General Information of Drug Transporter (DT)
DT ID DTD0017 Transporter Info
Gene Name ABCC6
Transporter Name Multidrug resistance-associated protein 6
Gene ID
368
UniProt ID
O95255
Epigenetic Regulations of This DT (EGR)

Methylation

  Pancretic ductal adenocarcinoma

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of ABCC6 in pancretic ductal adenocarcinoma [ 1 ]

Location

TSS1500 (cg03233656)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.37E+00 Statistic Test p-value:1.00E-02; Z-score:-1.09E+00

Methylation in Case

2.84E-01 (Median) Methylation in Control 3.88E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of ABCC6 in pancretic ductal adenocarcinoma [ 1 ]

Location

Body (cg19040266)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.61E+00 Statistic Test p-value:1.41E-13; Z-score:-2.53E+00

Methylation in Case

3.77E-01 (Median) Methylation in Control 6.06E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Atypical teratoid rhabdoid tumor

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of ABCC6 in atypical teratoid rhabdoid tumor [ 2 ]

Location

Body (cg01136471)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.15E+00 Statistic Test p-value:4.77E-05; Z-score:-1.23E+00

Methylation in Case

7.43E-01 (Median) Methylation in Control 8.57E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of ABCC6 in atypical teratoid rhabdoid tumor [ 2 ]

Location

Body (cg07965331)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.12E+00 Statistic Test p-value:5.09E-03; Z-score:-6.38E-01

Methylation in Case

7.29E-01 (Median) Methylation in Control 8.16E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of ABCC6 in atypical teratoid rhabdoid tumor [ 2 ]

Location

3'UTR (cg10024478)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.37E+00 Statistic Test p-value:1.51E-12; Z-score:2.00E+00

Methylation in Case

7.77E-01 (Median) Methylation in Control 5.67E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Bladder cancer

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of ABCC6 in bladder cancer [ 3 ]

Location

Body (cg01136471)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.52E+00 Statistic Test p-value:3.74E-11; Z-score:-2.02E+01

Methylation in Case

5.33E-01 (Median) Methylation in Control 8.12E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of ABCC6 in bladder cancer [ 3 ]

Location

Body (cg07965331)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.59E+00 Statistic Test p-value:3.79E-09; Z-score:-1.17E+01

Methylation in Case

4.02E-01 (Median) Methylation in Control 6.41E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of ABCC6 in bladder cancer [ 3 ]

Location

3'UTR (cg10024478)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.53E+00 Statistic Test p-value:6.66E-06; Z-score:-5.52E+00

Methylation in Case

2.80E-01 (Median) Methylation in Control 4.28E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Hypermethylation of ABCC6 in bladder cancer [ 9 ]

Location

Promoter

Epigenetic Type

Methylation Experiment Method Methylation-specific PCR

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Frequency

48 (36%) out of the 132 studied tumor sample

Experimental Material

Patient tissue samples

Additional Notes

ABCC6 is freqyently hypermethylated in bladder cancer (p<0.05).

  Breast cancer

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of ABCC6 in breast cancer [ 4 ]

Location

Body (cg07965331)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:1.10E-06; Z-score:-1.18E+00

Methylation in Case

5.33E-01 (Median) Methylation in Control 5.84E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of ABCC6 in breast cancer [ 4 ]

Location

3'UTR (cg10024478)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:2.65E-02; Z-score:-3.65E-01

Methylation in Case

4.60E-01 (Median) Methylation in Control 4.77E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Colorectal cancer

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of ABCC6 in colorectal cancer [ 5 ]

Location

Body (cg01136471)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:5.46E-05; Z-score:-1.22E+00

Methylation in Case

8.94E-01 (Median) Methylation in Control 9.10E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of ABCC6 in colorectal cancer [ 5 ]

Location

Body (cg07965331)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.12E-02; Z-score:-3.38E-01

Methylation in Case

8.34E-01 (Median) Methylation in Control 8.45E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Hepatocellular carcinoma

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of ABCC6 in hepatocellular carcinoma [ 6 ]

Location

Body (cg07965331)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.06E+00 Statistic Test p-value:1.50E-05; Z-score:7.81E-01

Methylation in Case

6.77E-01 (Median) Methylation in Control 6.36E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of ABCC6 in hepatocellular carcinoma [ 6 ]

Location

Body (cg01136471)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.16E+00 Statistic Test p-value:7.02E-05; Z-score:1.30E+00

Methylation in Case

7.44E-01 (Median) Methylation in Control 6.40E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of ABCC6 in hepatocellular carcinoma [ 6 ]

Location

3'UTR (cg10024478)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:4.31E-02; Z-score:-5.39E-01

Methylation in Case

3.87E-01 (Median) Methylation in Control 4.24E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  HIV infection

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of ABCC6 in HIV infection [ 7 ]

Location

Body (cg01136471)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.03E+00 Statistic Test p-value:2.69E-07; Z-score:9.02E-01

Methylation in Case

8.54E-01 (Median) Methylation in Control 8.31E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of ABCC6 in HIV infection [ 7 ]

Location

Body (cg07965331)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:8.86E-05; Z-score:-1.50E+00

Methylation in Case

7.57E-01 (Median) Methylation in Control 8.09E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of ABCC6 in papillary thyroid cancer [ 8 ]

Location

3'UTR (cg10024478)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.09E+00 Statistic Test p-value:4.22E-02; Z-score:7.49E-01

Methylation in Case

6.34E-01 (Median) Methylation in Control 5.79E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Renal pelvic tumors

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Hypermethylation of ABCC6 in renal pelvic tumors [ 10 ]

Location

Promoter

Epigenetic Type

Methylation Experiment Method Methylation-specific PCR

Studied Phenotype

Renal pelvic tumors[ ICD-11:2C91.Z]

Experimental Material

Patient tissue samples

Additional Notes

Methylation was present significantly more frequently in renal pelvic tumors, particularly with a higher rate of methylated ABCC6 (p <?0.05).

  Lymphoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of ABCC6 in lymphoma than that in healthy individual

Studied Phenotype

Lymphoma [ICD-11:2B30]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:7.71E-06; Fold-change:-0.218160073; Z-score:-1.475285522
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Multilayered rosettes embryonal tumour

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of ABCC6 in multilayered rosettes embryonal tumour than that in healthy individual

Studied Phenotype

Multilayered rosettes embryonal tumour [ICD-11:2A00.1]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:2.50E-08; Fold-change:-0.200845615; Z-score:-1.912904636
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Prostate cancer metastasis

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of ABCC6 in prostate cancer metastasis than that in healthy individual

Studied Phenotype

Prostate cancer metastasis [ICD-11:2.00E+06]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:0.006796751; Fold-change:-0.320508093; Z-score:-17.68550282
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

microRNA

  Unclear Phenotype

         52 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-1275 directly targets ABCC6 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1275 miRNA Mature ID miR-1275

miRNA Sequence

GUGGGGGAGAGGCUGUC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon2

miR-15a directly targets ABCC6 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-15a miRNA Mature ID miR-15a-5p

miRNA Sequence

UAGCAGCACAUAAUGGUUUGUG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon3

miR-15b directly targets ABCC6 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-15b miRNA Mature ID miR-15b-5p

miRNA Sequence

UAGCAGCACAUCAUGGUUUACA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon4

miR-16 directly targets ABCC6 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-16 miRNA Mature ID miR-16-5p

miRNA Sequence

UAGCAGCACGUAAAUAUUGGCG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon5

miR-195 directly targets ABCC6 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-195 miRNA Mature ID miR-195-5p

miRNA Sequence

UAGCAGCACAGAAAUAUUGGC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon6

miR-214 directly targets ABCC6 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-214 miRNA Mature ID miR-214-3p

miRNA Sequence

ACAGCAGGCACAGACAGGCAGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon7

miR-3191 directly targets ABCC6 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3191 miRNA Mature ID miR-3191-5p

miRNA Sequence

CUCUCUGGCCGUCUACCUUCCA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon8

miR-326 directly targets ABCC6 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-326 miRNA Mature ID miR-326

miRNA Sequence

CCUCUGGGCCCUUCCUCCAG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon9

miR-329 directly targets ABCC6 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-329 miRNA Mature ID miR-329-3p

miRNA Sequence

AACACACCUGGUUAACCUCUUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon10

miR-330 directly targets ABCC6 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-330 miRNA Mature ID miR-330-5p

miRNA Sequence

UCUCUGGGCCUGUGUCUUAGGC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon11

miR-3619 directly targets ABCC6 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3619 miRNA Mature ID miR-3619-5p

miRNA Sequence

UCAGCAGGCAGGCUGGUGCAGC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon12

miR-362 directly targets ABCC6 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-362 miRNA Mature ID miR-362-3p

miRNA Sequence

AACACACCUAUUCAAGGAUUCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon13

miR-3941 directly targets ABCC6 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3941 miRNA Mature ID miR-3941

miRNA Sequence

UUACACACAACUGAGGAUCAUA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon14

miR-424 directly targets ABCC6 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-424 miRNA Mature ID miR-424-5p

miRNA Sequence

CAGCAGCAAUUCAUGUUUUGAA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon15

miR-4299 directly targets ABCC6 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4299 miRNA Mature ID miR-4299

miRNA Sequence

GCUGGUGACAUGAGAGGC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon16

miR-4434 directly targets ABCC6 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4434 miRNA Mature ID miR-4434

miRNA Sequence

AGGAGAAGUAAAGUAGAA

miRNA Target Type

Direct

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon17

miR-4447 directly targets ABCC6 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4447 miRNA Mature ID miR-4447

miRNA Sequence

GGUGGGGGCUGUUGUUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon18

miR-4456 directly targets ABCC6 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4456 miRNA Mature ID miR-4456

miRNA Sequence

CCUGGUGGCUUCCUUUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon19

miR-4472 directly targets ABCC6 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4472 miRNA Mature ID miR-4472

miRNA Sequence

GGUGGGGGGUGUUGUUUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon20

miR-4516 directly targets ABCC6 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4516 miRNA Mature ID miR-4516

miRNA Sequence

GGGAGAAGGGUCGGGGC

miRNA Target Type

Direct

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon21

miR-4525 directly targets ABCC6 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4525 miRNA Mature ID miR-4525

miRNA Sequence

GGGGGGAUGUGCAUGCUGGUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon22

miR-4531 directly targets ABCC6 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4531 miRNA Mature ID miR-4531

miRNA Sequence

AUGGAGAAGGCUUCUGA

miRNA Target Type

Direct

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon23

miR-4665 directly targets ABCC6 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4665 miRNA Mature ID miR-4665-5p

miRNA Sequence

CUGGGGGACGCGUGAGCGCGAGC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon24

miR-4723 directly targets ABCC6 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4723 miRNA Mature ID miR-4723-5p

miRNA Sequence

UGGGGGAGCCAUGAGAUAAGAGCA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon25

miR-4739 directly targets ABCC6 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4739 miRNA Mature ID miR-4739

miRNA Sequence

AAGGGAGGAGGAGCGGAGGGGCCCU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon26

miR-4773 directly targets ABCC6 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4773 miRNA Mature ID miR-4773

miRNA Sequence

CAGAACAGGAGCAUAGAAAGGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon27

miR-497 directly targets ABCC6 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-497 miRNA Mature ID miR-497-5p

miRNA Sequence

CAGCAGCACACUGUGGUUUGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon28

miR-5010 directly targets ABCC6 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-5010 miRNA Mature ID miR-5010-5p

miRNA Sequence

AGGGGGAUGGCAGAGCAAAAUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon29

miR-518c directly targets ABCC6 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-518c miRNA Mature ID miR-518c-5p

miRNA Sequence

UCUCUGGAGGGAAGCACUUUCUG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon30

miR-541 directly targets ABCC6 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-541 miRNA Mature ID miR-541-3p

miRNA Sequence

UGGUGGGCACAGAAUCUGGACU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon31

miR-548q directly targets ABCC6 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-548q miRNA Mature ID miR-548q

miRNA Sequence

GCUGGUGCAAAAGUAAUGGCGG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon32

miR-5698 directly targets ABCC6 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-5698 miRNA Mature ID miR-5698

miRNA Sequence

UGGGGGAGUGCAGUGAUUGUGG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon33

miR-5703 directly targets ABCC6 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-5703 miRNA Mature ID miR-5703

miRNA Sequence

AGGAGAAGUCGGGAAGGU

miRNA Target Type

Direct

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon34

miR-603 directly targets ABCC6 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-603 miRNA Mature ID miR-603

miRNA Sequence

CACACACUGCAAUUACUUUUGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon35

miR-6081 directly targets ABCC6 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6081 miRNA Mature ID miR-6081

miRNA Sequence

AGGAGCAGUGCCGGCCAAGGCGCC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon36

miR-6165 directly targets ABCC6 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6165 miRNA Mature ID miR-6165

miRNA Sequence

CAGCAGGAGGUGAGGGGAG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon37

miR-625 directly targets ABCC6 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-625 miRNA Mature ID miR-625-5p

miRNA Sequence

AGGGGGAAAGUUCUAUAGUCC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon38

miR-654 directly targets ABCC6 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-654 miRNA Mature ID miR-654-5p

miRNA Sequence

UGGUGGGCCGCAGAACAUGUGC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon39

miR-6764 directly targets ABCC6 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6764 miRNA Mature ID miR-6764-3p

miRNA Sequence

UCUCUGGUCUUUCCUUGACAG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon40

miR-6769a directly targets ABCC6 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6769a miRNA Mature ID miR-6769a-5p

miRNA Sequence

AGGUGGGUAUGGAGGAGCCCU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon41

miR-6769b directly targets ABCC6 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6769b miRNA Mature ID miR-6769b-5p

miRNA Sequence

UGGUGGGUGGGGAGGAGAAGUGC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon42

miR-6824 directly targets ABCC6 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6824 miRNA Mature ID miR-6824-3p

miRNA Sequence

UCUCUGGUCUUGCCACCCCAG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon43

miR-6825 directly targets ABCC6 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6825 miRNA Mature ID miR-6825-5p

miRNA Sequence

UGGGGAGGUGUGGAGUCAGCAU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon44

miR-6838 directly targets ABCC6 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6838 miRNA Mature ID miR-6838-5p

miRNA Sequence

AAGCAGCAGUGGCAAGACUCCU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon45

miR-6870 directly targets ABCC6 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6870 miRNA Mature ID miR-6870-5p

miRNA Sequence

UGGGGGAGAUGGGGGUUGA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon46

miR-7106 directly targets ABCC6 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-7106 miRNA Mature ID miR-7106-5p

miRNA Sequence

UGGGAGGAGGGGAUCUUGGG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon47

miR-7111 directly targets ABCC6 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-7111 miRNA Mature ID miR-7111-5p

miRNA Sequence

UGGGGGAGGAAGGACAGGCCAU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon48

miR-761 directly targets ABCC6 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-761 miRNA Mature ID miR-761

miRNA Sequence

GCAGCAGGGUGAAACUGACACA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon49

miR-765 directly targets ABCC6 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-765 miRNA Mature ID miR-765

miRNA Sequence

UGGAGGAGAAGGAAGGUGAUG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon50

miR-7978 directly targets ABCC6 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-7978 miRNA Mature ID miR-7978

miRNA Sequence

UCUGGUGUAUAGCGUUGCUCA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon51

miR-8485 directly targets ABCC6 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-8485 miRNA Mature ID miR-8485

miRNA Sequence

CACACACACACACACACGUAU

miRNA Target Type

Direct

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon52

miR-92a-2 directly targets ABCC6 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-92a-2 miRNA Mature ID miR-92a-2-5p

miRNA Sequence

GGGUGGGGAUUUGUUGCAUUAC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)
References
1 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
2 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
3 DNA Methylation Dynamics in Urological Tumors.
4 Genome-wide Scan for Methylation Profiles in Breast Cancer
5 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
7 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
8 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
9 A novel set of DNA methylation markers in urine sediments for sensitive/specific detection of bladder cancer. Clin Cancer Res. 2007 Dec 15;13(24):7296-304.
10 Comparison of clinicopathologic characteristics, epigenetic biomarkers and prognosis between renal pelvic and ureteral tumors in upper tract urothelial carcinoma. BMC Urol. 2018 Mar 27;18(1):22.
11 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
12 Direct conversion of fibroblasts to neurons by reprogramming PTB-regulated microRNA circuits. Cell. 2013 Jan 17;152(1-2):82-96.
13 Argonaute CLIP Defines a Deregulated miR-122-Bound Transcriptome that Correlates with Patient Survival in Human Liver Cancer. Mol Cell. 2017 Aug 3;67(3):400-410.e7.
14 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.