General Information of Drug Transporter (DT)
DT ID DTD0038 Transporter Info
Gene Name ABCA12
Transporter Name ATP-binding cassette sub-family A member 12
Gene ID
26154
UniProt ID
Q86UK0
Epigenetic Regulations of This DT (EGR)

Methylation

  Panic disorder

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of ABCA12 in panic disorder [ 1 ]

Location

TSS1500 (cg16244747)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:7.84E-04; Z-score:6.07E-01

Methylation in Case

3.08E+00 (Median) Methylation in Control 2.93E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Liver cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate/significant hypermethylation of ABCA12 in liver cancer than that in healthy individual/adjacent tissue

Studied Phenotype

Liver cancer [ICD-11:2C12]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:0.00022114; Fold-change:-0.289718175; Z-score:-1.201309298

The Methylation Level of Disease Section Compare with the Adjacent Tissue

p-value:2.71E-12; Fold-change:-0.315220809; Z-score:-3.206904601
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
DT methylation level in tissue other than the diseased tissue of patients
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Craniopharyngioma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypermethylation of ABCA12 in craniopharyngioma than that in healthy individual

Studied Phenotype

Craniopharyngioma [ICD-11:2F9A]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:4.50E-08; Fold-change:0.279029793; Z-score:1.812505515
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Esthesioneuroblastoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypermethylation of ABCA12 in esthesioneuroblastoma than that in healthy individual

Studied Phenotype

Esthesioneuroblastoma [ICD-11:2D50.1]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:3.05E-15; Fold-change:0.50855963; Z-score:3.687746741
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Prostate cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypermethylation of ABCA12 in prostate cancer than that in healthy individual

Studied Phenotype

Prostate cancer [ICD-11:2C82]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:0.00590562; Fold-change:0.357869053; Z-score:1.272747064
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Brain neuroblastoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of ABCA12 in brain neuroblastoma than that in healthy individual

Studied Phenotype

Brain neuroblastoma [ICD-11:2A00.11]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:1.23E-17; Fold-change:-0.350501936; Z-score:-2.551281416
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

microRNA

  Unclear Phenotype

         17 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-1249 directly targets ABCA12 [ 2 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1249 miRNA Mature ID miR-1249-3p

miRNA Sequence

ACGCCCUUCCCCCCCUUCUUCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon2

miR-1295b directly targets ABCA12 [ 2 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1295b miRNA Mature ID miR-1295b-5p

miRNA Sequence

CACCCAGAUCUGCGGCCUAAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon3

miR-3130 directly targets ABCA12 [ 2 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3130 miRNA Mature ID miR-3130-5p

miRNA Sequence

UACCCAGUCUCCGGUGCAGCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon4

miR-329 directly targets ABCA12 [ 2 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-329 miRNA Mature ID miR-329-3p

miRNA Sequence

AACACACCUGGUUAACCUCUUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon5

miR-335 directly targets ABCA12 [ 3 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-335 miRNA Mature ID miR-335-5p

miRNA Sequence

UCAAGAGCAAUAACGAAAAAUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon6

miR-362 directly targets ABCA12 [ 2 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-362 miRNA Mature ID miR-362-3p

miRNA Sequence

AACACACCUAUUCAAGGAUUCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon7

miR-3679 directly targets ABCA12 [ 2 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3679 miRNA Mature ID miR-3679-3p

miRNA Sequence

CUUCCCCCCAGUAAUCUUCAUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon8

miR-4287 directly targets ABCA12 [ 2 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4287 miRNA Mature ID miR-4287

miRNA Sequence

UCUCCCUUGAGGGCACUUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon9

miR-4482 directly targets ABCA12 [ 2 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4482 miRNA Mature ID miR-4482-5p

miRNA Sequence

AACCCAGUGGGCUAUGGAAAUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon10

miR-4685 directly targets ABCA12 [ 2 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4685 miRNA Mature ID miR-4685-3p

miRNA Sequence

UCUCCCUUCCUGCCCUGGCUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon11

miR-5088 directly targets ABCA12 [ 2 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-5088 miRNA Mature ID miR-5088-3p

miRNA Sequence

UCCCUUCUUCCUGGGCCCUCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon12

miR-642a directly targets ABCA12 [ 2 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-642a miRNA Mature ID miR-642a-3p

miRNA Sequence

AGACACAUUUGGAGAGGGAACC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon13

miR-642b directly targets ABCA12 [ 2 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-642b miRNA Mature ID miR-642b-3p

miRNA Sequence

AGACACAUUUGGAGAGGGACCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon14

miR-660 directly targets ABCA12 [ 2 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-660 miRNA Mature ID miR-660-5p

miRNA Sequence

UACCCAUUGCAUAUCGGAGUUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon15

miR-6730 directly targets ABCA12 [ 2 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6730 miRNA Mature ID miR-6730-3p

miRNA Sequence

CCUGACACCCCAUCUGCCCUCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon16

miR-6734 directly targets ABCA12 [ 2 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6734 miRNA Mature ID miR-6734-3p

miRNA Sequence

CCCUUCCCUCACUCUUCUCUCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon17

miR-6887 directly targets ABCA12 [ 2 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6887 miRNA Mature ID miR-6887-3p

miRNA Sequence

UCCCCUCCACUUUCCUCCUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human
References
1 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
2 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
3 Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.