Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0040 Transporter Info | ||||
| Gene Name | ABCA2 | ||||
| Transporter Name | ATP-binding cassette sub-family A member 2 | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
Methylation |
|||||
|
Alzheimer's disease |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Hypermethylation of ABCA2 in alzheimer's disease | [ 1 ] | |||
|
Location |
cg13930557; cg03349123 | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Microarray | ||
|
Studied Phenotype |
Alzheimer's disease[ ICD-11:8A20] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Additional Notes |
High methylation level of the CpG islands (cg13930557, cg03349123) was negatively and significantly associated with AD risk(p<0.034). | ||||
|
microRNA |
|||||
|
Unclear Phenotype |
12 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
miR-320b directly targets ABCA2 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-320b | miRNA Mature ID | miR-320b | ||
|
miRNA Sequence |
AAAAGCUGGGUUGAGAGGGCAA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon2 |
miR-320c directly targets ABCA2 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-320c | miRNA Mature ID | miR-320c | ||
|
miRNA Sequence |
AAAAGCUGGGUUGAGAGGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon3 |
miR-320d directly targets ABCA2 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-320d | miRNA Mature ID | miR-320d | ||
|
miRNA Sequence |
AAAAGCUGGGUUGAGAGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon4 |
miR-320e directly targets ABCA2 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-320e | miRNA Mature ID | miR-320e | ||
|
miRNA Sequence |
AAAGCUGGGUUGAGAAGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon5 |
miR-4429 directly targets ABCA2 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4429 | miRNA Mature ID | miR-4429 | ||
|
miRNA Sequence |
AAAAGCUGGGCUGAGAGGCG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon6 |
miR-4644 directly targets ABCA2 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4644 | miRNA Mature ID | miR-4644 | ||
|
miRNA Sequence |
UGGAGAGAGAAAAGAGACAGAAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon7 |
miR-4722 directly targets ABCA2 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4722 | miRNA Mature ID | miR-4722-5p | ||
|
miRNA Sequence |
GGCAGGAGGGCUGUGCCAGGUUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon8 |
miR-4768 directly targets ABCA2 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4768 | miRNA Mature ID | miR-4768-3p | ||
|
miRNA Sequence |
CCAGGAGAUCCAGAGAGAAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon9 |
miR-485 directly targets ABCA2 | [ 3 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-485 | miRNA Mature ID | miR-485-5p | ||
|
miRNA Sequence |
AGAGGCUGGCCGUGAUGAAUUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
miR-6089 directly targets ABCA2 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6089 | miRNA Mature ID | miR-6089 | ||
|
miRNA Sequence |
GGAGGCCGGGGUGGGGCGGGGCGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon11 |
miR-6721 directly targets ABCA2 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6721 | miRNA Mature ID | miR-6721-5p | ||
|
miRNA Sequence |
UGGGCAGGGGCUUAUUGUAGGAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon12 |
miR-7112 directly targets ABCA2 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-7112 | miRNA Mature ID | miR-7112-5p | ||
|
miRNA Sequence |
ACGGGCAGGGCAGUGCACCCUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.