Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0017 Transporter Info | ||||
| Gene Name | ABCC6 | ||||
| Transporter Name | Multidrug resistance-associated protein 6 | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
Methylation |
|||||
|
Pancretic ductal adenocarcinoma |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of ABCC6 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
TSS1500 (cg03233656) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.37E+00 | Statistic Test | p-value:1.00E-02; Z-score:-1.09E+00 | ||
|
Methylation in Case |
2.84E-01 (Median) | Methylation in Control | 3.88E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of ABCC6 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg19040266) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.61E+00 | Statistic Test | p-value:1.41E-13; Z-score:-2.53E+00 | ||
|
Methylation in Case |
3.77E-01 (Median) | Methylation in Control | 6.06E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Atypical teratoid rhabdoid tumor |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of ABCC6 in atypical teratoid rhabdoid tumor | [ 2 ] | |||
|
Location |
Body (cg01136471) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.15E+00 | Statistic Test | p-value:4.77E-05; Z-score:-1.23E+00 | ||
|
Methylation in Case |
7.43E-01 (Median) | Methylation in Control | 8.57E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of ABCC6 in atypical teratoid rhabdoid tumor | [ 2 ] | |||
|
Location |
Body (cg07965331) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.12E+00 | Statistic Test | p-value:5.09E-03; Z-score:-6.38E-01 | ||
|
Methylation in Case |
7.29E-01 (Median) | Methylation in Control | 8.16E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of ABCC6 in atypical teratoid rhabdoid tumor | [ 2 ] | |||
|
Location |
3'UTR (cg10024478) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.37E+00 | Statistic Test | p-value:1.51E-12; Z-score:2.00E+00 | ||
|
Methylation in Case |
7.77E-01 (Median) | Methylation in Control | 5.67E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Bladder cancer |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of ABCC6 in bladder cancer | [ 3 ] | |||
|
Location |
Body (cg01136471) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.52E+00 | Statistic Test | p-value:3.74E-11; Z-score:-2.02E+01 | ||
|
Methylation in Case |
5.33E-01 (Median) | Methylation in Control | 8.12E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of ABCC6 in bladder cancer | [ 3 ] | |||
|
Location |
Body (cg07965331) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.59E+00 | Statistic Test | p-value:3.79E-09; Z-score:-1.17E+01 | ||
|
Methylation in Case |
4.02E-01 (Median) | Methylation in Control | 6.41E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of ABCC6 in bladder cancer | [ 3 ] | |||
|
Location |
3'UTR (cg10024478) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.53E+00 | Statistic Test | p-value:6.66E-06; Z-score:-5.52E+00 | ||
|
Methylation in Case |
2.80E-01 (Median) | Methylation in Control | 4.28E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Hypermethylation of ABCC6 in bladder cancer | [ 9 ] | |||
|
Location |
Promoter | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Methylation-specific PCR | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Frequency |
48 (36%) out of the 132 studied tumor sample | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Additional Notes |
ABCC6 is freqyently hypermethylated in bladder cancer (p<0.05). | ||||
|
Breast cancer |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of ABCC6 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg07965331) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:1.10E-06; Z-score:-1.18E+00 | ||
|
Methylation in Case |
5.33E-01 (Median) | Methylation in Control | 5.84E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of ABCC6 in breast cancer | [ 4 ] | |||
|
Location |
3'UTR (cg10024478) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:2.65E-02; Z-score:-3.65E-01 | ||
|
Methylation in Case |
4.60E-01 (Median) | Methylation in Control | 4.77E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colorectal cancer |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of ABCC6 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg01136471) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:5.46E-05; Z-score:-1.22E+00 | ||
|
Methylation in Case |
8.94E-01 (Median) | Methylation in Control | 9.10E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of ABCC6 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg07965331) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.12E-02; Z-score:-3.38E-01 | ||
|
Methylation in Case |
8.34E-01 (Median) | Methylation in Control | 8.45E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Hepatocellular carcinoma |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of ABCC6 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg07965331) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.06E+00 | Statistic Test | p-value:1.50E-05; Z-score:7.81E-01 | ||
|
Methylation in Case |
6.77E-01 (Median) | Methylation in Control | 6.36E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of ABCC6 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg01136471) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.16E+00 | Statistic Test | p-value:7.02E-05; Z-score:1.30E+00 | ||
|
Methylation in Case |
7.44E-01 (Median) | Methylation in Control | 6.40E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of ABCC6 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
3'UTR (cg10024478) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.09E+00 | Statistic Test | p-value:4.31E-02; Z-score:-5.39E-01 | ||
|
Methylation in Case |
3.87E-01 (Median) | Methylation in Control | 4.24E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
HIV infection |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of ABCC6 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg01136471) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:2.69E-07; Z-score:9.02E-01 | ||
|
Methylation in Case |
8.54E-01 (Median) | Methylation in Control | 8.31E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of ABCC6 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg07965331) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.07E+00 | Statistic Test | p-value:8.86E-05; Z-score:-1.50E+00 | ||
|
Methylation in Case |
7.57E-01 (Median) | Methylation in Control | 8.09E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Papillary thyroid cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of ABCC6 in papillary thyroid cancer | [ 8 ] | |||
|
Location |
3'UTR (cg10024478) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.09E+00 | Statistic Test | p-value:4.22E-02; Z-score:7.49E-01 | ||
|
Methylation in Case |
6.34E-01 (Median) | Methylation in Control | 5.79E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Renal pelvic tumors |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Hypermethylation of ABCC6 in renal pelvic tumors | [ 10 ] | |||
|
Location |
Promoter | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Methylation-specific PCR | ||
|
Studied Phenotype |
Renal pelvic tumors[ ICD-11:2C91.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Additional Notes |
Methylation was present significantly more frequently in renal pelvic tumors, particularly with a higher rate of methylated ABCC6 (p <?0.05). | ||||
|
Lymphoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Moderate hypomethylation of ABCC6 in lymphoma than that in healthy individual | ||||
Studied Phenotype |
Lymphoma [ICD-11:2B30] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:7.71E-06; Fold-change:-0.218160073; Z-score:-1.475285522 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
| ||||
|
Multilayered rosettes embryonal tumour |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Moderate hypomethylation of ABCC6 in multilayered rosettes embryonal tumour than that in healthy individual | ||||
Studied Phenotype |
Multilayered rosettes embryonal tumour [ICD-11:2A00.1] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:2.50E-08; Fold-change:-0.200845615; Z-score:-1.912904636 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
| ||||
|
Prostate cancer metastasis |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Significant hypomethylation of ABCC6 in prostate cancer metastasis than that in healthy individual | ||||
Studied Phenotype |
Prostate cancer metastasis [ICD-11:2.00E+06] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:0.006796751; Fold-change:-0.320508093; Z-score:-17.68550282 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
| ||||
|
microRNA |
|||||
|
Unclear Phenotype |
52 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
miR-1275 directly targets ABCC6 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1275 | miRNA Mature ID | miR-1275 | ||
|
miRNA Sequence |
GUGGGGGAGAGGCUGUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon2 |
miR-15a directly targets ABCC6 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-15a | miRNA Mature ID | miR-15a-5p | ||
|
miRNA Sequence |
UAGCAGCACAUAAUGGUUUGUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon3 |
miR-15b directly targets ABCC6 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-15b | miRNA Mature ID | miR-15b-5p | ||
|
miRNA Sequence |
UAGCAGCACAUCAUGGUUUACA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon4 |
miR-16 directly targets ABCC6 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-16 | miRNA Mature ID | miR-16-5p | ||
|
miRNA Sequence |
UAGCAGCACGUAAAUAUUGGCG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon5 |
miR-195 directly targets ABCC6 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-195 | miRNA Mature ID | miR-195-5p | ||
|
miRNA Sequence |
UAGCAGCACAGAAAUAUUGGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon6 |
miR-214 directly targets ABCC6 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-214 | miRNA Mature ID | miR-214-3p | ||
|
miRNA Sequence |
ACAGCAGGCACAGACAGGCAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon7 |
miR-3191 directly targets ABCC6 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3191 | miRNA Mature ID | miR-3191-5p | ||
