Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0023 Transporter Info
Gene Name SLC22A5
Transporter Name Organic cation/carnitine transporter 2
Gene ID
6584
UniProt ID
O76082
Epigenetic Regulations of This DT (EGR)

Methylation

  Colon cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Hypermethylation of SLC22A5 in colon cancer [ 1 ]

Location

 Promoter (-84 to +591, +1275 to 1492 bp)

Epigenetic Type

 Methylation Experiment Method Methylation-specific PCR

Related Molecular Changes

 Down regulation ofSLC22A5 Experiment Method RT-qPCR

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Human colon cancer cell line (LS174T)

Additional Notes

 Hypermethylation within the OCTN2 promoter is responsible for the down-regulation of OCTN2 in HepG2.

  Hepatocellular carcinoma

            8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Hypermethylation of SLC22A5 in hepatpcellular carcinoma [ 1 ]

Location

 Promoter (-274 to -97, +1275 to +1492 bp)

Epigenetic Type

 Methylation Experiment Method Methylation-specific PCR

Related Molecular Changes

 Down regulation ofSLC22A5 Experiment Method RT-qPCR

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Human hepatocellular carcinoma cell line (HepG2)

Additional Notes

 Hypermethylation within the OCTN2 promoter is responsible for the down-regulation of OCTN2 in HepG2.

  Epigenetic Phenomenon2

 Methylation of SLC22A5 in hepatocellular carcinoma [ 8 ]

Location

 TSS1500 (cg06746492)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.57E+00 Statistic Test p-value:2.05E-16; Z-score:-3.28E+00

Methylation in Case

 4.76E-01 (Median) Methylation in Control 7.47E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC22A5 in hepatocellular carcinoma [ 8 ]

Location

 TSS1500 (cg14196790)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.13E+00 Statistic Test p-value:1.07E-02; Z-score:-3.77E-01

Methylation in Case

 1.10E-01 (Median) Methylation in Control 1.24E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC22A5 in hepatocellular carcinoma [ 8 ]

Location

 Body (cg17989736)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-2.05E+00 Statistic Test p-value:5.49E-25; Z-score:-7.00E+00

Methylation in Case

 3.59E-01 (Median) Methylation in Control 7.36E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC22A5 in hepatocellular carcinoma [ 8 ]

Location

 Body (cg06588735)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.55E+00 Statistic Test p-value:7.48E-15; Z-score:-4.28E+00

Methylation in Case

 5.33E-01 (Median) Methylation in Control 8.28E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC22A5 in hepatocellular carcinoma [ 8 ]

Location

 Body (cg24642933)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.26E+00 Statistic Test p-value:1.55E-12; Z-score:-2.68E+00

Methylation in Case

 4.73E-01 (Median) Methylation in Control 5.99E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon7

 Methylation of SLC22A5 in hepatocellular carcinoma [ 8 ]

Location

 Body (cg16647868)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.19E+00 Statistic Test p-value:3.25E-06; Z-score:-1.01E+00

Methylation in Case

 1.01E-01 (Median) Methylation in Control 1.21E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon8

 Methylation of SLC22A5 in hepatocellular carcinoma [ 8 ]

Location

 Body (cg12558347)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.04E+00 Statistic Test p-value:2.16E-02; Z-score:3.56E-01

Methylation in Case

 5.64E-01 (Median) Methylation in Control 5.42E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Colon cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC22A5 in colon adenocarcinoma [ 2 ]

Location

 5'UTR (cg19918022)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.08E+00 Statistic Test p-value:3.20E-04; Z-score:-2.78E+00

Methylation in Case

 7.67E-01 (Median) Methylation in Control 8.31E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC22A5 in colon adenocarcinoma [ 2 ]

Location

 1stExon (cg15668691)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.04E+00 Statistic Test p-value:6.84E-04; Z-score:-1.38E+00

Methylation in Case

 8.28E-01 (Median) Methylation in Control 8.59E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC22A5 in colon adenocarcinoma [ 2 ]

