General Information of Drug Transporter (DT)
DT ID DTD0029 Transporter Info
Gene Name SLCO1A2
Transporter Name Organic anion transporting polypeptide 1A2
Gene ID
6579
UniProt ID
P46721
Epigenetic Regulations of This DT (EGR)

Methylation

  Atypical teratoid rhabdoid tumor

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLCO1A2 in atypical teratoid rhabdoid tumor [ 1 ]

Location

5'UTR (cg11704114)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.30E+00 Statistic Test p-value:3.40E-07; Z-score:-1.57E+00

Methylation in Case

4.77E-01 (Median) Methylation in Control 6.22E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Bladder cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLCO1A2 in bladder cancer [ 2 ]

Location

5'UTR (cg11704114)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.95E+00 Statistic Test p-value:2.70E-12; Z-score:-1.12E+01

Methylation in Case

2.13E-01 (Median) Methylation in Control 6.29E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Breast cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLCO1A2 in breast cancer [ 3 ]

Location

5'UTR (cg11704114)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:1.46E-04; Z-score:-1.08E+00

Methylation in Case

5.34E-01 (Median) Methylation in Control 5.88E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Colorectal cancer

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLCO1A2 in colorectal cancer [ 4 ]

Location

5'UTR (cg11704114)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.25E+00 Statistic Test p-value:1.05E-12; Z-score:-2.67E+00

Methylation in Case

6.48E-01 (Median) Methylation in Control 8.11E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Hepatocellular carcinoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLCO1A2 in hepatocellular carcinoma [ 5 ]

Location

5'UTR (cg11704114)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:6.50E-05; Z-score:-7.08E-01

Methylation in Case

6.71E-01 (Median) Methylation in Control 7.21E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  HIV infection

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLCO1A2 in HIV infection [ 6 ]

Location

5'UTR (cg11704114)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:1.50E-02; Z-score:-5.90E-01

Methylation in Case

7.49E-01 (Median) Methylation in Control 7.76E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Panic disorder

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLCO1A2 in panic disorder [ 7 ]

Location

5'UTR (cg11704114)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-6.41E+00 Statistic Test p-value:1.56E-07; Z-score:-9.06E-01

Methylation in Case

8.71E-02 (Median) Methylation in Control 5.58E-01 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLCO1A2 in papillary thyroid cancer [ 8 ]

Location

5'UTR (cg11704114)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.08E+00 Statistic Test p-value:5.56E-07; Z-score:-9.56E-01

Methylation in Case

6.77E-01 (Median) Methylation in Control 7.31E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Pancretic ductal adenocarcinoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLCO1A2 in pancretic ductal adenocarcinoma [ 9 ]

Location

TSS1500 (cg26743024)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.26E+00 Statistic Test p-value:1.31E-06; Z-score:-1.27E+00

Methylation in Case

3.68E-01 (Median) Methylation in Control 4.64E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Brain neuroblastoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of SLCO1A2 in brain neuroblastoma than that in healthy individual

Studied Phenotype

Brain neuroblastoma [ICD-11:2A00.11]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:5.65E-16; Fold-change:-0.37396627; Z-score:-8.589943892
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

microRNA

  B-cell acute lymphoblastic leukemia

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-595 downregulates SLCO1A2 in B-cell acute lymphoblastic leukemia [ 10 ]

Epigenetic Type

microRNA Experiment Method In-silico analysis

Related Molecular Changes

Down regulation ofSLCO1A2 Experiment Method RT-qPCR

miRNA Stemloop ID

miR-595 miRNA Mature ID miR-595

miRNA Sequence

GAAGUGUGCCGUGGUGUGUCU

miRNA Target Type

Direct

Studied Phenotype

B-cell acute lymphoblastic leukemia[ ICD-11:2A82]

Experimental Material

Patient tissue samples

Additional Notes

SNPs in miR-595 that might affect SLCO1A2 MTX transport gene regulation and could affect MTX levels in patients with pediatric B-cell ALL.
References
1 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2 DNA Methylation Dynamics in Urological Tumors.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
5 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
6 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
7 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
8 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
9 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
10 MiR-pharmacogenetics of methotrexate in childhood B-cell acute lymphoblastic leukemia. Pharmacogenet Genomics. 2016 Nov;26(11):517-525.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.