Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0071 Transporter Info | ||||
| Gene Name | ABCG1 | ||||
| Transporter Name | ATP-binding cassette sub-family G member 1 | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
microRNA |
|||||
|
Ischemic stroke |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Higher expression of miR-23a-5p in acute ischemic stroke | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Luciferase reporter assay | ||
|
Related Molecular Changes | Down regulation ofABCG1 | Experiment Method | RT-qPCR | ||
|
miRNA Stemloop ID |
miR-23a | miRNA Mature ID | miR-23a-5p | ||
|
miRNA Sequence |
GGGGUUCCUGGGGAUGGGAUUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Studied Phenotype |
Ischemic stroke[ ICD-11:8B11] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Additional Notes |
miR-23a-5p regulates cholesterol efflux in ABCG1-dependent pathway and miR-23a-5p might be a potential therapeutic target for suppressing atherosclerosis. | ||||
|
Gastric cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
miR-129-5p downregulates of ABCG1 in gastric cancer | [ 3 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Luciferase reporter assay | ||
|
Related Molecular Changes | Down regulation ofABCG1 | Experiment Method | Western Blot | ||
|
miRNA Stemloop ID |
miR-129 | miRNA Mature ID | miR-129-5p | ||
|
miRNA Sequence |
CUUUUUGCGGUCUGGGCUUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Studied Phenotype |
Gastric cancer[ ICD-11:2B72] | ||||
|
Experimental Material |
Human gastric adenocarcinoma cell line (SGC7901) | ||||
|
Additional Notes |
miR-129-5p regulates ABCG1 expression in vivo at the post-transcriptional level. | ||||
|
Unclear Phenotype |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
miR-10b directly targets RALBP1 | [ 6 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | miRNA Microarray Analysis | ||
|
miRNA Stemloop ID |
miR-10b | miRNA Mature ID | miR-10b-5p | ||
|
miRNA Sequence |
UACCCUGUAGAACCGAAUUUGUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon2 |
miR-129 directly targets ABCG1 | [ 3 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Immunohistochemistry//Luciferase reporter assay//Microarray//qRT-PCR//Western blot | ||
|
miRNA Stemloop ID |
miR-129 | miRNA Mature ID | miR-129-5p | ||
|
miRNA Sequence |
CUUUUUGCGGUCUGGGCUUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human gastric adenocarcinoma cell line (SGC7901) | ||||
|
Methylation |
|||||
|
Coronary heart disease |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Hypermethylation of ABCG1 in coronary heart disease | [ 1 ] | |||
|
Location |
Promoter (cg06500161) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | HumanMethylation450 BeadChip | ||
|
Related Molecular Changes | Down regulation ofABCG1 | Experiment Method | RT-qPCR | ||
|
Studied Phenotype |
Coronary heart disease[ ICD-11:BA80.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Additional Notes |
ABCG1 methylation (cg06500161) was negatively associated with ABCG1 mRNA levels. | ||||
|
Epigenetic Phenomenon2 |
Hypermethylation of ABCG1 in coronary heart disease | [ 4 ] | |||
|
Location |
Promoter | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Methylation-specific PCR | ||
|
Studied Phenotype |
Coronary heart disease[ ICD-11:BA80.Z] | ||||
|
Frequency |
52 (61%) out of the 85 studied sample | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Additional Notes |
Promoter DNA Hypermethylation of the ABCG1 is associated with an increased risk of CHD (p<0.001). | ||||
|
Type 2 diabetes |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Hypermethylation of ABCG1 in type 2 diabetes | [ 5 ] | |||
|
Location |
Promoter (cg06500161) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | . | ||
|
Studied Phenotype |
Type 2 diabetes[ ICD-11:5A11] | ||||
|
Frequency |
58% of the studied samples | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Additional Notes |
Increase risk for future type 2 diabetes | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.