Location

 Body (cg21803141)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.12E+00 Statistic Test p-value:2.49E-05; Z-score:-2.53E+00

Methylation in Case

 5.32E-01 (Median) Methylation in Control 5.96E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC22A5 in pancretic ductal adenocarcinoma [ 3 ]

Location

 5'UTR (cg10589249)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.07E+00 Statistic Test p-value:1.89E-05; Z-score:3.48E-01

Methylation in Case

 3.13E-02 (Median) Methylation in Control 2.92E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Bladder cancer

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC22A5 in bladder cancer [ 4 ]

Location

 TSS1500 (cg14196790)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.57E+00 Statistic Test p-value:4.50E-02; Z-score:-1.72E+00

Methylation in Case

 8.99E-02 (Median) Methylation in Control 1.41E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC22A5 in bladder cancer [ 4 ]

Location

 TSS200 (cg21911579)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.22E+00 Statistic Test p-value:4.37E-02; Z-score:-1.34E+00

Methylation in Case

 3.26E-02 (Median) Methylation in Control 3.99E-02 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC22A5 in bladder cancer [ 4 ]

Location

 Body (cg19040266)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.63E+00 Statistic Test p-value:1.06E-07; Z-score:-1.81E+01

Methylation in Case

 2.88E-01 (Median) Methylation in Control 4.70E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC22A5 in bladder cancer [ 4 ]

Location

 Body (cg18104539)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.10E+00 Statistic Test p-value:4.43E-06; Z-score:-7.34E+00

Methylation in Case

 8.10E-01 (Median) Methylation in Control 8.94E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC22A5 in bladder cancer [ 4 ]

Location

 Body (cg23475112)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.01E+00 Statistic Test p-value:2.02E-02; Z-score:-7.98E-01

Methylation in Case

 9.58E-01 (Median) Methylation in Control 9.65E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC22A5 in bladder cancer [ 4 ]

Location

 Body (cg16647868)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.20E+00 Statistic Test p-value:4.58E-02; Z-score:-1.13E+00

Methylation in Case

 1.09E-01 (Median) Methylation in Control 1.30E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon7

 Methylation of SLC22A5 in bladder cancer [ 4 ]

Location

 3'UTR (cg12481567)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.03E+00 Statistic Test p-value:2.42E-02; Z-score:-2.29E+00

Methylation in Case

 8.63E-01 (Median) Methylation in Control 8.85E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC22A5 in clear cell renal cell carcinoma [ 5 ]

Location

 TSS1500 (cg06968155)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.13E+00 Statistic Test p-value:6.58E-05; Z-score:1.21E+00

Methylation in Case

 6.09E-02 (Median) Methylation in Control 5.38E-02 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC22A5 in clear cell renal cell carcinoma [ 5 ]

Location

 TSS1500 (cg14196790)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.39E+00 Statistic Test p-value:4.34E-03; Z-score:-8.25E-01

Methylation in Case

 7.03E-02 (Median) Methylation in Control 9.74E-02 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC22A5 in clear cell renal cell carcinoma [ 5 ]

Location

 Body (cg16647868)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.13E+00 Statistic Test p-value:1.81E-03; Z-score:6.35E-01

Methylation in Case

 7.79E-02 (Median) Methylation in Control 6.90E-02 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC22A5 in colorectal cancer [ 6 ]

Location

 TSS1500 (cg07538946)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.32E+00 Statistic Test p-value:2.20E-03; Z-score:-1.13E+00

Methylation in Case

 2.63E-02 (Median) Methylation in Control 3.46E-02 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC22A5 in colorectal cancer [ 6 ]

Location

 TSS1500 (cg06968155)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.08E+00 Statistic Test p-value:2.24E-02; Z-score:5.79E-01

Methylation in Case

 1.67E-01 (Median) Methylation in Control 1.55E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC22A5 in colorectal cancer [ 6 ]

Location

 Body (cg23475112)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.02E+00 Statistic Test p-value:4.83E-05; Z-score:-1.49E+00

Methylation in Case

 9.36E-01 (Median) Methylation in Control 9.56E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC22A5 in colorectal cancer [ 6 ]

Location

 Body (cg12558347)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.13E+00 Statistic Test p-value:5.04E-03; Z-score:6.82E-01

Methylation in Case

 6.07E-01 (Median) Methylation in Control 5.39E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Depression

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC22A5 in depression [ 7 ]

Location

 TSS1500 (cg06968155)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.04E+00 Statistic Test p-value:3.40E-02; Z-score:4.55E-01

Methylation in Case

 8.75E-02 (Median) Methylation in Control 8.40E-02 (Median)

Studied Phenotype

 Depression[ ICD-11:6A8Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC22A5 in depression [ 7 ]

Location

 TSS200 (cg24060327)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.06E+00 Statistic Test p-value:4.46E-02; Z-score:3.98E-01

Methylation in Case

 5.77E-02 (Median) Methylation in Control 5.43E-02 (Median)

Studied Phenotype

 Depression[ ICD-11:6A8Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC22A5 in depression [ 7 ]

Location

 Body (cg12558347)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.01E+00 Statistic Test p-value:2.88E-02; Z-score:3.11E-01

Methylation in Case

 7.72E-01 (Median) Methylation in Control 7.64E-01 (Median)

Studied Phenotype

 Depression[ ICD-11:6A8Z]

Experimental Material

 Patient tissue samples

  HIV infection

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC22A5 in HIV infection [ 9 ]

Location

 TSS1500 (cg07538946)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.50E+00 Statistic Test p-value:8.81E-06; Z-score:1.76E+00

Methylation in Case

 3.12E-02 (Median) Methylation in Control 2.08E-02 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC22A5 in HIV infection [ 9 ]

Location

 TSS1500 (cg14196790)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.28E+00 Statistic Test p-value:1.98E-03; Z-score:1.27E+00

Methylation in Case

 1.68E-01 (Median) Methylation in Control 1.31E-01 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC22A5 in HIV infection [ 9 ]

Location

 TSS1500 (cg21948465)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.35E+00 Statistic Test p-value:2.38E-02; Z-score:3.86E-01

Methylation in Case

 2.06E-02 (Median) Methylation in Control 1.53E-02 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC22A5 in HIV infection [ 9 ]

Location

 Body (cg12558347)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.04E+00 Statistic Test p-value:1.04E-08; Z-score:1.34E+00

Methylation in Case

 8.99E-01 (Median) Methylation in Control 8.62E-01 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC22A5 in HIV infection [ 9 ]

Location

 Body (cg16647868)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.10E+00 Statistic Test p-value:3.69E-02; Z-score:6.04E-01

Methylation in Case

 1.36E-01 (Median) Methylation in Control 1.23E-01 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC22A5 in lung adenocarcinoma [ 10 ]

Location

 TSS1500 (cg14196790)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.34E+00 Statistic Test p-value:6.87E-03; Z-score:-1.28E+00

Methylation in Case

 2.03E-01 (Median) Methylation in Control 2.72E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC22A5 in lung adenocarcinoma [ 10 ]

Location

 TSS1500 (cg07538946)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.30E+00 Statistic Test p-value:1.11E-02; Z-score:-1.92E+00

Methylation in Case

 4.30E-02 (Median) Methylation in Control 5.59E-02 (Median)

Studied Phenotype

 Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC22A5 in lung adenocarcinoma [ 10 ]

Location

 Body (cg12558347)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.37E+00 Statistic Test p-value:1.24E-03; Z-score:4.01E+00

Methylation in Case

 5.97E-01 (Median) Methylation in Control 4.37E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC22A5 in lung adenocarcinoma [ 10 ]

Location

 Body (cg19040266)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.16E+00 Statistic Test p-value:2.24E-02; Z-score:1.65E+00

Methylation in Case

 5.92E-01 (Median) Methylation in Control 5.12E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

 Patient tissue samples

  Panic disorder

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC22A5 in panic disorder [ 11 ]

Location

 TSS1500 (cg21948465)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:9.69E-01 Statistic Test p-value:3.55E-02; Z-score:4.52E-01

Methylation in Case

 -4.12E+00 (Median) Methylation in Control -4.25E+00 (Median)

Studied Phenotype

 Panic disorder[ ICD-11:6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC22A5 in panic disorder [ 11 ]

Location

 TSS200 (cg24060327)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:9.94E-01 Statistic Test p-value:4.49E-02; Z-score:1.51E-01

Methylation in Case

 -5.39E+00 (Median) Methylation in Control -5.43E+00 (Median)

Studied Phenotype

 Panic disorder[ ICD-11:6B01]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC22A5 in papillary thyroid cancer [ 12 ]

Location

 TSS1500 (cg07538946)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.09E+00 Statistic Test p-value:3.27E-03; Z-score:-5.31E-01

Methylation in Case

 5.75E-02 (Median) Methylation in Control 6.24E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC22A5 in papillary thyroid cancer [ 12 ]

Location

 Body (cg19040266)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.21E+00 Statistic Test p-value:2.23E-16; Z-score:-3.04E+00

Methylation in Case

 5.87E-01 (Median) Methylation in Control 7.08E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC22A5 in papillary thyroid cancer [ 12 ]

Location

 Body (cg23475112)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.01E+00 Statistic Test p-value:1.82E-05; Z-score:-1.03E+00

Methylation in Case

 9.34E-01 (Median) Methylation in Control 9.44E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC22A5 in papillary thyroid cancer [ 12 ]

Location

 3'UTR (cg12481567)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.01E+00 Statistic Test p-value:2.31E-05; Z-score:-9.23E-01

Methylation in Case

 9.33E-01 (Median) Methylation in Control 9.46E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Prostate cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC22A5 in prostate cancer [ 13 ]

Location

 TSS1500 (cg00748432)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.19E+00 Statistic Test p-value:3.74E-02; Z-score:1.68E+00

Methylation in Case

 8.16E-01 (Median) Methylation in Control 6.88E-01 (Median)

Studied Phenotype

 Prostate cancer[ ICD-11:2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC22A5 in prostate cancer [ 13 ]

Location

 Body (cg20706711)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.16E+00 Statistic Test p-value:1.90E-02; Z-score:2.81E+00

Methylation in Case

 8.60E-01 (Median) Methylation in Control 7.39E-01 (Median)

Studied Phenotype

 Prostate cancer[ ICD-11:2C82]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC22A5 in systemic lupus erythematosus [ 14 ]

Location

 TSS1500 (cg14196790)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.16E+00 Statistic Test p-value:4.85E-02; Z-score:3.08E-01

Methylation in Case

 2.51E-01 (Median) Methylation in Control 2.16E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC22A5 in systemic lupus erythematosus [ 14 ]

Location

 TSS200 (cg21911579)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.05E+00 Statistic Test p-value:1.53E-02; Z-score:1.78E-01

Methylation in Case

 3.72E-02 (Median) Methylation in Control 3.55E-02 (Median)

Studied Phenotype

 Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC22A5 in systemic lupus erythematosus [ 14 ]

Location

 1stExon (cg20453264)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.02E+00 Statistic Test p-value:5.45E-03; Z-score:-8.28E-02

Methylation in Case

 8.06E-02 (Median) Methylation in Control 8.19E-02 (Median)

Studied Phenotype

 Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC22A5 in systemic lupus erythematosus [ 14 ]

Location

 Body (cg12558347)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.01E+00 Statistic Test p-value:4.26E-02; Z-score:-2.85E-01

Methylation in Case

 9.01E-01 (Median) Methylation in Control 9.07E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

 Patient tissue samples

  Atypical teratoid rhabdoid tumor

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC22A5 in atypical teratoid rhabdoid tumor [ 15 ]

Location

 1stExon (cg20453264)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:2.02E+00 Statistic Test p-value:4.70E-17; Z-score:2.80E+00

Methylation in Case

 7.25E-01 (Median) Methylation in Control 3.59E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC22A5 in atypical teratoid rhabdoid tumor [ 15 ]

Location

 Body (cg12558347)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.28E+00 Statistic Test p-value:2.80E-02; Z-score:-8.21E-01

Methylation in Case

 7.53E-02 (Median) Methylation in Control 9.65E-02 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC22A5 in atypical teratoid rhabdoid tumor [ 15 ]

Location

 3'UTR (cg12481567)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.13E+00 Statistic Test p-value:1.49E-11; Z-score:-2.16E+00

Methylation in Case

 7.52E-01 (Median) Methylation in Control 8.51E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  Breast cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC22A5 in breast cancer [ 16 ]

Location

 Body (cg12558347)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.85E+00 Statistic Test p-value:1.92E-11; Z-score:2.72E+00

Methylation in Case

 3.99E-01 (Median) Methylation in Control 2.15E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC22A5 in breast cancer [ 16 ]

Location

 Body (cg23475112)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.13E+00 Statistic Test p-value:5.17E-09; Z-score:-2.39E+00

Methylation in Case

 8.45E-01 (Median) Methylation in Control 9.51E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC22A5 in breast cancer [ 16 ]

Location

 Body (cg18104539)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.03E+00 Statistic Test p-value:5.52E-04; Z-score:-7.61E-01

Methylation in Case

 8.69E-01 (Median) Methylation in Control 8.96E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Asthma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Hypermethylation of SLC22A5 in asthma [ 17 ]

Location

 Promoter

Epigenetic Type

 Methylation Experiment Method Bisulfite pyrosequencing

Studied Phenotype

 Asthma[ ICD-11:CA23]

Experimental Material

 Patient tissue samples

Additional Notes

 Genotype influences DNA methylation levels at the SLC22A5 gene promoter region in LCLs.

  Multilayered rosettes embryonal tumour

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Moderate hypermethylation of SLC22A5 in multilayered rosettes embryonal tumour than that in healthy individual

Studied Phenotype

 Multilayered rosettes embryonal tumour [ICD-11:2A00.1]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value:1.03E-15; Fold-change:0.262467257; Z-score:6.744378667
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

microRNA

  Unclear Phenotype

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 miR-124 directly targets SLC22A5 [ 18 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-124 miRNA Mature ID miR-124-3p

miRNA Sequence

 UAAGGCACGCGGUGAAUGCCAA

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon2

 miR-148b directly targets SLC22A5 [ 19 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-148b miRNA Mature ID miR-148b-3p

miRNA Sequence

 UCAGUGCAUCACAGAACUUUGU

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon3

 miR-9 directly targets SLC22A5 [ 19 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-9 miRNA Mature ID miR-9-5p

miRNA Sequence

 UCUUUGGUUAUCUAGCUGUAUGA

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)
References
1 Different involvement of promoter methylation in the expression of organic cation/carnitine transporter 2 (OCTN2) in cancer cell lines. PLoS One. 2013 Oct 16;8(10):e76474.
2 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
3 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
4 DNA Methylation Dynamics in Urological Tumors.
5 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
6 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
7 DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
8 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
9 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
10 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
11 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
12 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
13 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
14 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
15 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
16 Genome-wide Scan for Methylation Profiles in Breast Cancer
17 Local genotype influences DNA methylation at two asthma-associated regions, 5q31 and 17q21, in a founder effect population. J Med Genet. 2016 Apr;53(4):232-41.
18 The impact of microRNAs on protein output. Nature. 2008 Sep 4;455(7209):64-71.
19 MicroRNA targeting specificity in mammals: determinants beyond seed pairing. Mol Cell. 2007 Jul 6;27(1):91-105.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.