|
miRNA Sequence |
CUCUCUGGCCGUCUACCUUCCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon8 |
miR-326 directly targets ABCC6 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-326 | miRNA Mature ID | miR-326 | ||
|
miRNA Sequence |
CCUCUGGGCCCUUCCUCCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon9 |
miR-329 directly targets ABCC6 | [ 12 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-329 | miRNA Mature ID | miR-329-3p | ||
|
miRNA Sequence |
AACACACCUGGUUAACCUCUUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon10 |
miR-330 directly targets ABCC6 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-330 | miRNA Mature ID | miR-330-5p | ||
|
miRNA Sequence |
UCUCUGGGCCUGUGUCUUAGGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon11 |
miR-3619 directly targets ABCC6 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3619 | miRNA Mature ID | miR-3619-5p | ||
|
miRNA Sequence |
UCAGCAGGCAGGCUGGUGCAGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon12 |
miR-362 directly targets ABCC6 | [ 12 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-362 | miRNA Mature ID | miR-362-3p | ||
|
miRNA Sequence |
AACACACCUAUUCAAGGAUUCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon13 |
miR-3941 directly targets ABCC6 | [ 12 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3941 | miRNA Mature ID | miR-3941 | ||
|
miRNA Sequence |
UUACACACAACUGAGGAUCAUA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon14 |
miR-424 directly targets ABCC6 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-424 | miRNA Mature ID | miR-424-5p | ||
|
miRNA Sequence |
CAGCAGCAAUUCAUGUUUUGAA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon15 |
miR-4299 directly targets ABCC6 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4299 | miRNA Mature ID | miR-4299 | ||
|
miRNA Sequence |
GCUGGUGACAUGAGAGGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon16 |
miR-4434 directly targets ABCC6 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4434 | miRNA Mature ID | miR-4434 | ||
|
miRNA Sequence |
AGGAGAAGUAAAGUAGAA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
miR-4447 directly targets ABCC6 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4447 | miRNA Mature ID | miR-4447 | ||
|
miRNA Sequence |
GGUGGGGGCUGUUGUUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon18 |
miR-4456 directly targets ABCC6 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4456 | miRNA Mature ID | miR-4456 | ||
|
miRNA Sequence |
CCUGGUGGCUUCCUUUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon19 |
miR-4472 directly targets ABCC6 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4472 | miRNA Mature ID | miR-4472 | ||
|
miRNA Sequence |
GGUGGGGGGUGUUGUUUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon20 |
miR-4516 directly targets ABCC6 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4516 | miRNA Mature ID | miR-4516 | ||
|
miRNA Sequence |
GGGAGAAGGGUCGGGGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon21 |
miR-4525 directly targets ABCC6 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4525 | miRNA Mature ID | miR-4525 | ||
|
miRNA Sequence |
GGGGGGAUGUGCAUGCUGGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon22 |
miR-4531 directly targets ABCC6 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4531 | miRNA Mature ID | miR-4531 | ||
|
miRNA Sequence |
AUGGAGAAGGCUUCUGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon23 |
miR-4665 directly targets ABCC6 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4665 | miRNA Mature ID | miR-4665-5p | ||
|
miRNA Sequence |
CUGGGGGACGCGUGAGCGCGAGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon24 |
miR-4723 directly targets ABCC6 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4723 | miRNA Mature ID | miR-4723-5p | ||
|
miRNA Sequence |
UGGGGGAGCCAUGAGAUAAGAGCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon25 |
miR-4739 directly targets ABCC6 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4739 | miRNA Mature ID | miR-4739 | ||
|
miRNA Sequence |
AAGGGAGGAGGAGCGGAGGGGCCCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon26 |
miR-4773 directly targets ABCC6 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4773 | miRNA Mature ID | miR-4773 | ||
|
miRNA Sequence |
CAGAACAGGAGCAUAGAAAGGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon27 |
miR-497 directly targets ABCC6 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-497 | miRNA Mature ID | miR-497-5p | ||
|
miRNA Sequence |
CAGCAGCACACUGUGGUUUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon28 |
miR-5010 directly targets ABCC6 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-5010 | miRNA Mature ID | miR-5010-5p | ||
|
miRNA Sequence |
AGGGGGAUGGCAGAGCAAAAUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon29 |
miR-518c directly targets ABCC6 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-518c | miRNA Mature ID | miR-518c-5p | ||
|
miRNA Sequence |
UCUCUGGAGGGAAGCACUUUCUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon30 |
miR-541 directly targets ABCC6 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-541 | miRNA Mature ID | miR-541-3p | ||
|
miRNA Sequence |
UGGUGGGCACAGAAUCUGGACU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon31 |
miR-548q directly targets ABCC6 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-548q | miRNA Mature ID | miR-548q | ||
|
miRNA Sequence |
GCUGGUGCAAAAGUAAUGGCGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon32 |
miR-5698 directly targets ABCC6 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-5698 | miRNA Mature ID | miR-5698 | ||
|
miRNA Sequence |
UGGGGGAGUGCAGUGAUUGUGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon33 |
miR-5703 directly targets ABCC6 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-5703 | miRNA Mature ID | miR-5703 | ||
|
miRNA Sequence |
AGGAGAAGUCGGGAAGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon34 |
miR-603 directly targets ABCC6 | [ 12 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-603 | miRNA Mature ID | miR-603 | ||
|
miRNA Sequence |
CACACACUGCAAUUACUUUUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon35 |
miR-6081 directly targets ABCC6 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6081 | miRNA Mature ID | miR-6081 | ||
|
miRNA Sequence |
AGGAGCAGUGCCGGCCAAGGCGCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon36 |
miR-6165 directly targets ABCC6 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6165 | miRNA Mature ID | miR-6165 | ||
|
miRNA Sequence |
CAGCAGGAGGUGAGGGGAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon37 |
miR-625 directly targets ABCC6 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-625 | miRNA Mature ID | miR-625-5p | ||
|
miRNA Sequence |
AGGGGGAAAGUUCUAUAGUCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon38 |
miR-654 directly targets ABCC6 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-654 | miRNA Mature ID | miR-654-5p | ||
|
miRNA Sequence |
UGGUGGGCCGCAGAACAUGUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon39 |
miR-6764 directly targets ABCC6 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6764 | miRNA Mature ID | miR-6764-3p | ||
|
miRNA Sequence |
UCUCUGGUCUUUCCUUGACAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon40 |
miR-6769a directly targets ABCC6 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6769a | miRNA Mature ID | miR-6769a-5p | ||
|
miRNA Sequence |
AGGUGGGUAUGGAGGAGCCCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon41 |
miR-6769b directly targets ABCC6 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6769b | miRNA Mature ID | miR-6769b-5p | ||
|
miRNA Sequence |
UGGUGGGUGGGGAGGAGAAGUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon42 |
miR-6824 directly targets ABCC6 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6824 | miRNA Mature ID | miR-6824-3p | ||
|
miRNA Sequence |
UCUCUGGUCUUGCCACCCCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon43 |
miR-6825 directly targets ABCC6 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6825 | miRNA Mature ID | miR-6825-5p | ||
|
miRNA Sequence |
UGGGGAGGUGUGGAGUCAGCAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon44 |
miR-6838 directly targets ABCC6 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6838 | miRNA Mature ID | miR-6838-5p | ||
|
miRNA Sequence |
AAGCAGCAGUGGCAAGACUCCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon45 |
miR-6870 directly targets ABCC6 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6870 | miRNA Mature ID | miR-6870-5p | ||
|
miRNA Sequence |
UGGGGGAGAUGGGGGUUGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon46 |
miR-7106 directly targets ABCC6 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-7106 | miRNA Mature ID | miR-7106-5p | ||
|
miRNA Sequence |
UGGGAGGAGGGGAUCUUGGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon47 |
miR-7111 directly targets ABCC6 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-7111 | miRNA Mature ID | miR-7111-5p | ||
|
miRNA Sequence |
UGGGGGAGGAAGGACAGGCCAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon48 |
miR-761 directly targets ABCC6 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-761 | miRNA Mature ID | miR-761 | ||
|
miRNA Sequence |
GCAGCAGGGUGAAACUGACACA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon49 |
miR-765 directly targets ABCC6 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-765 | miRNA Mature ID | miR-765 | ||
|
miRNA Sequence |
UGGAGGAGAAGGAAGGUGAUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon50 |
miR-7978 directly targets ABCC6 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-7978 | miRNA Mature ID | miR-7978 | ||
|
miRNA Sequence |
UCUGGUGUAUAGCGUUGCUCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon51 |
miR-8485 directly targets ABCC6 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-8485 | miRNA Mature ID | miR-8485 | ||
|
miRNA Sequence |
CACACACACACACACACGUAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon52 |
miR-92a-2 directly targets ABCC6 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-92a-2 | miRNA Mature ID | miR-92a-2-5p | ||
|
miRNA Sequence |
GGGUGGGGAUUUGUUGCAUUAC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples