAGGGCUGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon82	miR-6808 directly targets SLC10A6			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6808	miRNA Mature ID	miR-6808-5p
miRNA Sequence	CAGGCAGGGAGGUGGGACCAUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon83	miR-6825 directly targets SLC10A6			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6825	miRNA Mature ID	miR-6825-5p
miRNA Sequence	UGGGGAGGUGUGGAGUCAGCAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon84	miR-6829 directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6829	miRNA Mature ID	miR-6829-3p
miRNA Sequence	UGCCUCCUCCGUGGCCUCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon85	miR-6852 directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6852	miRNA Mature ID	miR-6852-5p
miRNA Sequence	CCCUGGGGUUCUGAGGACAUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon86	miR-6864 directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6864	miRNA Mature ID	miR-6864-3p
miRNA Sequence	GUGAGACUUCUCUCCCUUCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon87	miR-6883 directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6883	miRNA Mature ID	miR-6883-5p
miRNA Sequence	AGGGAGGGUGUGGUAUGGAUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon88	miR-6884 directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6884	miRNA Mature ID	miR-6884-5p
miRNA Sequence	AGAGGCUGAGAAGGUGAUGUUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon89	miR-6890 directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6890	miRNA Mature ID	miR-6890-3p
miRNA Sequence	CCACUGCCUAUGCCCCACAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon90	miR-6893 directly targets SLC10A6			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6893	miRNA Mature ID	miR-6893-5p
miRNA Sequence	CAGGCAGGUGUAGGGUGGAGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon91	miR-7106 directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-7106	miRNA Mature ID	miR-7106-5p
miRNA Sequence	UGGGAGGAGGGGAUCUUGGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon92	miR-7112 directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-7112	miRNA Mature ID	miR-7112-5p
miRNA Sequence	ACGGGCAGGGCAGUGCACCCUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon93	miR-7160 directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-7160	miRNA Mature ID	miR-7160-5p
miRNA Sequence	UGCUGAGGUCCGGGCUGUGCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon94	miR-769 directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-769	miRNA Mature ID	miR-769-5p
miRNA Sequence	UGAGACCUCUGGGUUCUGAGCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon95	miR-7977 directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-7977	miRNA Mature ID	miR-7977
miRNA Sequence	UUCCCAGCCAACGCACCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon96	miR-8087 directly targets SLC10A6			[ 9 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-8087	miRNA Mature ID	miR-8087
miRNA Sequence	GAAGACUUCUUGGAUUACAGGGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon97	miR-8089 directly targets SLC10A6			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-8089	miRNA Mature ID	miR-8089
miRNA Sequence	CCUGGGGACAGGGGAUUGGGGCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon98	miR-887 directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-887	miRNA Mature ID	miR-887-5p
miRNA Sequence	CUUGGGAGCCCUGUUAGACUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon99	miR-939 directly targets SLC10A6			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-939	miRNA Mature ID	miR-939-3p
miRNA Sequence	CCCUGGGCCUCUGCUCCCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon100	miR-939 directly targets SLC10A6			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-939	miRNA Mature ID	miR-939-5p
miRNA Sequence	UGGGGAGCUGAGGCUCUGGGGGUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon101	miR-940 directly targets SLC10A6			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-940	miRNA Mature ID	miR-940
miRNA Sequence	AAGGCAGGGCCCCCGCUCCCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human

References
1	DNA Methylation Dynamics in Urological Tumors.
2	Genome-wide Scan for Methylation Profiles in Breast Cancer
3	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
4	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
5	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
6	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
7	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
8	Direct conversion of fibroblasts to neurons by reprogramming PTB-regulated microRNA circuits. Cell. 2013 Jan 17;152(1-2):82-96.
9	The Landscape of microRNA Targeting in Prostate Cancer Defined by AGO-PAR-CLIP. Neoplasia. 2016 Jun;18(6):356-70.
10	Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence