Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0014 Transporter Info
Gene Name	ABCB11
Transporter Name	Bile salt export pump
Gene ID	8647
UniProt ID	O95342

Epigenetic Regulations of This DT (EGR)
Methylation
Atypical teratoid rhabdoid tumor	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of ABCB11 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg20118424)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.31E+00	Statistic Test	p-value:3.94E-06; Z-score:-1.18E+00
Methylation in Case	6.35E-01 (Median)	Methylation in Control	8.30E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of ABCB11 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	3'UTR (cg08997639)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.55E+00	Statistic Test	p-value:7.61E-13; Z-score:2.08E+00
Methylation in Case	6.38E-01 (Median)	Methylation in Control	4.12E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of ABCB11 in hepatocellular carcinoma			[ 2 ]
Location	5'UTR (cg20118424)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.23E+00	Statistic Test	p-value:1.15E-02; Z-score:-1.10E+00
Methylation in Case	5.05E-01 (Median)	Methylation in Control	6.23E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of ABCB11 in hepatocellular carcinoma			[ 2 ]
Location	TSS1500 (cg21346679)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.26E+00	Statistic Test	p-value:5.16E-06; Z-score:-1.78E+00
Methylation in Case	4.50E-01 (Median)	Methylation in Control	5.68E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of ABCB11 in hepatocellular carcinoma			[ 2 ]
Location	TSS200 (cg00295325)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.45E+00	Statistic Test	p-value:2.27E-05; Z-score:-1.71E+00
Methylation in Case	2.98E-01 (Median)	Methylation in Control	4.32E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of ABCB11 in hepatocellular carcinoma			[ 2 ]
Location	Body (cg24334048)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:4.08E-02; Z-score:-3.21E-01
Methylation in Case	8.08E-01 (Median)	Methylation in Control	8.28E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Bladder cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of ABCB11 in bladder cancer			[ 3 ]
Location	TSS1500 (cg21346679)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.10E+00	Statistic Test	p-value:4.64E-04; Z-score:-2.82E+00
Methylation in Case	7.37E-01 (Median)	Methylation in Control	8.13E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of ABCB11 in bladder cancer			[ 3 ]
Location	TSS200 (cg00295325)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.13E+00	Statistic Test	p-value:6.50E-04; Z-score:3.89E+00
Methylation in Case	7.08E-01 (Median)	Methylation in Control	6.26E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of ABCB11 in bladder cancer			[ 3 ]
Location	Body (cg24334048)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.65E+00	Statistic Test	p-value:1.41E-08; Z-score:-1.19E+01
Methylation in Case	4.59E-01 (Median)	Methylation in Control	7.59E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of ABCB11 in bladder cancer			[ 3 ]
Location	3'UTR (cg08997639)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.00E+00	Statistic Test	p-value:4.22E-02; Z-score:-9.56E-02
Methylation in Case	8.88E-01 (Median)	Methylation in Control	8.90E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Breast cancer	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of ABCB11 in breast cancer			[ 4 ]
Location	TSS1500 (cg21346679)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.05E+00	Statistic Test	p-value:7.95E-03; Z-score:3.70E-01
Methylation in Case	6.47E-01 (Median)	Methylation in Control	6.14E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of ABCB11 in breast cancer			[ 4 ]
Location	TSS200 (cg00295325)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.19E+00	Statistic Test	p-value:8.05E-11; Z-score:1.61E+00
Methylation in Case	6.01E-01 (Median)	Methylation in Control	5.07E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Colorectal cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of ABCB11 in colorectal cancer			[ 5 ]
Location	TSS1500 (cg21346679)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:6.19E-05; Z-score:-1.12E+00
Methylation in Case	8.36E-01 (Median)	Methylation in Control	8.73E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of ABCB11 in colorectal cancer			[ 5 ]
Location	TSS200 (cg00295325)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:1.05E-02; Z-score:-3.98E-01
Methylation in Case	8.20E-01 (Median)	Methylation in Control	8.35E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of ABCB11 in colorectal cancer			[ 5 ]
Location	Body (cg24334048)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:5.26E-05; Z-score:-1.37E+00
Methylation in Case	8.93E-01 (Median)	Methylation in Control	9.21E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Depression	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of ABCB11 in depression			[ 6 ]
Location	TSS1500 (cg21346679)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:3.32E-02; Z-score:-3.84E-01
Methylation in Case	7.84E-01 (Median)	Methylation in Control	7.98E-01 (Median)
Studied Phenotype	Depression[ ICD-11:6A8Z]
Experimental Material	Patient tissue samples
HIV infection	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of ABCB11 in HIV infection			[ 7 ]
Location	TSS1500 (cg21346679)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.06E+00	Statistic Test	p-value:1.05E-02; Z-score:-1.15E+00
Methylation in Case	8.60E-01 (Median)	Methylation in Control	9.09E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of ABCB11 in HIV infection			[ 7 ]
Location	Body (cg24334048)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:3.06E-02; Z-score:-4.50E-01
Methylation in Case	8.61E-01 (Median)	Methylation in Control	8.83E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Panic disorder	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of ABCB11 in panic disorder			[ 8 ]
Location	TSS1500 (cg21346679)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.59E+00	Statistic Test	p-value:1.88E-02; Z-score:4.76E-01
Methylation in Case	5.24E-01 (Median)	Methylation in Control	3.29E-01 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of ABCB11 in panic disorder			[ 8 ]
Location	3'UTR (cg08997639)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.07E+00	Statistic Test	p-value:1.16E-02; Z-score:6.15E-01
Methylation in Case	2.96E+00 (Median)	Methylation in Control	2.76E+00 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of ABCB11 in papillary thyroid cancer			[ 9 ]
Location	TSS1500 (cg21346679)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:3.55E-02; Z-score:-1.96E-01
Methylation in Case	7.91E-01 (Median)	Methylation in Control	8.02E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of ABCB11 in papillary thyroid cancer			[ 9 ]
Location	TSS200 (cg00295325)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.05E+00	Statistic Test	p-value:4.17E-03; Z-score:9.36E-01
Methylation in Case	7.76E-01 (Median)	Methylation in Control	7.37E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Prostate cancer	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of ABCB11 in prostate cancer			[ 10 ]
Location	TSS1500 (cg03371125)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.15E+00	Statistic Test	p-value:2.25E-02; Z-score:2.26E+00
Methylation in Case	8.26E-01 (Median)	Methylation in Control	7.17E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Significant hypermethylation of ABCB11 in prostate cancer than that in healthy individual
Studied Phenotype	Prostate cancer [ICD-11:2C82]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:0.017051985; Fold-change:0.360333949; Z-score:1.26583558
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Systemic lupus erythematosus	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of ABCB11 in systemic lupus erythematosus			[ 11 ]
Location	TSS200 (cg00295325)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:4.16E-04; Z-score:-3.52E-01
Methylation in Case	8.17E-01 (Median)	Methylation in Control	8.40E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of ABCB11 in pancretic ductal adenocarcinoma			[ 12 ]
Location	Body (cg04208466)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.00E+00	Statistic Test	p-value:1.54E-03; Z-score:-1.11E-01
Methylation in Case	8.86E-01 (Median)	Methylation in Control	8.88E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Anaplastic pilocytic astrocytoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Moderate hypomethylation of ABCB11 in anaplastic pilocytic astrocytoma than that in healthy individual
Studied Phenotype	Anaplastic pilocytic astrocytoma [ICD-11:2A00.0Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:1.53E-10; Fold-change:-0.295597231; Z-score:-1.538932128
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Anaplastic pleomorphic xanthoastrocytoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Moderate hypomethylation of ABCB11 in anaplastic pleomorphic xanthoastrocytoma than that in healthy individual
Studied Phenotype	Anaplastic pleomorphic xanthoastrocytoma [ICD-11:2A00.0Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:0.019461089; Fold-change:-0.218761157; Z-score:-0.874356095
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Craniopharyngioma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Moderate hypomethylation of ABCB11 in craniopharyngioma than that in healthy individual
Studied Phenotype	Craniopharyngioma [ICD-11:2F9A]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:0.003353029; Fold-change:-0.207730583; Z-score:-0.937268062
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Hemangioblastoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Moderate hypomethylation of ABCB11 in hemangioblastoma than that in healthy individual
Studied Phenotype	Hemangioblastoma [ICD-11:2F7C]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:1.03E-08; Fold-change:-0.241741058; Z-score:-2.090212325
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Melanocytoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Moderate hypomethylation of ABCB11 in melanocytoma than that in healthy individual
Studied Phenotype	Melanocytoma [ICD-11:2F36.2]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:0.011083397; Fold-change:-0.208858409; Z-score:-0.844106891
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Multilayered rosettes embryonal tumour	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Moderate hypomethylation of ABCB11 in multilayered rosettes embryonal tumour than that in healthy individual
Studied Phenotype	Multilayered rosettes embryonal tumour [ICD-11:2A00.1]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:1.26E-05; Fold-change:-0.276937013; Z-score:-1.254741734
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Prostate cancer metastasis	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Moderate hypomethylation of ABCB11 in prostate cancer metastasis than that in healthy individual
Studied Phenotype	Prostate cancer metastasis [ICD-11:2.00E+06]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:0.000275551; Fold-change:-0.279876166; Z-score:-20.97073859
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Brain neuroblastoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypomethylation of ABCB11 in brain neuroblastoma than that in healthy individual
Studied Phenotype	Brain neuroblastoma [ICD-11:2A00.11]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:1.91E-09; Fold-change:-0.37456554; Z-score:-1.682525817
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Cerebellar liponeurocytoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypomethylation of ABCB11 in cerebellar liponeurocytoma than that in healthy individual
Studied Phenotype	Cerebellar liponeurocytoma [ICD-11:2A00.0Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:0.003604809; Fold-change:-0.379516271; Z-score:-1.286820413
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Chordoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypomethylation of ABCB11 in chordoma than that in healthy individual
Studied Phenotype	Chordoma [ICD-11:5A61.0]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:9.49E-05; Fold-change:-0.438917705; Z-score:-2.784598927
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Esthesioneuroblastoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypomethylation of ABCB11 in esthesioneuroblastoma than that in healthy individual
Studied Phenotype	Esthesioneuroblastoma [ICD-11:2D50.1]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:7.64E-17; Fold-change:-0.792196565; Z-score:-3.365760322
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Glioblastoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypomethylation of ABCB11 in glioblastoma than that in healthy individual
Studied Phenotype	Glioblastoma [ICD-11:2A00.00]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:7.30E-10; Fold-change:-0.398486229; Z-score:-1.776461025
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Lymphoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypomethylation of ABCB11 in lymphoma than that in healthy individual
Studied Phenotype	Lymphoma [ICD-11:2B30]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:7.36E-18; Fold-change:-0.573845759; Z-score:-2.542306162
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Melanoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypomethylation of ABCB11 in melanoma than that in healthy individual
Studied Phenotype	Melanoma [ICD-11:2C30]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:0.001271; Fold-change:-0.302216161; Z-score:-1.265627539
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Peripheral neuroectodermal tumour	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypomethylation of ABCB11 in peripheral neuroectodermal tumour than that in healthy individual
Studied Phenotype	Peripheral neuroectodermal tumour [ICD-11:2B52]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:2.28E-08; Fold-change:-0.431814822; Z-score:-2.037152809
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Gastric cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypermethylation of ABCB11 in gastric cancer than that in adjacent tissue
Studied Phenotype	Gastric cancer [ICD-11:2B72]
The Methylation Level of Disease Section Compare with the Adjacent Tissue	p-value:0.047579786; Fold-change:0.422342137; Z-score:2.145426985
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue adjacent to the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data of patients in the normal section of the tissue adjacent to the disease section Download DT methylation data in the tissue of healthy individual
Histone acetylation
Rat liver	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Hyperacetylation of Abcb11 in liver (compare with kidney and cerebrum cells)			[ 13 ]
Location	Promoter
Epigenetic Type	Histone acetylation	Experiment Method	Chromatin immunoprecipitation
Related Molecular Changes	Up regulation ofAbcb11	Experiment Method	RT-qPCR
Studied Phenotype	Rat liver
Experimental Material	Model organism in vivo (mouse)
Additional Notes	The histone H3 associated with Oatp1b2 promoters was hyperacetylated in the liver but was acetylated very little in the kidney and cerebrum.
Histone methylation
Cholestasis	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Histone methylation of ABCB11 in Cholestasis			[ 14 ]
Location	Promoter
Epigenetic Type	Histone methylation	Experiment Method	.
Related Molecular Changes	Down regulation ofABCB11	Experiment Method	RT-qPCR
Studied Phenotype	Cholestasis[ ICD-11:5C50.1]
Experimental Material	CBDL mice & HepG2 cells
Additional Notes	MLL3 (as part of ASCOM complex) mediates H3K4me3 for FXR/GR-dependent activation of BSEP. Downregulated in cholestasis leading to reduced BSEP expression.
Hepatocellular carcinoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Histone methylation of ABCB11 in Hepatocellular carcinoma			[ 15 ]
Location	Promoter
Epigenetic Type	Histone methylation	Experiment Method	.
Related Molecular Changes	Down regulation ofABCB11	Experiment Method	.
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12]
Experimental Material	Ethanol-treated mice & HCC cells
Additional Notes	Alcohol exposure upregulates histone methyltransferases (RBBP-5/Suv39h1/ASH2L/SET7/9) and downregulates demethylases (JARID1a/b/c), leading to BSEP suppression. Altered BA homeostasis promotes HCC progression.
microRNA
Rat hepatocytes	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	miR-33 downregulates ABCB11 expression			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	Luciferase reporter assay
Related Molecular Changes	Down regulation ofABCB11	Experiment Method	RT-qPCR
miRNA Stemloop ID	miR-33	miRNA Mature ID	Unclear
miRNA Target Type	Direct
Studied Phenotype	Rat hepatocytes
Experimental Material	Model organism in vivo (mouse); Human hepato cellular carcinoma cell line (HuH-7)
Additional Notes	miR-33 controls the expression of biliary transporters, and mediates statin- and diet-induced hepatotoxicity via downregulates of ABCB11 expression.
Unclear Phenotype	16 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	miR-1266 directly targets ABCB11			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1266	miRNA Mature ID	miR-1266-3p
miRNA Sequence	CCCUGUUCUAUGCCCUGAGGGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon2	miR-138-2 directly targets ABCB11			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-138-2	miRNA Mature ID	miR-138-2-3p
miRNA Sequence	GCUAUUUCACGACACCAGGGUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon3	miR-1538 directly targets ABCB11			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1538	miRNA Mature ID	miR-1538
miRNA Sequence	CGGCCCGGGCUGCUGCUGUUCCU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon4	miR-3074 directly targets ABCB11			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3074	miRNA Mature ID	miR-3074-5p
miRNA Sequence	GUUCCUGCUGAACUGAGCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon5	miR-33a directly targets ABCB11			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	Luciferase reporter assay//qRT-PCR
miRNA Stemloop ID	miR-33a	miRNA Mature ID	miR-33a-5p
miRNA Sequence	GUGCAUUGUAGUUGCAUUGCA
miRNA Target Type	Direct
Experimental Material	Model organism in vivo (mouse); Human hepato cellular carcinoma cell line (HuH-7)
Epigenetic Phenomenon6	miR-4307 directly targets ABCB11			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4307	miRNA Mature ID	miR-4307
miRNA Sequence	AAUGUUUUUUCCUGUUUCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon7	miR-4433a directly targets ABCB11			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4433a	miRNA Mature ID	miR-4433a-3p
miRNA Sequence	ACAGGAGUGGGGGUGGGACAU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon8	miR-4433b directly targets ABCB11			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4433b	miRNA Mature ID	miR-4433b-3p
miRNA Sequence	CAGGAGUGGGGGGUGGGACGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon9	miR-449b directly targets ABCB11			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-449b	miRNA Mature ID	miR-449b-3p
miRNA Sequence	CAGCCACAACUACCCUGCCACU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon10	miR-4700 directly targets ABCB11			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4700	miRNA Mature ID	miR-4700-3p
miRNA Sequence	CACAGGACUGACUCCUCACCCCAGUG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon11	miR-4745 directly targets ABCB11			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4745	miRNA Mature ID	miR-4745-3p
miRNA Sequence	UGGCCCGGCGACGUCUCACGGUC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon12	miR-6504 directly targets ABCB11			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6504	miRNA Mature ID	miR-6504-3p
miRNA Sequence	CAUUACAGCACAGCCAUUCU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon13	miR-6720 directly targets ABCB11			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6720	miRNA Mature ID	miR-6720-3p
miRNA Sequence	CGCGCCUGCAGGAACUGGUAGA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon14	miR-6807 directly targets ABCB11			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6807	miRNA Mature ID	miR-6807-5p
miRNA Sequence	GUGAGCCAGUGGAAUGGAGAGG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon15	miR-7151 directly targets ABCB11			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-7151	miRNA Mature ID	miR-7151-3p
miRNA Sequence	CUACAGGCUGGAAUGGGCUCA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon16	miR-7152 directly targets ABCB11			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-7152	miRNA Mature ID	miR-7152-5p
miRNA Sequence	UUUCCUGUCCUCCAACCAGACC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human

References
1	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
3	DNA Methylation Dynamics in Urological Tumors.
4	Genome-wide Scan for Methylation Profiles in Breast Cancer
5	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6	DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
7	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
8	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
9	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
10	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
11	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
12	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
13	Analysis of DNA methylation and histone modification profiles of liver-specific transporters. Mol Pharmacol. 2009 Mar;75(3):568-76.
14	Histone H3K4 trimethylation by MLL3 as part of ASCOM complex is critical for NR activation of bile acid transporter genes and is downregulated in cholestasis. Am J Physiol Gastrointest Liver Physiol. 2011 May;300(5):G771-81.
15	Alcohol triggered bile acid disequilibrium by suppressing BSEP to sustain hepatocellular carcinoma progression. Chem Biol Interact. 2022 Apr 1;356:109847.
16	miR-33 controls the expression of biliary transporters, and mediates statin- and diet-induced hepatotoxicity. EMBO Mol Med. 2012 Sep;4(9):882-95.
17	Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
18	Circular RNAs are a large class of animal RNAs with regulatory potency. Nature. 2013 Mar 21;495(7441):333-8.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence