Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0022 Transporter Info | ||||
| Gene Name | SLC15A2 | ||||
| Transporter Name | Peptide transporter 2 | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
Methylation |
|||||
|
Clear cell renal cell carcinoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Hypermethylation of SLC15A2 in ccRCC | [ 1 ] | |||
|
Location |
Promoter | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Bisulfite sequencing | ||
|
Related Molecular Changes | Down regulation ofSLC15A2 | Experiment Method | RT-qPCR,Western blot | ||
|
Studied Phenotype |
Clear cell renal cell carcinoma[ ICD-11:2C90.4] | ||||
|
Experimental Material |
ccRCC cell lines,xenografts,patient tissues | ||||
|
Additional Notes |
PEPT2 is transcriptionally silenced due to DNMT3A/B-mediated promoter methylation, which can be reversed by decitabine, restoring PEPT2 expression and transport activity. | ||||
|
Hemangioblastoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Moderate hypermethylation of SLC15A2 in hemangioblastoma than that in healthy individual | ||||
Studied Phenotype |
Hemangioblastoma [ICD-11:2F7C] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:0.003098996; Fold-change:0.252931346; Z-score:1.033513742 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
| ||||
|
Low grade glioma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Moderate hypomethylation of SLC15A2 in low grade glioma than that in healthy individual | ||||
Studied Phenotype |
Low grade glioma [ICD-11:2A00.0Z] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:2.36E-10; Fold-change:-0.227010643; Z-score:-0.844068519 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
| ||||
|
Lymphoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Significant hypermethylation of SLC15A2 in lymphoma than that in healthy individual | ||||
Studied Phenotype |
Lymphoma [ICD-11:2B30] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:2.66E-17; Fold-change:0.448496109; Z-score:1.583744377 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
| ||||
|
Brain neuroblastoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Significant hypomethylation of SLC15A2 in brain neuroblastoma than that in healthy individual | ||||
Studied Phenotype |
Brain neuroblastoma [ICD-11:2A00.11] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:3.77E-12; Fold-change:-0.469683093; Z-score:-3.730721612 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
| ||||
|
Diffuse midline glioma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Significant hypomethylation of SLC15A2 in diffuse midline glioma than that in healthy individual | ||||
Studied Phenotype |
Diffuse midline glioma [ICD-11:2A00.0Z] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:2.60E-25; Fold-change:-0.389451595; Z-score:-1.4039043 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
| ||||
|
Malignant astrocytoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Significant hypomethylation of SLC15A2 in malignant astrocytoma than that in healthy individual | ||||
Studied Phenotype |
Malignant astrocytoma [ICD-11:2A00.12] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:1.06E-15; Fold-change:-0.310126635; Z-score:-1.152369969 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
| ||||
|
microRNA |
|||||
|
Unclear Phenotype |
11 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
miR-122 directly targets SLC15A2 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
|
miRNA Stemloop ID |
miR-122 | miRNA Mature ID | miR-122-5p | ||
|
miRNA Sequence |
UGGAGUGUGACAAUGGUGUUUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
|
Epigenetic Phenomenon2 |
miR-125a directly targets SLC15A2 | [ 3 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-125a | miRNA Mature ID | miR-125a-3p | ||
|
miRNA Sequence |
ACAGGUGAGGUUCUUGGGAGCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon3 |
miR-378a directly targets SLC15A2 | [ 3 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-378a | miRNA Mature ID | miR-378a-5p | ||
|
miRNA Sequence |
CUCCUGACUCCAGGUCCUGUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon4 |
miR-3934 directly targets SLC15A2 | [ 3 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3934 | miRNA Mature ID | miR-3934-5p | ||
|
miRNA Sequence |
UCAGGUGUGGAAACUGAGGCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon5 |
miR-4421 directly targets SLC15A2 | [ 3 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4421 | miRNA Mature ID | miR-4421 | ||
|
miRNA Sequence |
ACCUGUCUGUGGAAAGGAGCUA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon6 |
miR-5699 directly targets SLC15A2 | [ 3 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-5699 | miRNA Mature ID | miR-5699-3p | ||
|
miRNA Sequence |
UCCUGUCUUUCCUUGUUGGAGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon7 |
miR-640 directly targets SLC15A2 | [ 3 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-640 | miRNA Mature ID | miR-640 | ||
|
miRNA Sequence |
AUGAUCCAGGAACCUGCCUCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon8 |
miR-6787 directly targets SLC15A2 | [ 3 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6787 | miRNA Mature ID | miR-6787-3p | ||
|
miRNA Sequence |
UCUCAGCUGCUGCCCUCUCCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon9 |
miR-6790 directly targets SLC15A2 | [ 3 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6790 | miRNA Mature ID | miR-6790-3p | ||
|
miRNA Sequence |
CGACCUCGGCGACCCCUCACU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon10 |
miR-6821 directly targets SLC15A2 | [ 3 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6821 | miRNA Mature ID | miR-6821-3p | ||
|
miRNA Sequence |
UGACCUCUCCGCUCCGCACAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon11 |
miR-764 directly targets SLC15A2 | [ 3 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-764 | miRNA Mature ID | miR-764 | ||
|
miRNA Sequence |
GCAGGUGCUCACUUGUCCUCCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.